High-stability carbonyl reductase mutant and application thereof in synthesis of chiral alcohol

Abstract

The invention discloses a high-stability carbonyl reductase mutant and application of the high-stability carbonyl reductase mutant in chiral alcohol synthesis. An amino acid sequence as shown in SEQ ID NO.2 is mutated as follows: 20th leucine is replaced by any one of lysine, threonine, aspartic acid or isoleucine, and / or 55th leucine is replaced by any one of methionine, serine, lysine or isoleucine, and / or 55th leucine is replaced by any one of methionine, serine, lysine or isoleucine. Compared with a wild type enzyme, the stability of the obtained mutant is remarkably improved, particularly, single-point mutants Mut-L20I and Mut-L55I and a combined mutant Mut-L20I-L55I show excellent relative enzyme activity, thermal stability and substrate tolerance. The mutant has high catalytic activity and stability to various chiral alcohols, has the advantages of high catalytic efficiency, high thermal stability, strong substrate tolerance, easiness in fermentation production and the like, and is suitable for industrial application of enzymatic synthesis of chiral alcohols.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of a high-stability carbonyl reductase and its mutants in the synthesis of chiral alcohol. BACKGROUND

[0002] Chiral alcohol is a chemical synthesis method with stereoselectivity, which selectively obtains unequal optical isomer products by the action of reagents on a non-chiral group in the molecule, also known as stereoselective synthesis. Chiral alcohol is an important intermediate for the synthesis of chiral drugs, and is widely used in various fields such as drugs, fragrances, cosmetics, etc.

[0003] Carbonyl reductase is a class of enzymes that can catalyze the reduction of carbonyl compounds to chiral alcohol, with high stereoselectivity and substrate adaptability. However, wild-type carbonyl reductase is often limited in industrial applications due to insufficient thermal stability and substrate tolerance. To solve this problem, the present application optimizes the key amino acid sites of carbonyl reductase through directed mutation technology, significantly improving the thermal stability and catalytic efficiency of the enzyme. The present application particularly emphasizes the high stability of carbonyl reductase, and through optimization of mutation sites, the enzyme can still maintain high catalytic activity under high temperature and complex substrate conditions. This high stability not only reduces the risk of enzyme inactivation in industrial production, but also significantly improves reaction efficiency and product yield. In addition, the mutant enzyme has green chemistry characteristics, and the reaction can be completed without harsh conditions, further reducing environmental burden. Overall, the present application provides an innovative solution for efficient and green synthesis of chiral alcohol.

[0004] Florfenicol is a chloramphenicol antibiotic widely used in the field of veterinary medicine. The key precursor of its synthesis is D-ethyl ester and its analogues, which contain adjacent chiral centers, making synthesis difficult. Currently, the industrial production of D-ethyl ester at home and abroad mainly relies on the traditional method of aldol condensation and L-(+)-tartaric acid resolution. However, this method has poor atom economy and high production cost. The method of dynamic reduction kinetic resolution of carbonyl reductase on p-tolylsulfonyl-α-amino-β-keto ester substrate can effectively make up for the shortcomings of the traditional route. This method not only improves the synthesis efficiency of chiral alcohol, but also significantly reduces environmental pollution and production cost, providing a new solution for the green synthesis of florfenicol.

[0005] Vibegron is a beta3 adrenergic receptor agonist drug for the treatment of overactive bladder (OAB). OAB is a common clinical condition with main symptoms including urinary urgency, urinary frequency and urgency incontinence, which has a serious impact on the quality of life of patients. Vibegron can effectively relieve the symptoms related to OAB by selectively activating the beta3 adrenergic receptor, relaxing the bladder detrusor smooth muscle and increasing the bladder capacity. Methyl (2S, 3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoate ((2S, 3R)-aminohydroxylate) is a key chiral intermediate for the synthesis of vibegron. There are studies on the construction of a coupling system of NADPH-dependent carbonyl reductase KRED and glucose dehydrogenase GDH for the asymmetric reduction of methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropanoate ((S)-aminoketoester) to the product (2S, 3R)-aminohydroxylate. However, the enzymatic catalytic asymmetric reduction reaction has a low yield in the synthesis of chiral alcohol.

[0006] Duloxetine is a serotonin and norepinephrine reuptake inhibitor for the treatment of various mental diseases. Its key chiral intermediate is ethyl (S)-3-hydroxy-3-(thiophen-2-yl)propanoate ((S)-HEES). Rosuvastatin is a selective HMG-CoA reductase inhibitor for reducing cholesterol levels, and its key chiral intermediate is tert-butyl (3R, 5S)-6-chloro-3, 5-dihydroxyhexanoate ((3R, 5S)-CDHH). Atorvastatin is a lipid-lowering drug, and its key chiral intermediate is tert-butyl (3R, 5R)-6-cyano-3, 5-dihydroxyhexanoate ((3R, 5R)-CNHH).

[0007] In the biosynthesis process of pharmaceutical chemicals, carbonyl reductase-mediated asymmetric catalytic synthesis of chiral alcohol is a key technical link. Although biocatalysis has significant advantages over traditional chemical synthesis, there are still technical bottlenecks in industrial application. The traditional chemical path relies on multi-step chemical reactions and high-consumption organic solvents, which not only have poor atom economy, but also produce a large amount of waste. Although the biological catalytic system can avoid the above defects, it still needs to overcome the core problems such as unstable catalytic activity of enzyme protein, limited substrate tolerance and low efficiency of coenzyme regeneration. Through the innovation of enzyme molecules, the product yield and process economy can be effectively improved, which provides technical support for establishing a low-carbon emission green manufacturing paradigm of drugs. SUMMARY

[0008] In order to solve the technical problems of poor stability and low yield of carbonyl reductase-mediated synthesis of chiral alcohol, the present application provides a high-stability carbonyl reductase mutant and its application in enzymatic synthesis of chiral alcohol.

[0009] The technical scheme adopted by the present application is as follows:

[0010] A carbonyl reductase mutant is obtained by single-point mutation or multi-point combined mutation of the 20th and 55th positions of the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence of the carbonyl reductase shown in SEQ ID NO. 2 is derived from Exiguobacterium sp.

[0011] As a preferred, the mutation is one or a combination of the following two:

[0012] (1) the 20th leucine is mutated to any one of lysine, threonine, aspartic acid and isoleucine;

[0013] (2) the 55th leucine is mutated to any one of methionine, serine, lysine and isoleucine;

[0014] Further, the mutant is preferably one of the following:

[0015] (a) the 20th leucine in the amino acid sequence shown in SEQ ID NO. 2 is mutated to isoleucine (L20I);

[0016] (b) the 55th leucine in the amino acid sequence shown in SEQ ID NO. 2 is mutated to isoleucine (L55I);

[0017] (c) the 20th leucine in the amino acid sequence shown in SEQ ID NO. 2 is mutated to isoleucine, and the 55th leucine is mutated to isoleucine (L20I-L55I).

[0018] More preferably, the carbonyl reductase mutant is obtained by mutating the leucine at position 20 to isoleucine and mutating the leucine at position 55 to isoleucine of the amino acid sequence shown in SEQ ID NO. 2, and is named mutant Mut-L20I-L55I, the nucleotide sequence of which is shown in SEQ ID NO. 3 and the amino acid sequence of which is shown in SEQ ID NO. 4.

[0019] Due to the specificity of the amino acid sequence, any peptide protein fragment or variant thereof, such as a conservative variant, a biologically active fragment or a derivative thereof, containing the amino acid sequence shown in the present application, as long as the peptide protein fragment or peptide protein variant has more than 90% homology with the aforementioned amino acid sequence, belongs to the protection scope of the present application. Specifically, the changes include deletion, insertion or substitution of amino acids in the amino acid sequence; wherein, for conservative changes of the variant, the substituted amino acid has similar structure or chemical properties to the original amino acid, and the enzyme variant can also have non-conservative changes.

[0020] The present application also provides a coding gene of the carbonyl reductase mutant.

[0021] Specifically, the nucleotide sequence of the coding gene corresponding to the amino acid sequence shown in SEQ ID NO. 2 is shown in SEQ ID NO. 1.

[0022] Due to the specificity of the nucleotide sequence, any variant of the polynucleotide shown in the present application, as long as it has more than 90% homology with the aforementioned polynucleotide, belongs to the protection scope of the present application. The variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide changes. This variant of the polynucleotide can be a living variant or a non-living variant, including a substitution variant, a deletion variant and an insertion variant. As known in the art, an allelic variant is a substitution form of a polynucleotide, which can be a substitution, deletion or insertion of a polynucleotide, but will not substantially change the function of the encoded peptide protein.

[0023] The present application also provides a recombinant vector containing the coding gene of the carbonyl reductase mutant. The recombinant vector comprises a polynucleotide operably linked to a control sequence suitable for directing expression in a host cell. Various vectors, such as various plasmids, bacteriophages or viral vectors, etc. in the art, linked to the novel carbonyl reductase mutant nucleotide sequence of the present application, should belong to the protection scope of the present application. The recombinant vector preferably uses plasmid pET28b as an expression vector, and the coding gene of the novel carbonyl reductase mutant is linked to the plasmid pET28b.

[0024] The present application also provides a genetically engineered bacterium containing the coding gene of the carbonyl reductase mutant, and the genetically engineered bacterium is constructed by using a recombinant vector containing the coding gene of the carbonyl reductase mutant. The recombinant genetically engineered bacterium is generally constructed by connecting the coding gene of the carbonyl reductase mutant with an expression vector pET28b to construct a recombinant vector containing the coding gene of the carbonyl reductase mutant, and then transforming the recombinant vector into a host cell to obtain a genetically engineered bacterium containing the recombinant plasmid. The host cell can be a bacterium, a fungus, a plant cell or an animal cell, and preferably Escherichia coli BL21 (DE3) is used as an expression host.

[0025] The coding gene of the carbonyl reductase mutant is introduced into a host cell by genetic engineering technology to construct a genetically engineered bacterium and perform expression, so as to obtain the carbonyl reductase mutant of the present application.

[0026] The carbonyl reductase mutant can be obtained by the following method:

[0027] A recombinant vector containing the coding gene of the carbonyl reductase mutant is constructed, the recombinant vector is transformed into a host bacterium, and the obtained genetically engineered bacterium is induced to culture, and then the wet bacterium containing the carbonyl reductase mutant is separated from the culture solution. After the wet bacterium is broken, the crude enzyme solution of the carbonyl reductase mutant M6 is obtained, and the crude enzyme solution is purified to obtain the pure enzyme of the carbonyl reductase mutant.

[0028] In the present application, the carbonyl reductase mutant can be used in various forms. For example, the resting cell or the wet bacterium expressing the carbonyl reductase mutant of the present application can be used, and various different forms such as the crude enzyme solution, the pure enzyme or the crude enzyme powder can also be used, or the immobilized enzyme can also be used.

[0029] The present application also provides the application of the carbonyl reductase mutant in the synthesis of chiral alcohol. The chiral alcohol is a duloxetine intermediate, a florfenicol intermediate, a rosuvastatin intermediate, an atorvastatin intermediate or a vibegron intermediate.

[0030] Further, the method of the application is as follows: the wet bacterium obtained by fermentation culture of the genetically engineered bacterium containing the coding gene of the carbonyl reductase mutant, the crude enzyme solution after breaking the wet bacterium or the extracted pure enzyme are used as catalysts, a chiral ketone is used as a substrate, and a biological catalytic reaction is performed to prepare a corresponding chiral alcohol.

[0031] The chiral ketone is (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3- phenylpropanoic acid methyl ester, 2-acetamido-3-(4-(methylsulfonyl)phenyl)-3- oxopropanoic acid methyl ester, 3-oxo-3-(2-thienyl)propanoic acid ethyl ester, (S)-6-chloro-5-hydroxy-3-oxohexanoic acid tert-butyl ester ((S)-CHOH), 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester, and the corresponding chiral alcohol is (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoic acid methyl ester (a vibegron intermediate), (2S,3R)-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoic acid methyl ester (a florfenicol intermediate), (S)-3-hydroxy-3-(2-thienyl)propanoic acid ethyl ester ((S)-HEES, a duloxetine intermediate), (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester ((3R,5S)-CDHH, a rosuvastatin intermediate), and (3R,5R)-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester (an atorvastatin intermediate).

[0032] Further, the application provides a method for preparing a chiral alcohol, comprising the following steps:

[0033] A wet cell, a crude enzyme solution or a pure enzyme extracted from a genetically engineered bacterium containing a gene encoding a carbonyl reductase mutant is used as a catalyst, a chiral ketone is used as a substrate, glucose is used as a co-substrate, coenzyme NADPH and glucose dehydrogenase are added, and a reaction system is formed in a buffer solution with a pH value of 6.0-8.0 to prepare a corresponding chiral alcohol.

[0034] The temperature of the reaction is preferably 25-40°C, and the stirring speed is preferably 200-800 rpm. The reaction time is preferably 1-30 h.

[0035] The buffer solution is preferably a 100 mM phosphate buffer solution with a pH value of 6.5-7.0. The phosphate can be sodium phosphate or potassium phosphate.

[0036] When the catalyst is in the form of a wet cell, the amount of the carbonyl reductase mutant wet cell is 10-40 g / L of the buffer solution based on the weight of the wet cell. Since the wet cell contains coenzyme, there is no need to add additional NADPH.

[0037] When the catalyst is in the form of a crude enzyme solution, the amount of the carbonyl reductase mutant crude enzyme solution is 10-40 g / L.

[0038] The concentration of the chiral ketone substrate is 50-400 g / L.

[0039] The final concentration of coenzyme NADPH is 1-5 g / L.

[0040] The final concentration of glucose dehydrogenase is 5-15 g / L.

[0041] The final concentration of glucose is 10-200 g / L.

[0042] In some application methods, a cosolvent such as DMSO, n-butyl acetate, isopropyl alcohol, etc. needs to be added to the reaction system.

[0043] The volume of the cosolvent is generally 10-50% of the reaction system.

[0044] The wet bacteria can be prepared by the following method: genetically engineered bacteria containing the coding gene of the carbonyl reductase mutant are inoculated into LB liquid medium containing kanamycin resistance with a final concentration of 50 mg / L, and cultured at 37 DEG C and 200 rpm for 6-8 h, then inoculated into fresh LB liquid medium containing kanamycin resistance with a final concentration of 50 mg / L at a volume concentration of 1-5%, and cultured at 37 DEG C and 200 rpm for 2 h, then 0.1-0.3 mM IPTG is added, and the culture is induced at 28 DEG C and 200 rpm for 12 h, then centrifuged at 4 DEG C and 8000 rpm for 15 min, the supernatant is discarded, and the wet bacteria are collected.

[0045] In the present application, coenzyme NADPH and glucose dehydrogenase are added to form an enzyme-enzyme coupled coenzyme regeneration system, and glucose is added as a co-substrate. The carbonyl reductase mutant is first combined with coenzyme NADPH to form a whole enzyme, the substrate enters the substrate binding pocket of the enzyme, obtains one [H] reduced by NADPH transmission, and at the same time NADPH is oxidized to lose [H], then the oxidized NADP is separated from the enzyme, the product is released from the active center, and finally the oxidized NADP is reduced to NADPH by chiral substances or enzymes for recycling.

[0046] The present application provides an enzyme-catalyzed method for synthesizing chiral alcohols.

[0047] The wet bacteria obtained by fermentation culture of genetically engineered bacteria containing the coding gene of the carbonyl reductase mutant, the crude enzyme solution after breaking the wet bacteria, or the extracted pure enzyme is used as a catalyst, and chiral ketones are used as substrates to perform biological catalytic reaction, so that corresponding chiral alcohols are prepared.

[0048] The present application also provides a preparation method of a florfenicol intermediate. The wet bacteria obtained by fermentation culture of genetically engineered bacteria containing the coding gene of the carbonyl reductase mutant, the crude enzyme solution after breaking the wet bacteria, or the extracted pure enzyme is used as a catalyst, and 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionic acid methyl ester is used as a substrate to perform biological catalytic reaction, so that (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionic acid methyl ester, i.e. the florfenicol intermediate, is prepared.

[0049] Preferably, the method adds cosolvent DMSO, the volume is 10-20% of the reaction system.

[0050] The application also provides a preparation method of a duloxetine intermediate, wherein a wet bacterium obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, ethyl (S)-3-hydroxy-3-(2-thienyl) propanoate ((S)-HEES) is prepared by biocatalysis with ethyl 3-oxo-2-(3-thienyl) propanoate (KEES) as a substrate.

[0051] The application also provides a preparation method of a rosuvastatin intermediate, wherein a wet bacterium obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, (3R, 5S)-6-chloro-3, 5-dihydroxyhexanoic acid tert-butyl ester ((3R, 5S)-CDHH) is prepared by biocatalysis with (S)-6-chloro-5-hydroxy-3-hydroxyhexanoic acid tert-butyl ester ((S)-CHOH) as a substrate.

[0052] The application also provides a preparation method of an atorvastatin intermediate, wherein a wet bacterium obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, (3R, 5R)-6-cyano-3, 5-dihydroxyhexanoic acid tert-butyl ester is prepared by biocatalysis with 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester as a substrate.

[0053] The application also provides a preparation method of a vibexolone intermediate, wherein a wet bacterium obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, (2S, 3R)-2-((tert-butoxycarbonyl) amino)-3-hydroxy-3-phenylpropionic acid methyl ester ((2S, 3R)-aminohydroxy ester) is prepared by biocatalysis with (S)-2-((tert-butoxycarbonyl) amino)-3-oxo-3-phenylpropionic acid methyl ester ((S)-aminoketone ester) as a substrate.

[0054] Preferably, the method adds cosolvent n-butyl acetate, the volume is 30-50% of the reaction system.

[0055] Compared with the prior art, the application has the following technical effects:

[0056] The carbonyl reductase mutant provided by the application has significantly improved stability compared to the wild-type enzyme, and the single-point mutant Mut-L20I, Mut-L55I and the combined mutant Mut-L20I-L55I exhibit excellent relative enzyme activity, thermal stability and substrate tolerance. After incubation at 50℃ for 1h, the relative enzyme activity of the combined mutant Mut-L20I-L55I can be maintained at more than 90%, and after incubation at 55℃ for 0.5h, the relative enzyme activity of the combined mutant Mut-L20I-L55I can be maintained at more than 75%, while the wild-type enzyme has no enzyme activity at this time. The mutant of the application exhibits very excellent thermal stability.

[0057] In addition, the carbonyl reductase mutant has high catalytic activity and stability for various chiral alcohols, and has the advantages of high catalytic efficiency, high thermal stability, strong substrate tolerance and easy fermentation production, and is suitable for industrial application of enzyme synthesis of chiral alcohols. BRIEF DESCRIPTION OF DRAWINGS

[0058] Figure 1 SDS-PAGE diagram of wild-type carbonyl reductase and its mutants. Figure 1 In the figure, lane M is a protein molecular weight marker, lane 1 is a pure enzyme of the original strain WT of the carbonyl reductase, lane 2 is a Mut-L20I pure enzyme, lane 3 is a Mut-L55I pure enzyme, and lane 4 is a Mut-L20I-L55I pure enzyme. DETAILED DESCRIPTION

[0059] The application will be further described below in conjunction with examples. Those skilled in the art will be able to implement the application based on these descriptions. In addition, the examples of the application involved in the following description are generally only a part of the examples of the application, not all examples. Therefore, based on the examples in the application, all other examples obtained by those skilled in the art without creative labor shall fall within the scope of protection of the application.

[0060] In the examples of the application, the amino acid sequence of the wild-type carbonyl reductase (derived from Exiguobacterium sp.) is shown in SEQ ID NO. 2, and the encoding gene is shown in SEQ ID NO. 1.

[0061] The amino acid sequence of SEQ ID NO. 2 is as follows: MKYTVITGAS SGIGYETAKL LAEKGKSLVL VARRTKELES LRDEIKSISP DSDVLIESID LS YSENVYAL YESLTNLDIE TWINNAGFGD FDLVQDVDLG KIEKMLRLNI EALTVLSSLY VRDYHDVEGA QLLNVSSAGG YRIVPNAVTY CATKFYVSAY TEGLAQELIH NDAKLRAKVL APAATETEFA DRSRDQEGFDYSQNVPKYHT AREMAEFLYQ LLESDQIVGI VNHEDYSFNL RGPIKPYAG.

[0062] Example 1: Construction of carbonyl reductase mutant

[0063] (1) The wild-type carbonyl reductase-encoding gene (nucleotide sequence as shown in SEQ ID NO. 1) was linked to the expression vector pET28b to construct a heterologous expression recombinant plasmid pET28b(+)-WT containing the carbonyl reductase-encoding gene. The expression recombinant plasmid was transformed into host bacteria E. coli BL21(DE3) competent cells to obtain a recombinant genetically engineered bacteria E. coli BL21(DE3) / pET28b(+)-WT containing the expression recombinant plasmid of carbonyl reductase, i.e. a carbonyl reductase engineered bacteria.

[0064] After thawing the carbonyl reductase engineered bacteria E. coli BL21(DE3) / pET28b(+)-WT on ice, the bacterial solution was streaked on a kanamycin-resistant LB plate and incubated at 37°C for 12 h. A single colony was inoculated into 10 mL of LB test tube with a final concentration of 50 mg / L of kanamycin resistance and incubated at 37°C with 200 rpm shaking for 6-8 h. The bacterial solution in the 2 mL test tube was inoculated into 50 mL of LB flask with a final concentration of 50 mg / L of kanamycin resistance and incubated at 37°C with 200 rpm shaking for 2 h. Then 50 μL of 0.1 M IPTG was added and the culture was incubated at 28°C with 200 rpm shaking for 12 h. The bacterial cells were collected by centrifugation at 4°C with 8000 rpm for 10 min and stored at -20°C.

[0065] (2) The prepared carrier heterologous expression recombinant plasmid pET28b(+)-WT was used as a template, and the site-directed mutation primer shown in Table 1 was used to introduce mutations by PCR. In Table 1, the underlined mutation sites in the primer sequence are shown, wherein the primer L20-R, L20I-F is used in the PCR for mutating the 20th leucine of the wild-type enzyme to isoleucine, the primer L20-R, L20K-F is used in the PCR for mutating the 20th leucine of the wild-type enzyme to lysine, the primer L20-R, L20T-F is used in the PCR for mutating the 20th leucine of the wild-type enzyme to threonine, the primer L20-R, L20D-F is used in the PCR for mutating the 20th leucine of the wild-type enzyme to aspartic acid, the primer L55-R, L55M-F is used in the PCR for mutating the 55th leucine of the wild-type enzyme to methionine, the primer L55-R, L55S-F is used in the PCR for mutating the 55th leucine of the wild-type enzyme to serine, the primer L55-R, L55K-F is used in the PCR for mutating the 55th leucine of the wild-type enzyme to lysine, and the primer L55-R, L55I-F is used in the PCR for mutating the 55th leucine of the wild-type enzyme to isoleucine.

[0066] Table 1 Primer Sequence 5'-3' L20K-F AAACGGCCAAA AAG CTGGCCGAAAAAGGCAAAAG]]> L20T-F AAACGGCCAAA ACA CTGGCCGAAAAAGGCAAAAG]]> L20D-F AAACGGCCAAA GAC CTGGCCGAAAAAGGCAAAAG]]> L20I-F AAACGGCCAAA ATA CTGGCCGAAAAAGGCAAAAG]]> L20-R TTTGGCCGTTTCATAACCAATGCCG L55M-F TAGCGATGTT ATG ATTGAAAGCATTGATC]]> L55S-F TAGCGATGTT AGC ATTGAAAGCATTGATC]]> L55K-F TAGCGATGTT AAA ATTGAAAGCATTGATC]]> L55I-F TAGCGATGTT ATA ATTGAAAGCATTGATC]]> L55-R AACATCGCTATCCGGGCTAATGCT .

[0067] The PCR reaction program for introducing mutations by PCR is as follows: 98℃ 5 min, 98℃ 30 S, 56℃ 30 S, 72℃ 4 min, 31 cycles of repeating; 72℃ continue to extend for 5 min.

[0068] The PCR product was treated with DpnI at 37℃ for 3 h, and after inactivation, it was transformed into E. coli BL21(DE3) recipient bacteria, and then coated on LB solid plates containing a final concentration of 50 mg / L kanamycin, and cultured at 37℃ for 12 h. Randomly picked single colonies were subjected to sequencing analysis and confirmation, and each carbonyl reductase mutant and wet bacteria were obtained.

[0069] Mutant enzyme in which the 20th leucine of the wild-type enzyme is mutated to lysine is denoted Mut-L20K, mutant enzyme in which the 20th leucine of the wild-type enzyme is mutated to threonine is denoted Mut-L20T, mutant enzyme in which the 20th leucine of the wild-type enzyme is mutated to aspartic acid is denoted Mut-L20D, mutant enzyme in which the 20th leucine of the wild-type enzyme is mutated to isoleucine is denoted Mut-L20I, mutant enzyme in which the 55th leucine of the wild-type enzyme is mutated to methionine is denoted Mut-L55M, mutant enzyme in which the 55th leucine of the wild-type enzyme is mutated to serine is denoted Mut-L55S, mutant enzyme in which the 55th leucine of the wild-type enzyme is mutated to lysine is denoted Mut-L55K, and mutant enzyme in which the 55th leucine of the wild-type enzyme is mutated to isoleucine is denoted Mut-L55I.

[0070] (3) Mutations are introduced by PCR using plasmid DNA containing the Mut-L55I gene as a template, and the mutant primers are combined as follows (the positions marked with underlines are mutation sites):

[0071] L20K-L55I-F: 5'-AAACGGCCAAA AAG CTGGCCGAAAAAGGCAAAAG-3';

[0072] L20K-L55I-R: 5'-TTTGGCCGTTTCATAACCAATGCCG-3'.

[0073] The PCR reaction program for introducing mutations by PCR is the same as in step (2), and a recombinant carbonyl reductase combination mutant Mut-L20K-L55I and wet bacteria thereof are obtained.

[0074] (4) Mutations are introduced by PCR using plasmid DNA containing the Mut-L55I gene as a template, and the mutant primers are combined as follows (the positions marked with underlines are mutation sites):

[0075] L20I-L55I-F-F: 5'-AAACGGCCAAA ATA CTGGCCGAAAAAGGCAAAAG-3';

[0076] L20I-L55I-F-R: 5'-TTTGGCCGTTTCATAACCAATGCCG-3'.

[0077] The PCR reaction program for introducing mutations by PCR is the same as in step (2), and a recombinant carbonyl reductase combination mutant Mut-L20I-L55I and wet bacteria thereof are obtained. The nucleotide sequence of the mutant Mut-L20I-L55I is shown in SEQ ID NO. 3, and the amino acid sequence is shown in SEQ ID NO. 4.

[0078] like Figure 1 The image shown is an SDS-PAGE image of the above-mentioned wild-type carbonyl reductase and its mutants. Figure 1 In the diagram, lane M represents the protein molecular weight marker, lane 1 represents the pure enzyme from the original carbonyl reductase strain WT, lane 2 represents the pure enzyme from Mut-L20I, lane 3 represents the pure enzyme from Mut-L55I, and lane 4 represents the pure enzyme from Mut-L20I-L55I.

[0079] Example 2: Screening for highly thermally stable carbonyl reductase mutants

[0080] The carbonyl reductase mutant obtained in Example 1 was analyzed by measuring its residual enzyme activity at 50 °C. o After incubation at C for 1 hour, 55 o After incubation at C for 0.5 h, the remaining enzyme activity was measured to determine the optimal mutant. The steps are as follows:

[0081] (1) Preparation of crude enzyme solution: The strain containing the carbonyl reductase mutant encoding gene obtained in Example 1 was inoculated into LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance and cultured at 37°C and 200 rpm for 6-8 h. Then, it was inoculated into fresh LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance at a volume concentration of 2% and cultured at 37°C and 200 rpm for 2 h. 100 µL of 0.1 M IPTG was added and the culture was induced at 28°C and 200 rpm for 12 h. After centrifugation at 4°C and 8000 rpm for 10 min, the supernatant was discarded and the wet bacterial cells were collected. 125 mg of the wet bacterial cells of the mutant was weighed and resuspended in 10 mL of sodium phosphate buffer and cultured at 4°C and 4000 rpm for 10 min. o Sonication was performed under ice bath conditions until the bacterial solution became clear (220 W, 1 second, 2 seconds). Each crude enzyme solution was then subjected to separate incubation at 50 °C. o Incubate at C for 1 hour, then at 55°C o Incubate at C for 0.5 h.

[0082] (2) 500µL reaction system: 150µL NADP + 50µL glucose, 50µL of 50 o The crude enzyme solution, incubated at C for 1 h, was combined with 100 µL of methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionate ((S)-aminoketone ester) stock solution, and brought to a final volume of 500 µL with sodium phosphate buffer. The mixture was shaken at 1100 rpm and incubated at 35°C. oThe reaction was carried out in a shaking reactor of type C, and samples were taken immediately after 10 min. The mother liquor substrate (S)-amino ketone ester concentration was 50 g / L (solvent: dimethyl sulfoxide), the mother liquor co-substrate glucose concentration was 180 g / L (solvent: sodium phosphate buffer), and the mother liquor coenzyme NADP... + The concentration was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC, and the relative enzyme activity was calculated. The initial enzyme activity of each mutant was set as 100%, and 50... o The remaining enzyme activity after incubation at C for 1 h is shown in Table 2.

[0083] (3) 500µL reaction system: 150µL NADP + 50µL glucose, 50µL of 55 o The crude enzyme solution, incubated at C for 0.5 h, was combined with 100 µL of substrate (S)-amino ketone ester stock solution and brought to a final volume of 500 µL with sodium phosphate buffer. The mixture was shaken at 1100 rpm and incubated at 35°C. o The reaction was carried out in a shaking reactor of type C, and samples were taken immediately after 10 min. The mother liquor substrate (S)-amino ketone ester concentration was 50 g / L (solvent: dimethyl sulfoxide), the mother liquor co-substrate glucose concentration was 180 g / L (solvent: sodium phosphate buffer), and the mother liquor coenzyme NADP... + The concentration was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC, and the relative enzyme activity was calculated. The initial enzyme activity of each mutant was set as 100%, and the enzyme activity was measured at 55 °C. o The remaining enzyme activity after incubation at C for 0.5 h is shown in Table 2.

[0084] Table 2 Comparison of Remaining Enzyme Activities Enzyme 50 o C Incubation 1 h remaining enzyme activity (%)]]> 55 o C Incubation 0.5 h remaining enzyme activity (%)]]> Wild type 1.89 - Mut-L20K 20.36 2.98 Mut-L20T 15.23 - Mut-L20D 13.69 - Mut-L20I 38.26 15.86 Mut-L55M 59.68 20.69 Mut-L55S 60.53 26.36 Mut-L55K 48.69 25.75 Mut-L55I 88.89 59.87 Mut-L20K-L55I 82.36 68.64 Mut-L20I-L55I 93.21 75.77 .

[0085] As shown in Table 2, based on the results of the residual enzyme activity determination, Example 1 improved the thermostability of carbonyl reductase through site-directed mutagenesis. The optimal mutant for a single mutant was Mut-L55I, and the optimal mutant obtained after combining mutations at different mutation sites was Mut-L20I-L55I. In addition, the single mutants Mut-L20I, Mut-L55S, Mut-L55M, and Mut-L55K also showed good thermostability.

[0086] As shown in Table 2, the thermostability of the carbonyl reductase mutants Mut-L20I, Mut-L55I, and Mut-L20I-L55I was significantly improved.

[0087] Example 3: Determination of the relative enzyme activity of carbonyl reductase mutants

[0088] The relative enzyme activity of the carbonyl reductase mutant obtained in Example 1 was determined. The steps were as follows:

[0089] (1) Preparation of crude enzyme solution: the method was the same as that in Example 2.

[0090] (2) 500 μL reaction system: 150 μL NADP + , 50 μL glucose, 50 μL of 35 o C crude enzyme solution incubated for 24 h, 100 μL substrate (S)-aminoketone ester solution, and sodium phosphate buffer to complete 500 μL, 1100 rpm shaking, reaction in a shaking reactor at 35 o C, sampling immediately after 10 min of reaction. The concentration of the mother liquor substrate (S)-aminoketone ester was 50 g / L (solvent was dimethyl sulfoxide), the concentration of the mother liquor auxiliary substrate glucose was 180 g / L (solvent was sodium phosphate buffer), and the concentration of the mother liquor coenzyme NADP + was 1 g / L (solvent was sodium phosphate buffer). The yield of (2S, 3R)-aminohydroxy ester was determined by HPLC analysis, and the relative enzyme activity was calculated, and the results are shown in Table 3.

[0091] Table 3 Comparison of relative enzyme activity Enzyme Relative enzyme activity (%) Wild type 100.00 Mut-L20K 103.65 Mut-L20T 98.54 Mut-L20D 89.56 Mut-L20I 118.65 Mut-L55M 105.69 Mut-L55S 108.45 Mut-L55K 110.36 Mut-L55I 125.44 Mut-L20K-L55I 102.45 Mut-L20I-L55I 122.89 .

[0092] As can be seen from the determination results of the relative enzyme activity in Table 3, the stability of the carbonyl reductase was improved by the site-directed mutagenesis technology in Example 1, and the relative enzyme activity of the mutants Mut-L20I, Mut-L55I, and Mut-L20I-L55I was better.

[0093] Example 4: Application of carbonyl reductase mutants in the preparation of florfenicol intermediates

[0094] The single-point mutants Mut-L20I, Mut-L55I with better thermal stability and the combined mutant Mut-L20I-L55I were selected for application in the preparation of florfenicol intermediates. The specific steps were as follows:

[0095] The composition of the catalytic system and the catalytic conditions were as follows:

[0096] 20 mL reaction system: 100 mM, pH 7.0 sodium phosphate buffer solution, cosolvent DMSO (amounting to 20%), addition of crude enzyme solution of carbonyl reductase (amounting to 20 g / L, prepared by the same method as in Example 2) and glucose dehydrogenase (amounting to 10 g / L), glucose 200 mM, NADP +2 g / L, substrate 2-acetamido-3-(4-(methylsulfonyl)phenyl)-3-oxopropanoic acid methyl ester 100 g / L, complete to 20 mL with sodium phosphate buffer.

[0097] The reaction system was placed in a 35 o C water bath, magnetic stirring device 600 rpm, reaction for 24 h. During the reaction, sample was taken at regular intervals, sample volume 200 μL, after separation and purification, diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0098] The results showed that after 24 h of catalysis, the yield of (2S, 3R)-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoic acid methyl ester produced by WT catalysis reached 75.4%, e.e.>99%; Mut-L20I reached 85.3%, e.e.>99%; Mut-L55I reached 97.2%, e.e.>99%; Mut-L20I-L55I reached 99.8%, e.e.>99%.

[0099] Example 5: Application of carbonyl reductase mutants in the preparation of duloxetine intermediates

[0100] The single-point mutants Mut-L20I, Mut-L55I with better thermal stability and the combined mutant Mut-L20I-L55I were selected for application in the preparation of duloxetine intermediates. The specific steps are as follows:

[0101] The composition of the catalytic system and the catalytic conditions are as follows:

[0102] 20 mL reaction system: crude enzyme solution (preparation method same as example 2) 20 g / L, substrate KEES 150 g / L, cosolvent n-butyl acetate (amount 50%), co-substrate glucose 100 mM (solvent sodium phosphate buffer), glucose dehydrogenase (amount 10 g / L), coenzyme NADP + 3 g / L (solvent sodium phosphate buffer). Complete to 20 mL with sodium phosphate buffer.

[0103] The reaction system was placed in a 35 o C water bath, magnetic stirring device 600 rpm, reaction for 24 h. During the reaction, sample was taken at regular intervals, sample volume 200 μL, after separation and purification, diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0104] The results show that after 24 h of catalysis, the yield of (S)-HEES produced by WT catalysis reaches 79.9%, e.e.>99%; Mut-L20I reaches 88.31%, e.e.>99%; Mut-L55I reaches 91.6%, e.e.>99%; Mut-L20I-L55I reaches 97.9%, e.e.>99%.

[0105] Example 6: Application of carbonyl reductase mutants in preparation of rosuvastatin intermediates

[0106] The single-point mutants Mut-L20I, Mut-L55I with better thermal stability and the combined mutant Mut-L20I-L55I are selected for application in preparation of rosuvastatin intermediates. The specific steps are as follows:

[0107] The composition of the catalytic system and the catalytic conditions are as follows:

[0108] 20 mL reaction system: crude enzyme solution (preparation method is the same as that in Example 2) is weighed at 20 g / L, substrate (S)-CHOH is 150 g / L, cosolvent n-butyl acetate (amount is 50%), auxiliary substrate glucose is 100 mM (solvent is sodium phosphate buffer), glucose dehydrogenase (amount is 10 g / L), coenzyme NADP + is 3 g / L (solvent is sodium phosphate buffer). Sodium phosphate buffer is used to complete to 20 mL.

[0109] The reaction system is placed in a 35 o C water bath, a magnetic stirring device is 600 rpm, reaction is 24 h, reaction is sampled at regular time, the sampling volume is 200 μL, after separation and purification, 40 times dilution is performed with 30% acetonitrile, and the conversion rate is determined by HPLC analysis.

[0110] The results show that after 24 h of catalysis, the yield of (S)-HEES produced by WT catalysis reaches 79.9%, e.e.>99%; Mut-L20I reaches 88.31%, e.e.>99%; Mut-L55I reaches 91.6%, e.e.>99%; Mut-L20I-L55I reaches 97.9%, e.e.>99%.

[0111] Example 7: Application of carbonyl reductase mutants in preparation of atorvastatin intermediates

[0112] The single-point mutants Mut-L20I, Mut-L55I with better thermal stability and the combined mutant Mut-L20I-L55I are selected for application in preparation of atorvastatin intermediates. The specific steps are as follows:

[0113] The composition of the catalytic system and the catalytic conditions are as follows:

[0114] 20 mL reaction system: crude enzyme solution (preparation method and example 2) was weighed 20 g / L, substrate 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester 150 g / L, cosolvent n-butyl acetate (amount 50%), auxiliary substrate glucose 100 mM (solvent is sodium phosphate buffer), glucose dehydrogenase (amount 10 g / L), coenzyme NADP + 3 g / L (solvent is sodium phosphate buffer). Sodium phosphate buffer was used to complete to 20 mL.

[0115] The reaction system was placed in a 35 o C water bath, magnetic stirring device 600 rpm, reaction 24 h reaction sampling, sampling volume 200 μL, after separation and purification, diluted 100 times with acetonitrile, and the conversion rate was determined by HPLC analysis. The results showed that after 24 h of catalysis, the yield of (3R, 5R)-6-cyano-3, 5-dihydroxyhexanoic acid tert-butyl ester produced by WT reached 77.2%, e.e.> 99%; Mut-L20I reached 80.2%, e.e.> 99%; Mut-L55I reached 82.1%, e.e.> 99%; Mut-L20I-L55I reached 95.6%, e.e.> 99%.

[0116] Example 8: Application of carbonyl reductase mutants in the preparation of vibegron intermediates

[0117] The single-point mutants Mut-L20I, Mut-L55I with better thermal stability and the combined mutant Mut-L20I-L55I were selected for application in the preparation of vibegron intermediates. The specific steps are as follows:

[0118] The composition of the catalytic system and the catalytic conditions are as follows:

[0119] 20 mL reaction system: the substrate (S)-aminoketone ester was dissolved in 10 mL n-butyl acetate (final concentration 100 g / L), 1 mL of 0.1 mM NaH2PO4-Na2HPO4 buffer solution with pH 6.5-7.0 was added, 1 mL of crude enzyme solution (final concentration 20 g / L, preparation method and example 2) was added, 2 mL of glucose dehydrogenase crude enzyme solution (final concentration 10 g / L) was added, 100 mg of coenzyme NADPH was added, and 1.774 g of auxiliary substrate glucose was added. Sodium phosphate buffer was used to complete to 20 mL.

[0120] The reaction system was placed in a 35 o C water bath, magnetic stirring device 600 rpm, reaction sampling, sampling volume 200 µL, after separation and purification, diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0121] The results show that after 24 h of catalysis, the yield of (2S, 3R)-aminohydroxy ester produced by WT catalysis reaches 90.1%, e.e. >99%; Mut-L20I reaches 94.2%, e.e. >99%; Mut-L55I reaches 96.3%, e.e. >99%; Mut-L20I-L55I reaches 99.9%, e.e. >99%.

[0122] Example 9: Effect of fed-batch process on carbonyl reductase mutant for preparing vibegron intermediate

[0123] The single-point mutant Mut-L20I, Mut-L55I with better thermal stability and the combined mutant Mut-L20I-L55I were selected for use in the fed-batch process to prepare the vibegron intermediate. The specific steps are as follows:

[0124] (1) 20 mL reaction system: dissolve the substrate (S)-aminoketo ester in 10 mL n-butyl acetate (final concentration 80 g / L), add 1 mL of 0.1 mM, pH 6.5 NaH2PO4-Na2HPO4 buffer solution, add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 100 mg of coenzyme NADPH, and add 1.774 g of auxiliary substrate glucose. Use sodium phosphate buffer to complete to 20 mL.

[0125] Place the reaction system in a 35 o C water bath, and use a magnetic stirring device at 600 rpm. After 8 h, add 1.4 g of substrate (total substrate concentration after feeding is 150 g / L). Take samples at regular intervals, and after separation and purification, dilute 150 times with pure acetonitrile. Determine the conversion rate by HPLC analysis.

[0126] The results show that after 24 h of catalysis, the yield of (2S, 3R)-aminohydroxy ester produced by WT catalysis reaches 90.1%, e.e. >99%; Mut-L20I reaches 94.2%, e.e. >99%; Mut-L55I reaches 96.3%, e.e. >99%; Mut-L20I-L55I reaches 99.9%, e.e. >99%.

[0127] (2) 500 mL reaction system: dissolve the substrate (S)-aminoketo ester in 10 mL n-butyl acetate ((S)-aminoketo ester final concentration 80 g / L), add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 3.0 g of coenzyme NADPH, and add 35.5 g of auxiliary substrate glucose. Use sodium phosphate buffer to complete to 500 mL.

[0128] The reaction system was placed in a 35℃ water bath, the stirring device was set to 600 rpm, 35 g of the substrate was added after 8 h (the total concentration of the substrate after the addition was 150 g / L), reaction timing sampling was performed, the sampling volume was 200 μL, after separation and purification, the sample was diluted 150 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0129] The results show that after 24 h of catalysis, the yield of (2S, 3R)-aminohydroxy ester produced by WT catalysis reaches 92.5%, e.e.>99%; Mut-L20I reaches 96.3%, e.e.>99%; Mut-L55I reaches 97.6%, e.e.>99%; and Mut-L20I-L55I reaches 99.9%, e.e.>99%.

[0130] Compared with the non-supplemental process, the supplemental process further improves the production efficiency.

[0131] The raw materials and equipment used in the present application are conventional raw materials and equipment in the art unless otherwise specified; the methods used in the present application are conventional methods in the art unless otherwise specified.

[0132] The above is only a preferred embodiment of the present application, and does not limit the present application in any way, and any simple modification, change and equivalent transformation of the above embodiment according to the technical essence of the present application still belongs to the protection scope of the technical solution of the present application.

Claims

1. A carbonyl reductase mutant, characterized in that The carbonyl reductase mutant is obtained by single-point mutation or multi-point combined mutation of the 20th and 55th amino acids in the amino acid sequence shown in SEQ ID NO.

2.

2. The carbonyl reductase mutant of claim 1, wherein The mutation is one of the following or a combination of the two: (1) the 20th leucine is mutated into any one of lysine, threonine, aspartic acid, and isoleucine; (2) the 55th leucine is mutated into any one of methionine, serine, lysine, and isoleucine.

3. The carbonyl reductase mutant of claim 2, wherein The mutant is one of the following: (a) the 20th leucine in the amino acid sequence shown in SEQ ID NO. 2 is mutated into isoleucine; (b) the 55th leucine in the amino acid sequence shown in SEQ ID NO. 2 is mutated into isoleucine; (c) the 20th leucine in the amino acid sequence shown in SEQ ID NO. 2 is mutated into isoleucine, and the 55th leucine is mutated into isoleucine.

4. The carbonyl reductase mutant of claim 3, wherein The carbonyl reductase mutant is obtained by mutating the 20th leucine in the amino acid sequence shown in SEQ ID NO. 2 into isoleucine, and mutating the 55th leucine into isoleucine.

5. A gene encoding the carbonyl reductase mutant according to any one of claims 1-4.

6. A recombinant vector containing the gene encoding the carbonyl reductase mutant according to claim 5.

7. A recombinant genetically engineered bacterium containing the gene encoding the carbonyl reductase mutant constructed by the recombinant vector according to claim 6.

8. Use of the carbonyl reductase mutant according to any one of claims 1-4 in the synthesis of a chiral alcohol, which is a duloxetine intermediate, a florfenicol intermediate, a rosuvastatin intermediate, an atorvastatin intermediate, or a vibegron intermediate.

9. Use according to claim 8, wherein The method for the use is: using the wet bacterium obtained by fermentation culture of a genetically engineered bacterium containing the gene encoding the carbonyl reductase mutant, the crude enzyme solution after breaking the wet bacterium, or the extracted pure enzyme as a catalyst, using a chiral ketone as a substrate, and performing a biological catalytic reaction to prepare a corresponding chiral alcohol; the chiral ketone is S )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S )-6-chloro-5-hydroxy-3-oxohexanoic acid tert-butyl ester (3 S )-CHOH), 6-cyano-5 R )-hydroxy-3-oxohexanoic acid tert-butyl ester, the corresponding chiral alcohol is vibegron intermediate (2 S ,3 R )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S ,3 R )-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionic acid methyl ester, duloxetine intermediate (3 S )-3-hydroxy-3-(2-thienyl)propionic acid ethyl ester, rosuvastatin intermediate (3 R ,5 S )-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester, atorvastatin intermediate (3 R ,5 R )-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester.

10. A method for the enzymatic synthesis of a chiral alcohol, characterized in that The method is: using the wet bacterium obtained by fermentation culture of a genetically engineered bacterium containing the gene encoding the carbonyl reductase mutant according to any one of claims 1-4, the crude enzyme solution after breaking the wet bacterium, or the extracted pure enzyme as a catalyst, using a chiral ketone as a substrate, and performing a biological catalytic reaction to prepare a corresponding chiral alcohol; the chiral ketone is S )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S )-6-chloro-5-hydroxy-3-oxohexanoic acid tert-butyl ester S )-CHOH), 6-cyano-5 R )-hydroxy-3-oxohexanoic acid tert-butyl ester, the corresponding chiral alcohol is vibegron intermediate (2 S ,3 R )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S ,3 R )-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionic acid methyl ester, duloxetine intermediate (3 S )-3-hydroxy-3-(2-thienyl)propionic acid ethyl ester, rosuvastatin intermediate (3 R ,5 S )-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester, atorvastatin intermediate (3 R ,5 R )-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester.

Images