Gene expression regulated by CCL20 promoter
By regulating heterologous gene expression through the CCL20 promoter, the side effects of existing anti-inflammatory therapies are addressed, achieving precise regulation of the inflammatory response and reducing side effects in anti-inflammatory treatment.
Patent Information
- Application Number
- CN202480019664.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-21
- Filing Date
- 2024-03-20
- Publication Date
- 2025-12-05
AI Technical Summary
Existing anti-inflammatory therapies such as NSAIDs and corticosteroids may have side effects. Long-term systemic suppression of inflammation can lead to a decrease in immune response and cancer risk. Furthermore, existing cytokine neutralizers have adverse side effects when controlling inflammation and are difficult to precisely regulate in the host defense system.
The CCL20 promoter is used to regulate the expression of heterologous genes. By responding to cytokine stimulation, the CCL20 promoter, which is operatively linked to the heterologous gene, induces the expression of therapeutic proteins or nucleic acids. The CCL20 promoter is inserted into the cell using gene therapy vectors such as viral vectors or lipid vesicle delivery systems to achieve precise regulation of inflammation.
It enables dose-dependent control of heterologous gene expression in inflammatory responses, enhancing or weakening immune activation, reducing inflammation, providing more precise anti-inflammatory therapeutic effects, and reducing the side effects of systemic suppression.
Smart Images

Figure CN121079313A_ABST
Abstract
Description
[0001] Cross-references and incorporation by reference to related applications
[0002] This PCT application claims priority to U.S. Provisional Application No. 63 / 491,485, filed March 21, 2023, which is incorporated herein by reference in its entirety.
[0003] References to sequence lists submitted electronically
[0004] The contents of the ST.26 sequence list (name 5064_001PC01_SequenceListing_ST26.xml; size: 11,037 bytes; and creation date: March 18, 2023), which was submitted electronically in XML format with this application, are incorporated herein by reference in their entirety. Technical Field
[0005] This disclosure provides the CCL20 promoter and methods related to gene expression regulated by the CCL20 promoter in response to inflammation. Background Technology
[0006] Inflammation is a widespread response activated by the innate immune system when it detects signals from damaged tissue or pathogens. Inflammation is generally beneficial to an organism because it alerts the immune system to eliminate the root cause and restore homeostasis. However, dysregulation and excessive inflammation are harmful and can become chronic due to positive feedback mediated by inflammatory cytokines. The rapid production of pro-inflammatory cytokines (such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, and several other cytokines) is characteristic of diseases with inflammatory components.
[0007] Inflammation can occur as a response to any harmful stimulus. Physical causes of inflammation include, for example, burns, frostbite, physical injury, trauma, or ionizing radiation. Biological causes of inflammation include, for example, pathogen infection, immune responses due to hypersensitivity and allergic reactions, or stress. Chemical causes of inflammation include, for example, chemical irritants or toxins. Inflammatory abnormalities are the cause of many human diseases. The immune system is commonly associated with inflammatory conditions, as manifested in allergic reactions and some myopathies, and many immune system diseases (such as inflammatory bowel disease (IBD), rheumatoid arthritis (RA), multiple sclerosis, psoriasis, or lupus) can cause abnormal inflammation. Non-immune diseases whose causes stem from inflammatory processes include cancer, atherosclerosis, and ischemic heart disease.
[0008] Non-steroidal anti-inflammatory drugs (NSAIDs) and corticosteroids are widely used and effective anti-inflammatory therapies, but they can have adverse side effects. Currently, the most advanced therapies for inflammatory diseases in the clinic are TNF-a neutralizers (such as adalimumab, etanercept, and infliximab) and endogenous cytokine antagonists (such as anakinra (IL-1 beta antagonist)) that specifically and effectively inhibit the activity of pro-inflammatory cytokines.
[0009] Because inflammation is an important component of the host defense system, long-term systemic suppression can lead to adverse side effects, such as decreased immune response of the host to infection and increased risk of cancer development. Anti-inflammatory therapies can match the responsiveness and tunability of natural cellular responses, but can be externally controlled, which is both a challenge and an opportunity for synthetic biology. Synthetic biology allows the construction of biological systems that are orthogonal to existing signaling components but are able to read inputs from cellular processes or external signals and produce physiologically relevant outputs. Progress has been made in this direction, such as engineering the bacterium Lactococcus lactis to secrete IL-10, an anti-TNF-a nanobody that has been used to treat colitis in mice in situ, or engineering E. coli so that it can autonomously detect intestinal inflammation through nitric oxide sensing. SUMMARY
[0010] The present disclosure provides a polynucleotide comprising a promoter region comprising a C-C motif chemokine ligand 20 (CCL20) promoter operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene (e.g., expression of a therapeutic protein or a therapeutic nucleic acid) in response to stimulation by a cytokine (e.g., IL-1a). In some aspects, the CCL20 promoter comprises the CCL20 promoter sequence set forth in SEQ ID NO: 1. In some aspects, the CCL20 promoter comprises the CCL20 promoter sequence set forth in SEQ ID NO: 2. In some aspects, the CCL20 promoter comprises the CCL20 promoter sequence set forth in SEQ ID NO: 3. In some aspects, the CCL20 promoter comprises the CCL20 promoter sequence set forth in SEQ ID NO: 4. In some aspects, the CCL20 promoter comprises the CCL20 promoter sequence set forth in SEQ ID NO: 5.
[0011] In some aspects, the CCL20 promoter is a functional fragment or functional variant of the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the functional variant is a mutant. In some aspects, the functional fragment has a 5’ truncation, a 3’ truncation, or both, relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the sequence of the CCL20 promoter has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the sequence of the CCL20 promoter has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 point mutations. In some aspects, the point mutations are conservative point mutations.
[0012] In some aspects, the heterologous gene encodes a protein. In some aspects, the protein is a therapeutic protein. In some aspects, the therapeutic protein is a chimeric antigen receptor (CAR), an antibody, a tumor suppressor, an apoptosis inducer, an enzyme, or a hormone.
[0013] The present disclosure also provides a composition comprising (a) a polynucleotide comprising a promoter region comprising a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine (e.g., IL-1a), and (b) a delivery vehicle for delivering the polynucleotide into a cell (e.g., a cell of a subject or a cell in vitro). In some aspects, the delivery vehicle is a nucleic acid, a plasmid, a viral vector, a prokaryotic cell, a eukaryotic cell, or a lipid. In some aspects, the lipid is comprised in a lipid vesicle. In some aspects, the lipid vesicle is a micelle, a liposome, a lipid nanoparticle, or an extracellular vesicle. In some aspects, the viral vector is selected from the group consisting of an adeno-associated virus, an adenovirus, a retrovirus, an orthomyxovirus, a paramyxovirus, a papovavirus, a picornavirus, a lentivirus, a herpes simplex virus, a vaccinia virus, a poxvirus, and an alphavirus. In some aspects, the delivery vehicle is inserted into a cell (e.g., a cell of a subject, a cell from another donor, or a host cell for cell culture, e.g., for recombinant expression of the heterologous gene) with a construct of the present disclosure (i.e., comprising a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine (e.g., IL-1a)). In some aspects, the delivery vehicle is inserted into the cell via transfection. In some aspects, the transfection method is microinjection, lipofection, electroporation, cationic liposome transfection, microparticle methods, magnetic transfection, or any suitable method known in the art. In some aspects, the transfection can be transient. In some aspects, the transfection can be stable. In some aspects, the construct comprising the CCL20 promoter and the heterologous gene can be inserted into the genome of the cell, e.g., using a nuclease such as CRISPR / Cas.
[0014] The present disclosure also provides a method of producing a cell expressing at least one heterologous gene, the method comprising inserting (e.g., via transfection or microinjection) into a cell a composition comprising a polynucleotide (e.g., a construct or a vector comprising such a construct), the polynucleotide comprising a promoter region, wherein the promoter region comprises a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operatively linked to the heterologous gene, wherein the CCL20 promoter elicits expression of the heterologous gene (e.g., expression of a therapeutic protein or a therapeutic nucleic acid) in response to stimulation by a cytokine (e.g., IL-1a). Also provided is a cell genetically modified to express a heterologous gene, wherein the cell comprises a polynucleotide or a composition disclosed herein. Such a cell can be a cell to be administered to a subject (e.g., a cell in which the heterologous gene encodes an anti-inflammatory cytokine, an antibody, a CAR, etc.). The present disclosure also provides a pharmaceutical composition comprising a polynucleotide, a composition, or a cell disclosed herein, and a pharmaceutically acceptable carrier or excipient.
[0015] Also provided is a method of inducing, modulating, or enhancing expression of a heterologous gene (e.g., a heterologous gene encoding an anti-inflammatory cytokine, an antibody, or a CAR) in a subject, the method comprising (a) administering to the subject a polynucleotide, a composition, a cell, or a pharmaceutical composition comprising a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operatively linked to the heterologous gene disclosed herein; and (b) stimulating the CCL20 promoter with a cytokine (e.g., IL-1a). The present disclosure also provides a method of inducing dose-dependent gene expression of a heterologous gene in a cell, the method comprising (a) contacting the cell with a polynucleotide, a composition, a cell, or a pharmaceutical composition comprising a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operatively linked to the heterologous gene disclosed herein; and (b) contacting the cell with an effective amount of a cytokine (e.g., IL-1a) capable of stimulating the CCL20 promoter to induce gene expression of the heterologous gene in a dose-dependent manner.
[0016] Also provided is a method of controlling or inducing gene expression of a heterologous gene, the method comprising operatively coupling a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof to the heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a) controls or induces expression of the heterologous gene in response to the stimulation.
[0017] The present disclosure also provides a method of treating a disease or condition or a symptom or sequelae of such disease or condition in a subject, the method comprising administering to the subject an effective amount of a polynucleotide, composition, cell, or pharmaceutical composition comprising a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operatively linked to a heterologous gene disclosed herein. In some aspects, the method further comprises inducing expression of the therapeutic gene by stimulating the CCL20 promoter with a cytokine (e.g., IL-1a).
[0018] Also provided is a method of controlling or reducing inflammation in a subject, the method comprising operatively coupling a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof to a heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a) induces expression of the heterologous gene in response to the stimulation, and wherein the heterologous gene controls or reduces inflammation by increasing or decreasing immune activation or increasing or decreasing expression of another gene in an inflammatory pathway.
[0019] In some aspects of the polynucleotides, compositions, cells, or methods disclosed herein, the cytokine that stimulates the CCL20 promoter is selected from the group consisting of IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL6, sIL-6R, IL-17, CD30, or any combination thereof. In some aspects, the cytokine that stimulates the CCL20 promoter of the present disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) is an interleukin. In some aspects, the interleukin is interleukin-1. In some aspects, the interleukin is interleukin-1a. In some aspects, the cytokine that stimulates the CCL20 promoter of the present disclosure (e.g., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) is an exogenous cytokine; that is, it has an external source, and it is administered to the subject or added to the culture medium. In some aspects, the cytokine that stimulates the CCL20 promoter of the present disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) is an endogenous cytokine; that is, the cytokine is produced by the subject’s tissues. In some aspects, the endogenous cytokine that stimulates the CCL20 promoter is a result of inflammation in the subject. In some aspects, the inflammation is naturally occurring. In some aspects, the inflammation is induced. In some aspects, the cytokine that stimulates the CCL20 promoter can be added to the culture medium, for example, during recombinant expression, or the cytokine can be secreted by a co-cultured cell.
[0020] In some aspects of the polynucleotides, compositions, cells, or methods disclosed herein, the use of the CCL20 promoter of the disclosure increases expression of a heterologous gene by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, or at least about 500% relative to expression observed using a reference promoter. In some aspects, the reference promoter is the serum amyloid A3 (SAA3) promoter.
[0021] The disclosure also provides a gene therapy vector comprising a gene that, when expressed, increases or decreases immune activation in a subject, wherein the gene is under the control of a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof). The disclosure also provides a cell for use in gene therapy, the cell comprising a gene that, when expressed, increases or decreases immune activation in a subject, wherein the gene is under the control of a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof). In some aspects, the cell is an autologous cell, e.g., an autologous T cell, such as an autologous CAR T cell. In other aspects, the cell is an allogeneic cell, e.g., an allogeneic T cell, such as an allogeneic CAR T cell.
[0022] In some aspects, the disclosure provides a vector comprising a promoter region comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof. In some aspects, the vector comprises a heterologous gene operably linked to the CCL20 promoter. In some aspects, the vector does not comprise a heterologous gene operably linked to the CCL20 promoter. In some aspects, the CCL20 promoter is a functional fragment of the sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the functional fragment has a 5’ truncation, a 3’ truncation, or both, relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the CCL20 promoter is a functional variant having a sequence with at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the sequence of the CCL20 promoter functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 point mutations relative to the sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the point mutations are conservative point mutations. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1A The expression level of a firefly luciferase reporter gene (fold increase of firefly luciferase) is shown in cells transfected with the luciferase (FF-Luc) gene under IL-1a stimulation in the absence of a promoter, i.e., no promoter-FF-Luc (labeled “no promoter control”), (ii) under the control of a CCL20 promoter, i.e., CCL20-FF-Luc (labeled “CCL20 promoter”), or (iii) under the control of a SAA3 promoter, i.e., SAA3-FF-Luc (labeled “SAA3 promoter”). Luciferase expression levels were measured at 0.5 hours, 2 hours, 4 hours, and 24 hours after IL-1a stimulation.
[0024] Figure 1BStandardized expression levels of the firefly luciferase reporter gene in cells transfected with the luciferase (FF-Luc) gene (i) in the absence of a promoter, i.e., no promoter-FF-Luc (labeled "no promoter control"), (ii) under the control of the CCL20 promoter, i.e., CCL20-FF-Luc (labeled "CCL20 promoter"), (iii) under the control of the SAA3 promoter, i.e., SAA3-FF-Luc (labeled "SAA3 promoter"), or (iv) under the control of the SV40 promoter, i.e., SV40-FF-Luc (labeled "SV40 promoter"), in the absence of stimulation or after 4 hours of stimulation with IL-1a.
[0025] Figure 2 Expression levels of the interleukin receptor antagonist IL-1RA (an anti-inflammatory cytokine that competes with active IL-1 and blocks binding to their common activating receptor IL-1R1) secreted by cells transfected with (i) luciferase under the control of the CCL20 promoter ("CCL20-Luc"; negative control), (ii) the IL-1RA gene under the control of the CMV promoter ("CMV-IL1RA"; positive control), and (iii) IL-1RA under the control of the CCL20 promoter ("CCL20-IL1RA") in response to IL-1a stimulation.
[0026] Figure 3A Expression levels of the interleukin-8 (IL-8) (a pro-inflammatory cytokine with pro-angiogenic, proliferative, and pro-motile activities) secreted by cells transfected with (i) luciferase under the control of the CCL20 promoter ("CCL20-Luc"; negative control), (ii) the IL-1RA gene under the control of the CMV promoter ("CMV-IL1RA"; positive control), and (iii) IL-1RA under the control of the CCL20 promoter ("CCL20-IL1RA") in response to IL-1a stimulation.
[0027] Figure 3B Expression levels of the interleukin-6 (IL-6) (most often considered a pro-inflammatory cytokine involved in the acute phase immune response and chronic inflammation) secreted by cells transfected with (i) luciferase under the control of the CCL20 promoter ("CCL20-Luc"; negative control), (ii) the IL-1RA gene under the control of the CMV promoter ("CMV-IL1RA"; positive control), and (iii) IL-1RA under the control of the CCL20 promoter ("CCL20-IL1RA") in response to IL-1a stimulation.
[0028] Figure 3CThe expression level of monocyte chemoattractant protein-1 (MCP-1), a chemokine that activates the respiratory burst of monocytes and induces the expression of proinflammatory cytokines IL-6 and IL-1 beta, secreted by cells in response to IL-1 alpha stimulation is shown, the cells being transfected with (i) luciferase under the control of the CCL20 promoter ("CCL20-Luc"; negative control), (ii) the IL-1RA gene under the control of the CMV promoter ("CMV-IL1RA"; positive control), and (iii) IL-1RA under the control of the CCL20 promoter ("CCL20-IL1RA").
[0029] Figure 4 The expression level of IL-10 after IL-1 alpha stimulation of HeLa cells transfected with the CCL20 promoter-IL10 construct is shown.
[0030] Figure 5 Luciferase expression in a tunable system comprising a Gal4-VP16 synthetic transcription factor under the control of the CCL20 promoter is shown. The expression level of luciferase can be controlled according to the number of upstream activation sequences (UAS) in the luciferase reporter construct. DETAILED DESCRIPTION
[0031] The present disclosure provides CCL20 promoters that elicit gene expression in response to stimulation by proinflammatory cytokines. These inflammation-sensitive promoters can be used, for example, to control the timing of expression of a heterologous gene (e.g., an anti-inflammatory chemokine).
[0032] The CCL20 promoters disclosed herein (i.e., a CCL20 promoter of any of SEQ ID NOS: 1-5 or a functional fragment or variant thereof) can elicit gene expression in response to inflammation (naturally occurring inflammation or induced inflammation) in a subject. Thus, the CCL20 promoters of the present disclosure can be used to control the expression level of a gene in a dose-dependent manner, the gene for example increasing or decreasing immune activation, signaling to another set of genes to be expressed in the inflammation pathway, or altering or modifying the state of the cell in any inflammation-reducing manner. The strength and speed of the gene expression induced by the CCL20 promoters of the present disclosure produces a potent response that can be harnessed for gene therapy, cell therapy, or recombinant expression.
[0033] The CCL20 promoters of the disclosure can be used, for example, in gene therapy. As a non-limiting example, an individual having an inflammatory condition (e.g., a cancer, a neurodegenerative disease, or an autoimmune disease) can receive a gene therapy comprising a heterologous gene under the control of a CCL20 promoter of the disclosure. Endogenously released or exogenously (administered) inflammatory cytokines (e.g., IL-1a) will stimulate the CCL20 promoter and trigger a downstream anti-inflammatory response, for example, via expression of an anti-inflammatory cytokine or an anti-inflammatory molecule (e.g., an antibody) encoded by the heterologous gene controlled by the CCL20 promoter. Alternatively, endogenously released or exogenously (administered) inflammatory cytokines can trigger expression of an intermediate (e.g., an activator or an inhibitor) encoded by the heterologous gene controlled by the CCL20 promoter that will lead to an anti-inflammatory response upon action in the inflammatory pathway.
[0034] The CCL20 promoters of the disclosure (i.e., a CCL20 promoter of any of SEQ ID NOs: 1-5 or a functional fragment or variant thereof) can also be used to genetically modify a cell for administration (e.g., via injection or implantation) to a subject having an inflammatory condition. In some aspects, the cell is an autologous cell, e.g., an autologous T cell, such as an autologous CAR T cell. In other aspects, the cell is an allogeneic cell, e.g., an allogeneic T cell, such as an allogeneic CAR T cell. In some aspects, the cell can be implanted into the subject.
[0035] Stimulation of the CCL20 promoter in the administered / implanted cell can trigger a downstream anti-inflammatory response, for example, by eliciting expression of an anti-inflammatory cytokine (e.g., IL1RA, IL-4, IL-10, IL-11, IL-13 protein, TGF-beta, leukemia inhibitory factor, interferon-alpha, or a combination thereof (if the construct is bi- or multi-cistronic)), an analgesic peptide or protein, or a therapeutic protein (e.g., an antibody or another biologic) in response to stimulation by, for example, an inflammatory cytokine such as IL-1a, IL-1b, TNFa, IL-6, IL-15, IL-17, or IL-18.
[0036] In some aspects, the CCL20 promoters of the disclosure can be indirectly activated by a cytokine such as IL-6, sIL-6R, or IL-17, which will indirectly elicit expression of a heterologous gene under the control of the CCL20 gene via increased phosphorylated NF-kB recruitment to the CCL20 promoter.
[0037] The CCL20 promoters disclosed herein can also be used for recombinant gene expression. In some aspects, recombinant gene expression under the control of the CCL20 promoters disclosed herein can be induced by the addition of an exogenous cytokine (e.g., IL-1a) to the cell culture medium. In other aspects, the cultured cells can be subjected to conditions that elicit the production of cytokines by the cultured cells or cells co-cultured with the host cells, which in turn will induce recombinant gene expression under the control of the CCL20 promoters disclosed herein.
[0038] The therapeutic use of the CCL20 promoters of the present disclosure is not limited to the expression of genes that trigger an anti-inflammatory response. For example, the CCL20 promoters disclosed herein can be used to trigger the expression of any protein or gene that can treat a disease or condition characterized by elevated levels of inflammatory cytokines. For example, a gene encoding an antimicrobial or antiviral protein, such as an antibody, can be expressed in a subject with a microbial or viral infection under the control of the CCL20 promoters of the present disclosure. Given the dose-dependent gene expression observed upon induction of the CCL20 promoters of the present disclosure, the level of production of such antimicrobial or antiviral proteins can be controlled endogenously by the severity of the inflammatory response to the disease, can be controlled exogenously by the administration of a compound that will directly activate the CCL20 promoter (e.g., an inflammatory cytokine), or can be controlled by the administration of a compound that will indirectly elicit the release of an inflammatory cytokine that in turn will activate the CCL20 promoter.
[0039] I. DEFINITIONS
[0040] For the purposes of the present specification, the following terms and phrases are defined below.
[0041] It should be noted that the terms "a" or "an" entity refer to one or more of that entity; for example, "a nucleotide sequence," is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein. Further, it is also to be noted that the claims can be drafted solely in the
[0042] Also, as used herein in the context of describing the aspects described herein, "and / or" shall be taken to mean either "and" or "or", or both, in the particular aspect being described. Likewise, "or" shall be taken to mean either "and" or "or", or both, in the particular aspect being described. Further, "consisting only of" shall be taken to mean "comprising" in the particular aspect being described.
[0043] It should be understood that wherever aspects are described herein with the language "comprising" alternatively "comprises" or "consisting" alternatively "consists" or "consisting essentially of' alternatively "consists essentially of' that alternatively, the aspects described also can be described with the language "consisting of' or "consisting only of'.
[0044] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.
[0045] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. In instances where a range of values is recited, understanding is that every intervening integer value, as well as every fraction between the recited range limits, is also specifically disclosed. Any range of values can be independently combined with any other disclosed range or values to produce a desired set of values. Thus, every range of values disclosed herein is to be understood to be a shorthand for describing a set of individual values and subranges within the overall range. Accordingly, the ranges of values recited herein are to be construed as specifically encompassing the full range of values as well as every individual value and sub-range within the overall range. For example, a range of 1 to 10 is to be understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
[0046] Where a value is explicitly listed, it is to be understood that values approximately or about the same as the listed value are also within the scope of the disclosure. Where a combination is disclosed, each sub-combination of the elements of the combination is also specifically disclosed and within the scope of the disclosure. Conversely, where different elements or groups of elements are disclosed, combinations thereof are also disclosed. Where any of the elements are disclosed as having a plurality of alternatives, examples of the disclosure are hereby also disclosed in which each alternative is excluded individually or in any combination with other alternatives; more than one element of the disclosure can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.
[0047] Nucleotides are referred to by their accepted one-letter codes. Unless otherwise indicated, nucleotide sequences are written left to right in the 5' to 3' direction. Nucleotides are referred to herein by the commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Thus, "a" stands for adenine, "c" stands for cytosine, "g" stands for guanine, "t" stands for thymine, and "u" stands for uracil.
[0048] About: The term "about" is used herein to mean approximately, roughly, around, or in the range of, as in a non- precise value. When the term "about" is used in conjunction with a numerical value, it modifies that value by extending it by a variance on either side of the stated value. Generally, the term "about" can modify a numerical value higher and lower than the stated value by a variance of, for example, 10% up or down.
[0049] Administration: The terms "administration" and "administering" and grammatical variations thereof refer to introducing a composition (e.g., a polynucleotide, a vector, or a viral particle) comprising a CCL20 promoter disclosed herein (i.e., a CCL20 promoter of any of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) into the body of a subject via a pharmaceutically acceptable route. The composition is introduced into the body of a subject by any suitable route including oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intrathecal, intratumoral, periocular, or topical. Administration includes self-administration and administration by another. A suitable route of administration allows the composition or agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject. In some aspects, cells are administered. In some aspects, cells can be implanted.
[0050] Antibody: As used herein, the term "antibody" (Ab) shall include, but is not limited to, a glycoprotein immunoglobulin, or an antigen binding portion thereof, that specifically binds an antigen and comprises at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each H chain comprises a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant region. The heavy chain constant region comprises three constant domains, C H1 , C H2 , and C H3 . Each light chain comprises a light chain variable region (abbreviated herein as V L ) and a light chain constant region. The light chain constant region comprises one constant domain, C L . The V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each V H and V L comprises three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. In some aspects, the heterologous protein expressed via stimulation of the CCL20 promoter operably linked to a polypeptide encoding the heterologous protein comprises an antibody or antigen binding portion thereof.
[0051] Antigen: The term "antigen" refers to a molecule that elicits an immune response. This immune response can involve either antibody production or the activation of specific immune-competent cells, or both. Those skilled in the art will appreciate that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, the antigen can be derived from recombinant DNA or genomic DNA.
[0052] Antigen binding portion: An "antigen binding portion" of an antibody (also called an "antigen binding fragment") refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen bound by the whole antibody. It has been shown that the antigen binding function of an antibody can be performed by fragments of a whole antibody. Examples of binding fragments encompassed within the term "antigen binding portion" of an antibody (e.g., an anti-GD2 antibody) include (i) a Fab fragment (fragment from papain cleavage) or similar monovalent fragment, which is comprised of the V L , V H(i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. H (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. L (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. H (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. H (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. L (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. H (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. L (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710. H (i) whole immunoglobulin; (ii) F(ab')2 fragments; (iii) Fab fragments; (iv) Fd fragments; (v) Fv fragments; and (vi) isolated complementarity determining regions (CDRs). See, e.g., Ward et al. (1989) Nature 341 :544-546; and U.S. Patent No. 6,450,710.
[0053] Approximate: As used herein, the term "approximate," when applied to one or more values of interest, refers to a value that is similar to the referenced value. In certain aspects, the term "approximate" refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of either direction (greater than or less than) the referenced value, unless otherwise noted or otherwise evident from context (unless such a number would exceed 100% of the possible values).
[0054] CAR: The term "chimeric antigen receptor" or alternatively "CAR" refers to a set of polypeptides, usually two in the simplest form, which when in an immune effector cell, provide the cell with specificity for a target cell, usually a cancer cell, and provide intracellular signal generation. In some aspects, a CAR comprises at least an extracellular antigen binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to as "intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule and / or a costimulatory molecule as defined below. In some aspects, the heterologous protein expressed via the CCL20 promoter operably linked to a polynucleotide encoding the heterologous protein comprises a CAR.
[0055] CCL20: Chemokine (C-C motif) ligand 20 (CCL20), also known as liver- activated regulatory chemokine (LARC) or macrophage inflammatory protein-3a (MIP3A), is a small cytokine belonging to the CC chemokine family. It has strong chemotactic effects on lymphocytes and weak attracting effects on neutrophils. CCL20 elicits its effects on target cells by binding to and activating the chemokine receptor CCR6. Gene expression of CCL20 can be induced by microbial factors such as lipopolysaccharide (LPS) and inflammatory cytokines such as tumor necrosis factor and interferon-gamma, and can be downregulated by IL-10.
[0056] CCL20 promoter: As used herein, the term "CCL20 promoter", "CCL20 promoter of the present disclosure" or "CCL20 promoter disclosed herein" relates to a nucleic acid sequence derived from the regulatory region of human CCL20 having promoter activity. The term also encompasses functional fragments and functional variants, i.e. fragments, mutants and derivatives thereof having promoter activity. In a particular aspect, the term CCL20 promoter refers to a polynucleotide comprising the nucleic acid sequence as shown in any one of SEQ ID NOs: 1, 2, 3, 4 or 5, or a functional variant disclosed herein.
[0057] Chemokine: The term "chemokine" refers to a family of small cytokines or signaling proteins secreted by cells that induce directed migration of leukocytes as well as other cell types, including endothelial and epithelial cells. Chemokines are divided into four major subfamilies: CXC, CC, CX3C, and C. All of these proteins exert their biological effects by interacting with transmembrane receptors called chemokine receptors that are selectively present on the surface of their target cells.
[0058] Cytokine: The term "cytokine" refers to a broad and loose category of small proteins (about 5-25 kDa) that are important in cell signaling. Cytokines are peptides and cannot cross the lipid bilayer of a cell into the cytoplasm. Cytokines have been shown to participate in autocrine, paracrine, and endocrine signaling as immune modulators. Cytokines include chemokines, interferons, interleukins, lymphokines, and tumor necrosis factors, but generally do not include hormones or growth factors.
[0059] Complementarity: As used herein, the terms "complementarity" and "complementary" refer to two or more polynucleotides (i.e., each comprising a sequence of nucleobases) that are related to each other through the Watson-Crick base pairing rules. For example, the nucleobase sequence "T-G-A (5'→ 3')" is complementary to the nucleobase sequence "A-C-T (3'→ 5')". Complementarity can be "partial," in which less than all of the nucleobases of a given polynucleotide sequence are matched by nucleobases of another polynucleotide sequence, according to the base pairing rules. For example, in some aspects, complementarity between a given polynucleotide sequence and another polynucleotide sequence can be at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%. On the other hand, there can be "complete" or "perfect" (100%) complementarity between a given polynucleotide sequence and another polynucleotide sequence to continue the example. The degree of complementarity between polynucleotide sequences has a significant effect on the efficiency and strength of hybridization between the sequences.
[0060] Complementary: The terms "complementary" and "complementarity" refer to two or more polynucleotides (i.e., each comprising a sequence of nucleobases) that are related to each other through the Watson-Crick base pairing rules. For example, the nucleobase sequence "T-G-A (5'→ 3')" is complementary to the nucleobase sequence "A-C-T (3'→ 5')". Complementarity can be "partial," in which less than all of the nucleobases of a given polynucleotide sequence are matched by nucleobases of another polynucleotide sequence, according to the base pairing rules. For example, in some aspects, complementarity between a given polynucleotide sequence and another polynucleotide sequence can be at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%. On the other hand, there can be "complete" or "perfect" (100%) complementarity between a given polynucleotide sequence and another polynucleotide sequence to continue the example. The degree of complementarity between polynucleotide sequences has a significant effect on the efficiency and strength of hybridization between the sequences.
[0061] Conserved: As used herein, the term “conserved” refers to a nucleotide of a polynucleotide sequence that occurs unchanged at the same position of two or more sequences being compared. Nucleotides that are relatively conserved are those that are conserved in more related sequences than nucleotides that occur elsewhere in the sequence.
[0062] Corresponding to: The terms “corresponding to” and “corresponds to” can be used to set forth regions of sequence that correspond or are similar to one another based on homology and / or functionality when referring to two separate nucleic acid or nucleotide sequences, although the nucleotides of a particular sequence can be differently numbered. In addition, it is recognized that different numbering systems can be employed when characterizing nucleic acid or nucleotide sequences. In addition, it is recognized that the nucleic acid or nucleotide sequences of different variants of a nucleic acid can vary. However, as used herein, regions of variants that share nucleic acid or nucleotide sequence homology and / or functionality are considered to “correspond” to one another.
[0063] Culture: As used herein, the terms “culture,” “cell culture,” and “eukaryotic cell culture” refer to a population of surface-attached or suspended cells maintained or grown in a culture medium (see definition of “culture medium” below) under conditions suitable for the survival and / or growth of the cell population. As will be clear to one of ordinary skill in the art, as used herein, these terms can refer to a combination comprising a cell population and the culture medium in which the population is suspended. As used herein, “culturing” refers to culturing one or more cells in vitro under defined or controlled conditions. Examples of culture conditions that can be defined include temperature, gas mixture, time, and culture medium formulation.
[0064] Culture medium: As used herein, the terms “media,” “medium,” “culture medium,” “cell culture medium,” “tissue culture medium,” and “growth medium” refer to a solution containing nutrients useful for nourishing host cells grown in culture. Typically, these solutions provide essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements necessary and sufficient for minimal growth and / or survival of cells. The solution can also include components that enhance growth and / or survival above the minimal rate, including hormones and growth factors.
[0065] Derived from: As used herein, the term “derived from” or “derivative” refers to a component that is isolated from or made using a particular molecule or information from a particular molecule (e.g., a nucleic acid sequence). For example, a polynucleotide sequence derived from another polynucleotide sequence can include a polynucleotide sequence that is identical or substantially similar to the polynucleotide sequence from which it is derived. In the case of polynucleotides, derivatives can be obtained, for example, by naturally occurring mutations, artificial directed mutations, or artificial random mutations. Mutations used to derive polynucleotides can be intentionally directed or intentionally random, or a mixture of each. Mutation of a polynucleotide to produce a different polynucleotide derived from a first polynucleotide can be a random event (e.g., caused by polymerase fidelity deficiencies), and identification of the derived polynucleotide can be performed by appropriate screening methods known in the art. In some aspects, a polynucleotide sequence derived from a first polynucleotide sequence has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity, respectively, to the first polynucleotide sequence, wherein the derived polynucleotide sequence retains the biological activity of the original polynucleotide.
[0066] Downstream / upstream: The term “downstream” refers to a nucleotide sequence that is located 3’ of a reference nucleotide sequence. In certain aspects, a downstream nucleotide sequence relates to a sequence after the transcription start point. For example, the translation start codon of a gene is located downstream of the transcription start site. The term “upstream” refers to a nucleotide sequence that is located 5’ of a reference nucleotide sequence.
[0067] Encoding: The term “encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as a template for synthesis of other polymers and macromolecules that have a specified sequence of nucleotides, e.g., a sequence of rRNA, tRNA, and mRNA, or a specific sequence of amino acids, during biological processes. Thus, if a mRNA corresponding to a gene is transcribed and translated, it will exhibit the same sequence of amino acids as does the protein encoded by the gene. The coding strand of a known gene or open reading frame has the same nucleotide sequence as the mRNA and is generally provided in sequence listings. The non-coding strand will have the exact reverse complement sequence of the mRNA and the gene, and, in a known gene or open reading frame, will also encode the same protein as the coding strand.
[0068] Unless otherwise indicated, a nucleotide sequence “encoding” an amino acid sequence, e.g., a polynucleotide “encoding” a heterologous molecule under the control of a CCL20 promoter of the disclosure, includes all nucleotide sequences which have the same encoding ability.
[0069] Expression: As used herein, the term “expression” refers to the process by which a polynucleotide gives rise to a gene product (e.g., an RNA or a polypeptide). It includes, but is not limited to, transcription of a polynucleotide into messenger RNA (mRNA) and translation of mRNA into a polypeptide. Expression results in a “gene product.” As used herein, a gene product can be a nucleic acid (e.g., messenger RNA produced by transcription of a gene) or a polypeptide translated from a transcript. In some aspects, the terms “expression” and “expresses” are used to refer to transcription and translation occurring within a cell. The level of expression of a product gene in a host cell can be determined based on the amount of corresponding mRNA present in the cell or the amount of protein encoded by the product gene produced by the cell, or both.
[0070] Fragment: As used herein, the term “fragment” (e.g., a fragment of a CCL20 promoter disclosed herein) refers to a polynucleotide sequence of a CCL20 promoter of the disclosure that is shorter than a CCL20 promoter sequence disclosed herein (e.g., a CCL20 promoter of any of SEQ ID NOs: 1-5), e.g., a deletion of the 5’ end and / or 3’ end or any portion of the polynucleotide sequence compared to a naturally occurring polynucleotide.
[0071] Functional / Non-functional Fragment: As used herein, the term “functional fragment” refers to a polynucleotide fragment derived from a CCL20 promoter sequence disclosed herein that retains the functional properties of the parent molecule. Thus, in some aspects, a functional fragment of a CCL20 promoter disclosed herein retains the ability to initiate expression of a heterologous gene operably linked to the CCL20 promoter fragment. In contrast, a “non-functional fragment” lacks one or more functional characteristics of the parent molecule.
[0072] Whether a fragment of a CCL20 promoter disclosed herein is a functional fragment can be assessed by any method known in the art without undue experimentation. For example, a reporter gene (e.g., luciferase) can be operably linked to a CCL20 promoter fragment, and luciferase expression in response to IL-1a stimulation can be determined. In some aspects, a functional fragment retains, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of a CCL20 promoter disclosed herein to control expression of a heterologous gene (as determined, e.g., using a luciferase expression detection assay in response to IL-1a stimulation). In some aspects, a CCL20 promoter functional fragment consists of a sequence complementary to the reverse complement of a CCL20 promoter of any one of SEQ ID NOs: 1-5, and which can hybridize to such reverse complement of a CCL20 promoter of any one of SEQ ID NOs: 1-5 under stringent conditions.
[0073] Functional variant / non-functional variant: As used herein, the term “functional variant” refers to a polynucleotide derived from a CCL20 promoter sequence disclosed herein (e.g., via point mutations, insertions, deletions, etc.) that retains promoter function. In some aspects, a functional variant of a CCL20 promoter disclosed herein retains the ability to initiate expression of a heterologous gene operably linked to a CCL20 promoter fragment. In contrast, a “non-functional variant” lacks one or more functional characteristics of the parent molecule.
[0074] Whether a variant (e.g., mutant) of a CCL20 promoter disclosed herein is a functional variant can be assessed by any method known in the art without undue experimentation. For example, a reporter gene (e.g., luciferase) can be operably linked to a CCL20 promoter variant, and luciferase expression in response to IL-1a stimulation can be determined. In some aspects, a functional variant retains, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of a CCL20 promoter disclosed herein to control expression of a heterologous gene (as determined, e.g., using a luciferase expression detection assay in response to IL-1a stimulation). In some aspects, a CCL20 promoter functional variant consists of a sequence complementary to the reverse complement of a CCL20 promoter of any one of SEQ ID NOs: 1-5, and which can hybridize to such reverse complement of a CCL20 promoter of SEQ ID NOs: 1-5 under stringent conditions.
[0075] Gene: The terms "gene," "coding sequence," "coding nucleic acid," and grammatical variations thereof are used interchangeably in the present disclosure and refer to a nucleic acid (RNA or DNA molecule) comprising a nucleotide sequence that encodes a gene of interest (typically a protein, e.g., a therapeutic protein such as an antibody or CAR). The coding sequence can also include initiation and termination signals operably linked to regulatory elements, including a promoter and a polyadenylation signal, capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence can be codon-optimized.
[0076] Heterologous gene: As used herein, the term "heterologous gene" refers to a gene that is operably linked to a CCL20 promoter of the present disclosure, wherein the gene is not naturally occurring CCL20. In some aspects, the heterologous gene can be a gene encoding a therapeutic protein (e.g., an anti-inflammatory cytokine or an antibody) or a therapeutic nucleic acid (e.g., an RNA interference molecule). In some aspects, particularly for diagnostic uses, the heterologous gene encodes a reporter molecule (e.g., luciferase).
[0077] Identical: In some aspects, two or more sequences are referred to as "perfectly conserved" or "identical" to one another if they are 100% identical to one another. In some aspects, two or more sequences are referred to as "highly conserved" if they are at least about 70% identical, at least about 80% identical, at least about 90% identical, or at least about 95% identical to one another. In some aspects, two or more sequences are referred to as "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. In some aspects, two or more sequences are referred to as "conserved" if they are at least about 30% identical, at least about 40% identical, at least about 50% identical, at least about 60% identical, at least about 70% identical, at least about 80% identical, at least about 90% identical, or at least about 95% identical to one another. In some aspects, two or more sequences are referred to as "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequences can apply to the full length of a polynucleotide or polypeptide or can apply to portions, regions, or features thereof.
[0078] Identity: As used herein, the term "identity" refers to the overall monomer conservancy between polymeric molecules (e.g., between polypeptide molecules or between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules)). The term "identical" without any additional qualifying word (e.g., protein A is identical to protein B) means 100% identical in sequence (100% sequence identity). Describing two sequences as, for example, "70% identical" is equivalent to describing them as having, for example, "70% sequence identity."
[0079] For example, the percent identity of two polypeptide or polynucleotide sequences can be computed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and second polypeptide or polynucleotide sequence for optimal alignment and nonidentical sequences can be disregarded for comparison purposes). In certain aspects, the length of an aligned sequence for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence. The amino acids at corresponding amino acid positions are then compared.
[0080] When a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
[0081] Suitable software programs are available from various sources and are used for alignment of protein and nucleotide sequences. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST suite of programs available from the National Center for Biotechnology Information BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm to compare two sequences. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the bioinformatics program EMBOSS suite and are available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa. In a particular aspect, sequence identity corresponds to the percent sequence identity of a global pairwise alignment determined using a program implementing the Needleman-Wunsch algorithm (e.g., Needle, available at www.ebi.ac.uk / Tools / psa / emboss_needle / ).
[0082] Sequence alignments can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, Clustal X, or Clustal Omega), MUSCLE, etc.
[0083] Different regions within a single polynucleotide or polypeptide target sequence aligned to a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It should be noted that percent sequence identity values are rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It should also be noted that length values will always be integers.
[0084] In certain aspects, the percent identity (% ID) of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as % ID = 100 x (Y / Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in an alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program), and Z is the total number of residues in the second sequence. If the first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.
[0085] Those skilled in the art will appreciate that the generation of sequence alignments for the calculation of percent sequence identity is not limited to binary sequence-sequence comparisons driven by primary sequence data alone. It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystal protein structures), functional data (e.g., mutation positions), or phylogenetic data. A suitable program for integrating heterogeneous data to generate multiple sequence alignments is T-Coffee, available at www.tcoffee.org, and alternatively available from, e.g., EBI. It will also be appreciated that the final alignment for the calculation of percent sequence identity can be curated automatically or manually.
[0086] Inflammation: As used herein, the term “inflammation” refers to the complex biological response of vascular tissue to harmful stimuli, such as pathogens, damaged cells, or irritants. The typical signs of acute inflammation are pain, heat, redness, swelling, and loss of function. Inflammation is a protective attempt by the organism to remove the harmful stimuli and to initiate the healing process. Inflammation is not synonymous with infection, although the two are often related (the former is usually a consequence of the latter). Inflammation can also occur without infection, although this type of inflammation is usually maladaptive (such as atherosclerosis). Inflammation is a stereotyped response, and as such is considered a mechanism of innate immunity compared to the adaptive immunity that is specific to each pathogen. Without inflammation, progressive destruction of tissues can jeopardize the survival of the organism. On the other hand, chronic inflammation can lead to many diseases, such as hay fever, periodontitis, atherosclerosis, rheumatoid arthritis, and even cancer (e.g., gallbladder cancer). It is for this reason that inflammation is usually tightly regulated by the body.
[0087] Inflammation can be divided into acute or chronic. “Acute inflammation” is the initial reaction of the body to harmful stimuli, achieved by the increased migration of plasma and leukocytes, especially granulocytes, from the blood into the injured tissues. A series of biochemical events propagates and matures the inflammatory response, involving the local blood vessels, the immune system, and various cells within the injured tissue. Persistent inflammation is termed “chronic inflammation,” leading to progressive transformation of the cellular components of the tissues present at the site of inflammation and is characterized by simultaneous destruction and healing of the tissue in the course of the inflammatory process.
[0088] In some aspects, the CCL20 promoters of the present disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be stimulated in response to an inflammation-released pro-inflammatory cytokine (e.g., IL-α). In other aspects, the CCL20 promoters of the present disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be used to initiate or control expression of a polynucleotide encoding a therapeutic agent that can treat, ameliorate, or reduce symptoms of a cardiac, pulmonary, peripheral, hepatic, renal, digestive system, or central nervous system disorder, condition, and disease that can involve inflammation or inflammatory processes, such as myocardial inflammation (myocarditis), chronic myocarditis, acute myocarditis, viral myocarditis, vasculitis, pancreatitis, peritonitis, rheumatoid disease, renal inflammatory disease, immune renal disease, kidney transplant rejection, immune complex-induced kidney disease, toxin-induced kidney disease, contrast agent-induced kidney disease, diabetic and non-diabetic kidney disease, pyelonephritis, kidney cysts, kidney cirrhosis, hypertensive kidney cirrhosis, nephrotic syndrome, chronic interstitial inflammation, inflammatory bowel disease (IBD), Crohn’s disease, ulcerative colitis (UC), inflammatory skin disease, ocular inflammatory disease, blepharitis, dry eye, Sjogren’s syndrome, or ocular fibrosis. Additional indications that can be treated using the disclosed compositions and methods are disclosed in more detail below.
[0089] As used herein, the term “naturally occurring inflammation” refers to an inflammatory response that is caused by the natural course of a disease or condition or other causes, such as exposure to an allergen or irritant. In other words, naturally occurring inflammation is not caused by an external intervention that stimulates the CCL20 promoters of the present disclosure (e.g., injection of an exogenous interleukin). As used herein, the term “induced inflammation” refers to an external intervention (e.g., elevated temperature, exposure to an antigen or allergen, injection of an exogenous interleukin, etc.) that triggers an inflammatory response with the intent to stimulate the CCL20 promoters of the present disclosure.
[0090] Inflammatory cytokine: The terms “inflammatory cytokine” and “pro-inflammatory cytokine” are used interchangeably and refer to a signaling molecule (cytokine) that is secreted from immune cells, such as helper T cells (Th) and macrophages, as well as certain other cell types that promote inflammation. They include, for example, interleukin-1 (IL-1), IL-6, IL-12, and IL-18, tumor necrosis factor alpha (TNF-a), interferon gamma (IFNy), and granulocyte-macrophage colony-stimulating factor (GM-CSF), and play an important role in mediating innate immune responses. Inflammatory cytokines are produced primarily by and involved in the upregulation of the inflammatory response. Excessive chronic production of inflammatory cytokines leads to inflammatory diseases that are associated with different diseases, such as atherosclerosis and cancer.
[0091] As used herein, the term "exogenous cytokine" refers to a cytokine that has an external source and is administered to a subject or cell or added to a culture medium. In some aspects, the exogenous cytokine is an exogenous interleukin (e.g., an interleukin injected into a subject or added to a culture medium). As used herein, the term "endogenous cytokine" refers to a cytokine produced by a subject's tissue or cell or naturally produced by a cell in culture. In some aspects, the endogenous cytokine is an endogenous interleukin, e.g., an interleukin released by a subject's tissue due to naturally occurring or induced inflammation.
[0092] Immune modulator: As used herein, the term "immune modulator" refers to an agent that modulates the immune system. Non-limiting examples of genes encoding immune modulators that can be under the control of a CCL20 promoter of the present disclosure include genes encoding agents such as modulators of checkpoint inhibitors, ligands of checkpoint inhibitors, cytokines, derivatives thereof, or any combination thereof. In some aspects of the present disclosure, the heterologous gene under the control of a CCL20 promoter of the present disclosure is an immune modulator. Immune modulating genes under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can also include, for example, a polynucleotide encoding an agonist protein, an antagonist protein, an antibody, an antigen binding fragment, or a polynucleotide such as an siRNA, miRNA, IncRNA, mRNA, or DNA.
[0093] Immune response: Inflammation is a reaction of the immune system to a harmful stimulus, such as a pathogen, a damaged cell, a toxic compound, or radiation. As used herein, an “immune response” refers to a biological response within a vertebrate to a foreign agent or an abnormality (e.g., a cancer cell) that protects the organism from these agents and diseases caused by them. The immune response is mediated by the action of one or more cells of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, or neutrophils) and soluble macromolecules produced by any of these cells or the liver, including antibodies, cytokines, and complement, that results in the selective targeting, binding, damage, destruction, and / or elimination from the vertebrate’s body of invading pathogens, cells or tissues infected with a pathogen, cancerous or other abnormal cells, or, in the case of autoimmune or pathological inflammation, normal body cells or tissues. An immune response includes, for example, the activation or inhibition of T cells (e.g., effector T cells, Th cells, CD4+ cells, CD8+ T cells, or Treg cells), or the activation or inhibition of any other cell of the immune system (e.g., NK cells). Thus, an immune response can include a humoral immune response (e.g., mediated by B cells), a cellular immune response (e.g., mediated by T cells), or both a humoral and a cellular immune response.
[0094] In some aspects, the compositions and methods of the present disclosure of a CCL20 promoter (i.e., a CCL20 promoter of any of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can elicit an immune response that is generally an “inhibitory” immune response. An inhibitory immune response is an immune response that blocks or attenuates the action of a stimulus (e.g., an antigen). In certain aspects, an inhibitory immune response includes the production of inhibitory antibodies against a stimulus. In some aspects, the immune response is a “stimulatory” immune response. A stimulatory immune response is an immune response that results in the generation of effector cells (e.g., cytotoxic T lymphocytes) that can destroy and clear target antigens (e.g., tumor antigens or viruses).
[0095] Interleukins: The term “interleukin,” abbreviated IL, refers to a group of cytokines (secreted proteins and signaling molecules) expressed and secreted by leukocytes (white blood cells) as well as some other body cells. The human genome encodes more than 50 interleukins and related proteins. As used herein, the term encompasses, for example, interleukin 1 (interleukin 1 alpha, IL-1 alpha; and interleukin 1 beta, IL-1 beta), interleukin 2 (IL-2), interleukin 3 (IL-3), interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6 (IL-6), interleukin 7 (IL-7), interleukin 8 (IL-8; CXCL8), interleukin 9 (IL-9), interleukin 10 (IL-10), interleukin 11 (IL-11), interleukin 12 (IL-12), interleukin 13 (IL-13), interleukin 14 (IL-14), interleukin 15 (IL-15), interleukin 16 (IL-16), interleukin 17 (IL-17), interleukin 18 (IL-18), interleukin 19 (IL-19), interleukin 20 (IL-20), interleukin 21 (IL-21), interleukin 22 (IL-22), interleukin 23 (IL-23), interleukin 24 (IL-24), interleukin 25 (IL-25), interleukin 26 (IL-26), interleukin 27 (IL-27), interleukin 28 (IL-28), interleukin 29 (IL-29), interleukin 30 (IL-30), interleukin 31 (IL-31), interleukin 32 (IL-32), interleukin 33 (IL-33), interleukin 35 (IL-35), and interleukin 36 (IL-36),
[0096] Mismatch: The term “mismatch” or “mismatches” refers to one or more nucleobases (whether contiguous or separated) in the oligomer nucleobase sequence that do not match the target pre-mRNA according to base pairing rules. While perfect complementarity is generally desired, some aspects can include one or more, but preferably 6, 5, 4, 3, 2, or 1 mismatches relative to the target pre-mRNA. Variations including anywhere within the oligomer. In certain aspects, the antisense oligomers of the present disclosure include variations in the nucleobase sequence near the ends, variations internally, and, if present, generally within about 6, 5, 4, 3, 2, or 1 subunits of the 5’ and / or 3’ ends. In certain aspects, one, two, or three nucleobases can be removed and still provide targeted binding.
[0097] Nucleic acid: The terms "nucleic acid," "nucleic acid molecule," "nucleotide sequence," "polynucleotide," and grammatical variations thereof are used interchangeably and refer to a polymeric form of either ribonucleotides (adenine, guanine, uracil, or cytosine "RNA molecules") or deoxyribonucleotides (deoxyadenine, deoxyguanine, deoxythymidine, or deoxycytosine "DNA molecules"), or any phosphoester analogs thereof (such as phosphorothioates and phosphoramidates), in either single stranded form, or as double-stranded helices. Single-stranded nucleic acid sequences refer to either single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The term nucleic acid molecule and in particular DNA or RNA molecule refers only to the primary and secondary structure of the molecule and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences can be described in terms of their sequence in the 5' to 3' direction along the non-transcribed strand (i.e., the strand having a sequence homologous to mRNA). A "recombinant DNA molecule" is a DNA molecule that has been subjected to molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. "Nucleic acid compositions" of the present disclosure comprise one or more nucleic acids as described herein.
[0098] Nucleic acid sequence: The terms "nucleic acid sequence" and "nucleotide sequence" are used interchangeably and refer to a contiguous nucleic acid sequence. The sequence can be single- or double-stranded DNA or RNA, e.g., gRNA.
[0099] Operably linked: "Operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. For example, a promoter is operably linked to a coding sequence if it influences its transcription or expression. For example, a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be an operable linker to a polynucleotide encoding, e.g., an anti-inflammatory protein, an antibody, a CAR, etc.
[0100] Pharmaceutically acceptable: The terms "pharmaceutically acceptable carrier," "pharmaceutically acceptable excipient," and grammatical variations thereof, encompass any agent that is approved by a regulatory agency of the Federal government or listed in the U.S. Pharmacopeia that is used in animals, including humans, and any agent that is not deleterious to the biological activity and properties of the compounds being administered when such agent is administered to a subject in an amount that is commensurate with that used for the preparation of pharmaceutical compositions and that is generally safe, nontoxic, and desirable. The term includes excipients and carriers that are useful in preparing pharmaceutical compositions.
[0101] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to one or more compounds in admixture or in suspension with one or more other chemical components such as pharmaceutically acceptable carriers and excipients, or one or more compounds suspended in one or more other chemical components such as pharmaceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate administration of the pharmaceutical preparation to a subject.
[0102] Polynucleotide: As used herein, the term “polynucleotide” refers to a polymer of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. The term refers to the primary structure of the molecule. Thus, the term includes triple-stranded, double-stranded, and single- stranded deoxyribonucleic acid (“DNA”), as well as triple-stranded, double-stranded, and single-stranded ribonucleic acid (“RNA”).
[0103] More specifically, the term “polynucleotide” includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose); polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced or unspliced; any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base; and other polymers containing conventional nucleotide skeletons, such as polyamides (e.g., peptide nucleic acid “PNA”) and poly-morpholino polymers, as well as other synthetic sequence-specific nucleic acid polymers, provided that the polymers contain nucleobases that allow for base pairing and base stacking, such as found in DNA and RNA. In some aspects of the disclosure, the polynucleotide can be, for example, RNA (e.g., mRNA) or DNA.
[0104] Polypeptide: The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymers can comprise modified amino acids. These terms also encompass amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some aspects, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids long.
[0105] Prevent: As used herein, the terms "prevent," "preventing," and "prevention" refer to partially or totally delaying the onset of a disease, disorder, and / or condition; partially or totally delaying the onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and / or condition; partially or totally delaying the onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and / or condition; partially or totally delaying the progression of a particular disease, disorder, and / or condition; and / or reducing the risk of developing a pathology associated with a disease, disorder, and / or condition. In some aspects, a prevention outcome is achieved by prophylactic treatment. As used herein, "prophylactic" refers to a process for preventing the onset of a disease or condition, or for preventing or delaying symptoms associated with a disease or condition. As used herein, "prevent" refers to measures taken to maintain health and to prevent or delay the onset of a disease or condition, or to prevent or delay symptoms associated with a disease or condition.
[0106] Recombinant: A "recombinant" polypeptide or protein refers to a polypeptide or protein that is produced via recombinant DNA techniques. For purposes of the present disclosure, a recombinantly produced polypeptide or protein expressed in an engineered host cell is considered isolated, as a naturally or recombinantly produced polypeptide that has been isolated, fractionated, or partially or substantially purified by any suitable technique.
[0107] Similarity: As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent similarity between polymer molecules to each other can be done in the same manner as calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as understood in the art. It is understood that percent similarity depends on the scale of comparison used, i.e., whether amino acids are compared, for example, based on their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
[0108] Subject: The terms "subject," "patient," "individual," and "host," and variants thereof, are used interchangeably herein and refer to any mammalian subject in which diagnosis, treatment, or therapy is desired, including, but not limited to, humans, domestic animals (e.g., dogs, cats, etc.), farm animals (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.), particularly humans. The methods described herein are applicable to both human therapy and veterinary applications. As used herein, the phrase "a subject in need thereof includes a subject, such as a mammalian subject, who would benefit from administration of a therapeutic agent (e.g., a gene encoding a therapeutic protein), wherein the gene is under the control of a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional variant thereof).
[0109] Subsequence: As used herein, the term "subsequence" refers to a subset of contiguous nucleotides or amino acids in a sequence (physical sequence or symbolic representation thereof).
[0110] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" is the amount of an agent or pharmaceutical compound (e.g., a vector comprising a gene encoding a therapeutic protein), wherein the gene is under the control of a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional variant thereof), that is sufficient to effect a desired therapeutic, pharmacological, and / or physiological effect in a subject in need thereof. A therapeutically effective amount can be a "prophylactically effective amount" as prophylaxis can be considered therapy.
[0111] Treat: As used herein, the term“treat,”“treatment,” or“treating” refers to, for example, reducing the severity of a disease or condition; shortening the duration of a disease course; improving or eliminating one or more symptoms associated with a disease or condition; providing a beneficial effect to a subject with a disease or condition, without necessarily curing the disease or condition. The term also includes preventing or protecting against a disease or condition or its symptoms. In one aspect, the terms“treating” or“treatment” mean inducing an immune response against an antigen, or reducing inflammation, in a subject.
[0112] Modulate: As used herein, the terms“modulate,”“alter,” and grammatical variants thereof, when applied to a particular concentration, level, expression, function, or behavior, generally refer to the ability to change that particular concentration, level, expression, function, or behavior by increasing or decreasing (e.g., directly or indirectly promoting / stimulating / up-regulating or interfering / inhibiting / down-regulating), for example, as an antagonist or agonist. In some instances, a modulator can increase and / or decrease a certain concentration, level, activity, or function relative to a control, or relative to an average activity level typically expected or relative to a control activity level.
[0113] Vector: The terms“vector,”“expression vector,”“plasmid,” and grammatical variants thereof are used interchangeably in the present disclosure and refer to a polynucleotide that is foreign to the host cell genome that is inserted into a specific location in the host cell (e.g., T cell) genome. Typically, a plasmid comprises a variety of elements, such as a recombination site (e.g., a homologous recombination site and / or a site-specific recombination site), a marker (e.g., a detection marker and / or a selection marker), one or more expression cassettes, or any combination thereof. In some aspects, a plasmid can be a linear plasmid. In other aspects, a plasmid can be a circular plasmid, e.g., a complete circular plasmid.
[0114] II.CCL20 Cytokine-inducible Promoters and Uses Thereof
[0115] The present disclosure provides promoters derived from regulatory regions of human C-C motif chemokine ligand 20 (CCL20) and their uses, for example, for in situ protein or recombinant gene expression via cytokine control of CCL20 promoter activity. The CCL20 promoters disclosed herein can be stimulated by a cytokine (e.g., a pro-inflammatory cytokine, such as IL-1a) to induce expression of a heterologous gene operably linked to the CCL20 promoter, for example, a gene encoding a heterologous protein (e.g., an anti-inflammatory cytokine). As used herein, the terms“heterologous gene” and“heterologous protein” refer to any gene or protein, respectively, that does not encode CCL20. In some aspects, the expression product of the heterologous gene is a therapeutic protein. In other aspects, the expression product of the heterologous gene is a therapeutic polypeptide.
[0116] A CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be used, for example, to induce expression of a heterologous gene operably linked to the CCL20 promoter in a subject in response to stimulation of the CCL20 promoter by an inflammatory cytokine (e.g., IL-α), the heterologous gene encoding, for example, a heterologous protein or a plurality of heterologous proteins (e.g., controlling expression of genes that are part of a bi- or multi-cistronic construct). The inflammatory cytokine capable of inducing heterologous gene expression via stimulation of a CCL20 promoter of the disclosure can be endogenous (i.e., produced by naturally occurring inflammation) or exogenous (i.e., a cytokine administered to a subject to elicit an inflammatory response, or a cytokine added to a culture medium in the case of recombinant expression).
[0117] In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be used to control a heterologous gene in a subject, where the process does not include insertion of the heterologous gene into the subject. For example, a CCL20 promoter of the disclosure can be inserted into a locus in the genome of a subject upstream of a heterologous gene, where the CCL20 promoter replaces a naturally occurring promoter, for example, using gene editing methods. In some aspects, the replaced CCL20 promoter can be inserted into a position that inactivates the naturally occurring promoter, for example, an internal position, without removing the naturally occurring promoter. In some aspects, the replaced CCL20 promoter can be inserted into a position that removes a portion of the naturally occurring promoter (e.g., a portion of the 3’-terminal region of the naturally occurring promoter) and inactivates the naturally occurring promoter. Thus, if it would be beneficial, for example, for the expression level of a particular gene to be lower or under external control, such as administration of an exogenous cytokine, a naturally occurring promoter can be replaced with a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof).
[0118] In some aspects, the one or more heterologous proteins expressed in response to stimulation of the CCL20 promoter with an endogenous or exogenous cytokine (e.g., IL-α) can be an anti-inflammatory protein, such as an antibody or antigen-binding portion thereof, a receptor, an antagonist, or any combination thereof. In some aspects, the antibody or antigen-binding portion thereof is an anti-TNF antibody, such as an antibody against TNF-α. In other aspects, the antibody or antigen-binding portion thereof is an anti-IL-1 antibody, such as an antibody against IL-1α. In some aspects, the receptor is a soluble TNF receptor. In some aspects, the receptor is a soluble IL-1 receptor. In some aspects, the antagonist is a TNF receptor antagonist. In some aspects, the antagonist can be an IL-1 receptor antagonist. Generally, stimulation of the CCL20 promoter activity can be initiated by any action that increases the level of a protein that binds to the CCL20 promoter (e.g., NF-kB, STAT3, AP-1, AP-2, C-EBP, SP1, or ESE-1). Exemplary pathways that can result in downstream increases in the level of NF-kB, STAT3, AP-1, AP-2, C-EBP, SP1, or ESE-1 are depicted in signaling pathway diagrams at, for example, www.cellsignal.com / pathways / by-research / immunology-inflammation-pathways, all of which are incorporated herein by reference in their entirety.
[0119] In some aspects, the one or more heterologous proteins expressed in response to stimulation of a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) with an endogenous or exogenous cytokine can be a protein activator or inhibitor that results in a decreased inflammatory response by altering the response of the inflammatory pathway. Three common transcription factors act as key regulators in the inflammatory response pathway, namely nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κΒ), hypoxia-inducible factor-1 alpha (HIF-1a), and signal transducer and activator of transcription (STAT). These factors can lead to cancer when inflammation becomes chronic. See, e.g., Bharat B. et al (2009) Clin Cancer Res 15(2):425-430; Chiara P. et al (2009) Immunobiology 214(2009):761-777. Thus, in some aspects, the one or more heterologous proteins expressed in response to stimulation of a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is an antagonist (e.g., an antibody, antigen binding portion thereof, or molecule derived from such an antibody, e.g., a CAR) targeting NF-κΒ, HIF-1a, or STAT. In other words, stimulation of the CCL20 promoter by inflammation will trigger a negative feedback appearance that will reduce inflammation.
[0120] In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) can be used to induce expression of a protein in vivo (e.g., following gene therapy), ex vivo, or in vitro (e.g., recombinantly expressed in cell culture).
[0121] In some aspects, the disclosure provides a polynucleotide comprising a promoter region comprising a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine (e.g., IL-α). In some aspects, the cytokine used to stimulate the CCL20 promoter of the disclosure is a pro-inflammatory cytokine.
[0122] In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with interleukin-1 (IL-1) (e.g., IL-1a or IL-1b). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with interleukin 6 (IL-6). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with interleukin 12 (IL-12). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with interleukin 18 (IL-18). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with tumor necrosis factor a (TNF-a). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with interferon gamma (IFNy). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with granulocyte-macrophage colony-stimulating factor (GM-CSF). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with soluble interleukin 6 receptor (sIL-6R). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with interleukin 17 (IL-17). In some aspects, a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) is stimulated with CD30.
[0123] In some aspects, the polynucleotide comprises a CCL20 promoter comprising, consisting of, or consisting essentially of the sequence set forth in SEQ ID NO: 1. In some aspects, the polynucleotide comprises a CCL20 promoter comprising, consisting of, or consisting essentially of the sequence set forth in SEQ ID NO: 2. In some aspects, the polynucleotide comprises a CCL20 promoter comprising, consisting of, or consisting essentially of the sequence set forth in SEQ ID NO: 3. In some aspects, the polynucleotide comprises a CCL20 promoter comprising, consisting of, or consisting essentially of the sequence set forth in SEQ ID NO: 4. In some aspects, the polynucleotide comprises a CCL20 promoter comprising, consisting of, or consisting essentially of the sequence set forth in SEQ ID NO: 5.
[0124] SEQ ID NO: 1 (full sequence of CCL20 promoter)
[0125] GAGAGTTCTTATACTGCCTTAGGTTAGGGATTCATATTACATTATCATCATTAGTACTGTTATTTGACATTTGCTGTGCTGACTAGCTACTGCTGATAGGTTTTCTTTCCTCAACAATTCTGAGGCTCTATATTGAGTTATATTAGTACATCATCATGGAGAGTTAAAGGTAGGTAAGGATTATTTTCTGAACTGCAATATTGATTAAAGCCATGTGAATGTATAAGATTCTTAGAAGAGTTGACATTAAATCAAGGTGAAGCTGAGGTTTGAGCCTTACTTAAAGGCTGATATTTTCCACTCTAACTGCGGACAGTACTGTAGCACTGTTATAGTACCTGCTCTGAATGTTAGTCTAGCAACTCAGGGTCTTCTTCATGACAGCTGAACCTCAACCATGTGATGGTAAATGTGTAGCAGAGTATGCCTGGCATCCCACCTGCTCCTCCTCCCCCTCCTCCTTGACTGGTTCTGGAAAGCAAATAGGGTGTAACAATAGGAGTTCTGGAATGTTCCTGTGTGGGGCTGACCTTTGTATCGCTGTTAATCCTCTATTTTCAGACACAAAAATGATTAAGTTAAAACTGGATGAAAGTCTTTTCTGGGTCACAGGGCTGAGCTGCTTTTGCTCTTTGCAAATACAAAGAATTTAACAGGATTCTCCCCTTCTCAACTTCCTGTCCCCCACCCTGACCTTCGCACCTTCCCAATATGAGGAAAAAGCAGGAAGTTTTCCTTGCGGGTTTTTTTTATGATGACATGATGGGGCCAGTTGATCAATGGGGAAAACCCCATGTGGCAACACGCCTTCTGTGTACATTCCCAATATTTGCTATAAATAGGGCCATCCCAGGCTGCTGTCAGAATATAACAGCACTCCCAAAGAACTGGGTACTCAACACTGAGCAGATCTGTTCTTTGA
[0126] SEQ ID NO: 2 (CCL20 promoter without 5' region)
[0127] GTTATTTGACATTTGCTGTGCTGACTAGCTACTGCTGATAGGTTTTCTTTCCTCAACAATTCTGAGGCTCTATATTGAGTTATATTAGTACATCATCATGGAGAGTTAAAGGTAGGTAAGGATTATTTTCTGAACTGCAATATTGATTAAAGCCATGTGAATGTATAAGATTCTTAGAAGAGTTGACATTAAATCAAGGTGAAGCTGAGGTTTGAGCCTTACTTAAAGGCTGATATTTTCCACTCTAACTGCGGACAGTACTGTAGCACTGTTATAGTACCTGCTCTGAATGTTAGTCTAGCAACTCAGGGTCTTCTTCATGACAGCTGAACCTCAACCATGTGATGGTAAATGTGTAGCAGAGTATGCCTGGCATCCCACCTGCTCCTCCTCCCCCTCCTCCTTGACTGGTTCTGGAAAGCAAATAGGGTGTAACAATAGGAGTTCTGGAATGTTCCTGTGTGGGGCTGACCTTTGTATCGCTGTTAATCCTCTATTTTCAGACACAAAAATGATTAAGTTAAAACTGGATGAAAGTCTTTTCTGGGTCACAGGGCTGAGCTGCTTTTGCTCTTTGCAAATACAAAGAATTTAACAGGATTCTCCCCTTCTCAACTTCCTGTCCCCCACCCTGACCTTCGCACCTTCCCAATATGAGGAAAAAGCAGGAAGTTTTCCTTGCGGGTTTTTTTTATGATGACATGATGGGGCCAGTTGATCAATGGGGAAAACCCCATGTGGCAACACGCCTTCTGTGTACATTCCCAATATTTGCTATAAATAGGGCCATCCCAGGCTGCTGTCAGAATATAACAGCACTCCCAAAGAACTGGGTACTCAACACTGAGCAGATCTGTTCTTTGA
[0128] SEQ ID NO: 3 (CCL20 promoter without 3' region)
[0129] GAGAGTTCTTATACTGCCTTAGGTTAGGGATTCATATTACATTATCATCATTAGTACTGTTATTTGACATTTGCTGTGCTGACTAGCTACTGCTGATAGGTTTTCTTTCCTCAACAATTCTGAGGCTCTATATTGAGTTATATTAGTACATCATCATGGAGAGTTAAAGGTAGGTAAGGATTATTTTCTGAACTGCAATATTGATTAAAGCCATGTGAATGTATAAGATTCTTAGAAGAGTTGACATTAAATCAAGGTGAAGCTGAGGTTTGAGCCTTACTTAAAGGCTGATATTTTCCACTCTAACTGCGGACAGTACTGTAGCACTGTTATAGTACCTGCTCTGAATGTTAGTCTAGCAACTCAGGGTCTTCTTCATGACAGCTGAACCTCAACCATGTGATGGTAAATGTGTAGCAGAGTATGCCTGGCATCCCACCTGCTCCTCCTCCCCCTCCTCCTTGACTGGTTCTGGAAAGCAAATAGGGTGTAACAATAGGAGTTCTGGAATGTTCCTGTGTGGGGCTGACCTTTGTATCGCTGTTAATCCTCTATTTTCAGACACAAAAATGATTAAGTTAAAACTGGATGAAAGTCTTTTCTGGGTCACAGGGCTGAGCTGCTTTTGCTCTTTGCAAATACAAAGAATTTAACAGGATTCTCCCCTTCTCAACTTCCTGTCCCCCACCCTGACCTTCGCACCTTCCCAATATGAGGAAAAAGCAGGAAGTTTTCCTTGCGGGTTTTTTTTATGATGACATGATGGGGCCAGTTGATCAATGGGGAAAACCCCATGTGGCAACACGCCTTCTGTGTACATTCCCAATATTTGCTATAAATAGGGCCATCCCAGGCTGCTGTCAGAATATAACAG
[0130] SEQ ID NO: 4 (CCL20 promoter, core region)
[0131] GTTATTTGACATTTGCTGTGCTGACTAGCTACTGCTGATAGGTTTTCTTTCCTCAACAATTCTGAGGCTCTATATTGAGTTATATTAGTACATCATCATGGAGAGTTAAAGGTAGGTAAGGATTATTTTCTGAACTGCAATATTGATTAAAGCCATGTGAATGTATAAGATTCTTAGAAGAGTTGACATTAAATCAAGGTGAAGCTGAGGTTTGAGCCTTACTTAAAGGCTGATATTTTCCACTCTAACTGCGGACAGTACTGTAGCACTGTTATAGTACCTGCTCTGAATGTTAGTCTAGCAACTCAGGGTCTTCTTCATGACAGCTGAACCTCAACCATGTGATGGTAAATGTGTAGCAGAGTATGCCTGGCATCCCACCTGCTCCTCCTCCCCCTCCTCCTTGACTGGTTCTGGAAAGCAAATAGGGTGTAACAATAGGAGTTCTGGAATGTTCCTGTGTGGGGCTGACCTTTGTATCGCTGTTAATCCTCTATTTTCAGACACAAAAATGATTAAGTTAAAACTGGATGAAAGTCTTTTCTGGGTCACAGGGCTGAGCTGCTTTTGCTCTTTGCAAATACAAAGAATTTAACAGGATTCTCCCCTTCTCAACTTCCTGTCCCCCACCCTGACCTTCGCACCTTCCCAATATGAGGAAAAAGCAGGAAGTTTTCCTTGCGGGTTTTTTTTATGATGACATGATGGGGCCAGTTGATCAATGGGGAAAACCCCATGTGGCAACACGCCTTCTGTGTACATTCCCAATATTTGCTATAAATAGGGCCATCCCAGGCTGCTGTCAGAATATAACAG
[0132] SEQ ID NO: 5 (CCL promoter, small)
[0133] CCCACCTGCTCCTCCTCCCCCTCCTCCTTGACTGGTTCTGGAAAGCAAATAGGGTGTAACAATAGGAGTTCTGGAATGTTCCTGTGTGGGGCTGACCTTTGTATCGCTGTTAATCCTCTATTTTCAGACACAAAAATGATTAAGTTAAAACTGGATGAAAGTCTTTTCTGGGTCACAGGGCTGAGCTGCTTT
[0134] In some aspects, a CCL20 promoter of the present disclosure is a functional variant of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5. In some aspects, a CCL20 promoter of the present disclosure is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5. As defined above, a functional fragment can be a truncated fragment of a CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is still capable of inducing expression of a heterologous protein encoded by a heterologous gene operatively linked to the CCL20 promoter in response to stimulation by a cytokine (e.g., IL-1a). Similarly, a functional variant can be a mutant of a CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional variant promoter is still capable of inducing expression of a heterologous protein encoded by a heterologous gene operatively linked to the CCL20 promoter in response to stimulation by a cytokine (e.g., IL-1a). In some aspects, the promoter activity of a functional fragment or functional variant is determined using a heterologous gene that is a reporter gene (e.g., luciferase).
[0135] In some aspects, a CCL20 functional fragment or functional variant promoter has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% of the activity of a CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0136] In some aspects, the CCL20 functional fragment or functional variant promoter has about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0137] In some aspects, the CCL20 functional fragment or functional variant promoter has about 20% to about 30%, about 25% to about 35%, about 30% to about 40%, about 35% to about 45%, about 40% to about 50%, about 45% to about 55%, about 50% to about 60%, about 55% to about 65%, about 60% to about 70%, about 65% to about 75%, about 70% to about 80%, about 75% to about 85%, about 80% to about 90%, about 85% to about 95%, about, or 90% to about 100% of the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0138] In some aspects, the CCL20 functional fragment or functional variant promoter is a gain-of-function promoter, i.e., the activity of the CCL20 functional fragment or functional variant promoter is higher than the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0139] In some aspects, the gain-of-function CCL20 promoter has at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% of the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0140] In some aspects, the gain-of-function CCL20 promoter has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold of the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0141] In some aspects, the gain-of-function CCL20 promoter has about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold of the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0142] In some aspects, the functionally obtained CCL20 promoter has from about 2-fold to about 3-fold, from about 3-fold to about 4-fold, from about 4-fold to about 5-fold, from about 5-fold to about 6-fold, from about 6-fold to about 7-fold, from about 7-fold to about 8-fold, from about 8-fold to about 9-fold, or from about 9-fold to about 10-fold the activity of the CCL20 promoter of any one of SEQ ID NOs: 1, 2, 3, 4, or 5 under the same experimental conditions.
[0143] In some aspects, the CCL20 promoter of the present disclosure has at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0144] In some aspects, the CCL20 promoter of the present disclosure has about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0145] In some aspects, the CCL20 promoter of the present disclosure has about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100% sequence identity to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0146] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0147] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises a truncation of at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, or at least about 600 nucleotides from the 5’ of the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0148] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises a truncation of about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, or about 600 nucleotides from the 5’ of the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0149] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises a truncation of at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, or at least about 600 nucleotides from the 5’ of the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0150] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises a truncation of about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, or about 600 nucleotides from the 3’ of the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0151] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises an internal truncation (i.e., a truncation that does not include the 5’ or 3’ end of the sequence) of at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, or at least about 600 nucleotides from the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0152] In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises an internal truncation (i.e., a truncation that does not include the 5’ or 3’ end of the sequence) of about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, or about 600 nucleotides from the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a). In some aspects, the CCL20 promoter is a functional fragment of a CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter comprises an internal truncation (i.e., a truncation that does not include the 5’ or 3’ end of the sequence) of at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, or at least about 600 nucleotides from the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional fragment promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0153] In some aspects, the CCL20 promoter is a functional variant of the CCL20 promoter having the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional variant promoter is a mutant capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a). As used herein, the term mutant refers to a CCL20 functional variant promoter comprising one or more nucleotide substitutions, insertions, or deletions relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 functional variant promoter is capable of inducing expression of a heterologous protein in response to stimulation by a cytokine (e.g., IL-1a).
[0154] In some aspects, the CCL20 functional variant promoter comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 substitutions. In some aspects, the CCL20 functional variant promoter comprises at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 substitutions. In some aspects, the CCL20 functional variant promoter comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 substitutions. In some aspects, the CCL20 functional variant promoter comprises about 20, about 25, about 30, about 35, about 40, about 45, or about 50 substitutions.
[0155] In some aspects, the CCL20 functional variant promoter comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or more deletions. In some aspects, the CCL20 functional variant promoter comprises at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 deletions. In some aspects, the CCL20 functional variant promoter comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 deletions. In some aspects, the CCL20 functional variant promoter comprises about 20, about 25, about 30, about 35, about 40, about 45, or about 50 deletions.
[0156] In some aspects, the CCL20 functional variant promoter comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or more insertions. In some aspects, the CCL20 functional variant promoter comprises at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 insertions. In some aspects, the CCL20 functional variant promoter comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 insertions. In some aspects, the CCL20 functional variant promoter comprises about 20, about 25, about 30, about 35, about 40, about 45, or about 50 insertions.
[0157] In some aspects, the mutation can comprise a plurality of nucleotides in the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, e.g., a subsequence comprising more than one nucleotide can be inserted, deleted, or substituted. In some aspects, the mutation comprises a single nucleotide change in the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, i.e., the mutation is a point mutation. In some aspects, the sequence of the CCL20 promoter of the present disclosure has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 point mutations relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5. In some aspects, the sequence of the CCL20 promoter of the present disclosure has at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 point mutations relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5. In some aspects, the point mutation is a conservative point mutation. In some aspects, the point mutation is a non-conservative point mutation. In some aspects, the point mutation includes both conservative and non-conservative point mutations.
[0158] In some aspects, a CCL20 promoter of the present disclosure comprises at least about 50 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 550 nucleotides, at least about 600 nucleotides, at least about 650 nucleotides, at least about 700 nucleotides, at least about 750 nucleotides, at least about 800 nucleotides, at least about 850 nucleotides, or at least about 900 nucleotides from the sequence set forth in SEQ ID NO: 1, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0159] In some aspects, a CCL20 promoter of the present disclosure comprises at least about 50 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 550 nucleotides, at least about 600 nucleotides, at least about 650 nucleotides, at least about 700 nucleotides, at least about 750 nucleotides, at least about 800 nucleotides, at least about 850 nucleotides, or at least about 900 nucleotides from the sequence set forth in SEQ ID NO: 2, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0160] In some aspects, a CCL20 promoter of the present disclosure comprises at least about 50 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 550 nucleotides, at least about 600 nucleotides, at least about 650 nucleotides, at least about 700 nucleotides, at least about 750 nucleotides, at least about 800 nucleotides, at least about 850 nucleotides, or at least about 900 nucleotides from the sequence set forth in SEQ ID NO: 3, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0161] In some aspects, a CCL20 promoter of the present disclosure comprises at least about 50 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 550 nucleotides, at least about 600 nucleotides, at least about 650 nucleotides, at least about 700 nucleotides, at least about 750 nucleotides, at least about 800 nucleotides, at least about 850 nucleotides, or at least about 900 nucleotides from the sequence set forth in SEQ ID NO: 4, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0162] In some aspects, a CCL20 promoter of the present disclosure comprises at least about 50 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 550 nucleotides, at least about 600 nucleotides, at least about 650 nucleotides, at least about 700 nucleotides, at least about 750 nucleotides, at least about 800 nucleotides, at least about 850 nucleotides, or at least about 900 nucleotides from the sequence set forth in SEQ ID NO: 5, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0163] In some aspects, a CCL20 promoter of the present disclosure comprises about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, about 650 nucleotides, about 700 nucleotides, about 750 nucleotides, about 800 nucleotides, about 850 nucleotides, or about 900 nucleotides from the sequence set forth in SEQ ID NO: 1, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0164] In some aspects, a CCL20 promoter of the present disclosure comprises about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, about 650 nucleotides, about 700 nucleotides, about 750 nucleotides, about 800 nucleotides, about 850 nucleotides, or about 900 nucleotides from the sequence set forth in SEQ ID NO: 2, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0165] In some aspects, a CCL20 promoter of the present disclosure comprises about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, about 650 nucleotides, about 700 nucleotides, about 750 nucleotides, about 800 nucleotides, about 850 nucleotides, or about 900 nucleotides from the sequence set forth in SEQ ID NO: 3, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0166] In some aspects, a CCL20 promoter of the present disclosure comprises about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, about 650 nucleotides, about 700 nucleotides, about 750 nucleotides, about 800 nucleotides, about 850 nucleotides, or about 900 nucleotides from the sequence set forth in SEQ ID NO: 4, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0167] In some aspects, the CCL20 promoter of the present disclosure comprises about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 550 nucleotides, about 600 nucleotides, about 650 nucleotides, about 700 nucleotides, about 750 nucleotides, about 800 nucleotides, about 850 nucleotides, or about 900 nucleotides from the sequence set forth in SEQ ID NO: 5, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0168] In some aspects, the CCL20 promoter of the present disclosure comprises between about 50 nucleotides and about 100 nucleotides, between about 100 nucleotides and about 150 nucleotides, between about 150 nucleotides and about 200 nucleotides, between about 200 nucleotides and about 250 nucleotides, between about 250 nucleotides and about 300 nucleotides, between about 300 nucleotides and about 350 nucleotides, between about 350 nucleotides and about 400 nucleotides, between about 400 nucleotides and about 450 nucleotides, between about 450 nucleotides and about 500 nucleotides, between about 500 nucleotides and about 550 nucleotides, between about 550 nucleotides and about 600 nucleotides, between about 600 nucleotides and about 650 nucleotides, between about 650 nucleotides and about 700 nucleotides, between about 700 nucleotides and about 750 nucleotides, between about 750 nucleotides and about 800 nucleotides, between about 800 nucleotides and about 850 nucleotides, between about 850 nucleotides and about 900 nucleotides, between about 100 nucleotides and about 200 nucleotides, between about 200 nucleotides and about 300 nucleotides, between about 300 nucleotides and about 400 nucleotides, between about 400 nucleotides and about 500 nucleotides, between about 500 nucleotides and about 600 nucleotides, between about 600 nucleotides and about 700 nucleotides, between about 700 nucleotides and about 800 nucleotides, between about 800 nucleotides and about 900 nucleotides, between about 100 nucleotides and about 300 nucleotides, between about 200 nucleotides and about 400 nucleotides, between about 300 nucleotides and about 500 nucleotides, between about 400 nucleotides and about 600 nucleotides, between about 500 nucleotides and about 700 nucleotides, between about 600 nucleotides and about 800 nucleotides, between about 700 nucleotides and about 900 nucleotides, between about 100 nucleotides and about 400 nucleotides, between about 200 nucleotides and about 500 nucleotides, between about 300 nucleotides and about 600 nucleotides, between about 400 nucleotides and about 700 nucleotides, between about 500 nucleotides and about 800 nucleotides, or between about 600 nucleotides and about 900 nucleotides from the sequence set forth in any one of SEQ ID NOs: 1, 2, 3, 4, or 5, wherein the CCL20 promoter can induce expression of a protein or nucleic acid encoded by a heterologous gene operably linked to the promoter in response to stimulation by a cytokine (e.g., IL-1a).
[0169] In some aspects, the CCL20 promoter of the present disclosure is about 100, about 125, about 150, about 175, about 200, about 225, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, or about 900 nucleotides in length. In some aspects, the CCL20 promoter of the present disclosure is at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 225, at least about 250, at least about 275, at least about 300, at least about 325, at least about 350, at least about 375, at least about 400, at least about 425, at least about 450, at least about 475, at least about 500, at least about 525, at least about 550, at least about 575, at least about 600, at least about 625, at least about 650, at least about 675, at least about 700, at least about 725, at least about 750, at least about 775, at least about 800, at least about 825, at least about 850, at least about 875, or at least about 900 nucleotides in length.
[0170] In some aspects, the heterologous gene encodes a nucleic acid. In some aspects, the nucleic acid is an endogenous nucleic acid, e.g., a miRNA. In some aspects, the nucleic acid is an exogenous nucleic acid, e.g., an RNA interference agent, such as an antisense oligonucleotide. In some aspects, the heterologous gene encodes a protein, e.g., a therapeutic protein. In some aspects, the therapeutic protein is, e.g., a chimeric antigen receptor (CAR), an antibody, a tumor suppressor, an apoptosis inducer, an enzyme, a hormone, or any combination thereof.
[0171] In some aspects, the therapeutic protein comprises an anti-inflammatory antibody or antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits TNF-a. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-6. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-12. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-23. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-12 and IL-23. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-2. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits immunoglobulin E (IgE). In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits interleukin 6 receptor (IL-6R). In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-17A. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-5. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-4RA. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-1B. In some aspects, the anti-inflammatory antibody or antigen-binding portion thereof inhibits IL-17RA.
[0172] In some aspects, the anti-inflammatory antibody comprises infliximab or an antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody comprises adalimumab or an antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody comprises ustekinumab or an antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody comprises basiliximab or an antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody comprises daclizumab or an antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody comprises ocrelizumab or an antigen-binding portion thereof. In some aspects, the anti-inflammatory antibody comprises
[0173] In some aspects, the heterologous gene encodes an antagonist of a pro-inflammatory cytokine. In some aspects, the heterologous gene encodes an interleukin. In some aspects, the heterologous gene encodes an anti-inflammatory interleukin. In some aspects, the heterologous gene encodes an antagonist of an inflammatory interleukin. In some aspects, the heterologous gene encodes an IL-1 receptor antagonist (IL-1RA). In some aspects, the heterologous gene encodes an interleukin 36 receptor antagonist (IL-36RA). In some aspects, the heterologous gene encodes an interleukin 37 (IL-37). In some aspects, the heterologous gene encodes IL-4. In some aspects, the heterologous gene encodes IL-6. In some aspects, the heterologous gene encodes IL-10. In some aspects, the heterologous gene encodes IL-11. In some aspects, the heterologous gene encodes IL-13. In some aspects, the heterologous gene encodes a specific cytokine receptor for IL-1. In some aspects, the heterologous gene encodes a specific receptor for TNF-a. In some aspects, the heterologous gene encodes a specific receptor for IL-18. In some aspects, the heterologous gene encodes an anti-inflammatory protein.
[0174] In some aspects, the heterologous gene encodes a protein or nucleic acid that can block expression of or inhibit the activity of a pro-inflammatory gene (i.e., a gene that promotes inflammation when expressed) or its protein product, such as IL-1, IL-4, IL-5, IL-6, IL-8, IL-12, IL-13, IL-17, IL-21, IL-22, IL-23, IL-27, IFN, CCL2, CCL3, CCL5, CCL20, CXCL5, CXCL10, CXCL12, CXCL13, or TNF-a.
[0175] In some aspects, the heterologous gene encodes a protein or nucleic acid that has a regulatory role in an inflammatory pathway. In some aspects, the heterologous gene encodes a regulatory protein in an inflammatory pathway. In some aspects, the heterologous gene encodes a regulatory protein or polypeptide that prevents activation of a proinflammatory pathway. In some aspects, the heterologous gene encodes an inhibitor of an inflammatory mediator. Thus, in some aspects, the heterologous gene can encode a modulator or inhibitor of a protein known to be a key mediator (target) in an inflammatory response pathway. Key mediator proteins that can be modulated, directly or indirectly, via the CCL20 promoter of the present disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional variant thereof) include, for example, Aggrecan, IFN-g, LFA-1, Th1, Angiogenin-2, Mac-1, Th2, BDNF, MCP-1 / CCL2, Th9, CD23, MCP-2 / CCL8, Th17, CD30, MCP-3 / CCL7, Th22, CD40L, MIG / CXCL9, TLR 1, C-reactive protein (CRP), IKK, MIP-1a / CCL3, TLR 2, CTL, IL-1, MIP-1b / CCL4, TLR 3, E-cadherin, IL-2, MIP-2, TLR 4, EGF, IL-3, NF-kappa B, TLR 5, ELAM-1, IL-4, PAI-1, TLR 6, Eotaxin / CCL11, IL-5, PDGF-BB, TLR 7, Basic FGF, IL-6, PECAM-1g, TLR 8, G-CSF, IL-8, p-selectin, TLR 9, GDNF, IL-10, RANTES / CCL5, TLR 10, GM-CSF, IL-12, SAA, TNF-a, GRO-a, IL-13, STAT1, TNF-beta, HGF, IL-15, STAT2, TGF-beta1, HIF-1a, IL-16, STAT3, TNF-RI, ICAM-1, IL-17, STAT4, TNF-RII, IFN-a, IL-18, STAT5, VCAM-1, IFN-beta, IL-23, STAT6, or VEGF.
[0176] In some aspects, the heterologous gene encodes a chimeric antigen receptor (CAR). In some aspects, the heterologous gene encodes an enzyme, e.g., an enzyme that is desired to be expressed at a level higher than the endogenous normal level, as part of an enzyme replacement therapy. In some aspects, the heterologous gene encodes a hormone. In some aspects, the heterologous gene encodes a protein or nucleic acid that, when expressed, results in a reduction of a systemic effect associated with inflammation, such as fever, leukocytosis, leukopenia, vasodilation, septic shock, swelling, pain, loss of function, redness (erythema), necrosis, or any combination thereof.
[0177] In general, the CCL20 promoters disclosed herein (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be used to elicit expression of any therapeutic protein or therapeutic nucleic acid in a subject following administration of a vector or cell comprising the CCL20 promoter disclosed herein operably linked to a gene encoding such a protein or nucleic acid (e.g., a cell transiently or stably transfected with a vector comprising the CCL20 promoter disclosed herein operably linked to a gene encoding such a protein or nucleic acid) or a viral particle comprising the CCL20 promoter disclosed herein operably linked to a gene encoding such a protein or nucleic acid. In some aspects, the therapeutic protein can be an antibody that targets cancer cells or a clotting factor. In some aspects, the heterologous gene encodes a reporter protein, such as luciferase, green fluorescent protein, red fluorescent protein, beta-galactosidase.
[0178] In some aspects, the disclosure provides a vector comprising a promoter region comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof. In some aspects, the vector comprises a heterologous gene operably linked to the CCL20 promoter. In some aspects, the vector does not comprise a heterologous gene operably linked to the CCL20 promoter. In some aspects, the CCL20 promoter is a functional fragment of the sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the functional fragment has a 5’ truncation, a 3’ truncation, or both, relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the CCL20 promoter is a functional variant having a sequence with at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the sequence of the CCL20 promoter functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 point mutations relative to the sequence set forth in any one of SEQ ID NOs: 1-5. In some aspects, the point mutations are conservative point mutations.
[0179] The disclosure also provides a composition comprising:
[0180] (a) a polynucleotide comprising a promoter region comprising a CCL20 promoter of the disclosure, i.e., a promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof, operatively linked to a heterologous gene (encoding, e.g., a therapeutic protein or a therapeutic nucleic acid), wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine (e.g., IL-α).
[0181] (b) a delivery vehicle for delivering the polynucleotide into a cell of a subject.
[0182] In some aspects, the delivery vehicle comprises a nucleic acid, a plasmid, a vector (e.g., a viral vector), a prokaryotic cell, a eukaryotic cell, a lipid, or any combination thereof. In some aspects, the delivery vehicle comprises a lipid in a lipid vesicle, such as a micelle, a liposome (e.g., a small unilamellar vesicle), a lipid particle (e.g., a lipid nanoparticle), or an extracellular vesicle (e.g., an exosome). In some aspects, the delivery vehicle comprises a viral particle. In some aspects, the delivery vehicle comprises a viral vector selected from the group consisting of an adeno-associated virus, an adenovirus, a retrovirus, an orthomyxovirus, a paramyxovirus, a papovavirus, a picornavirus, a lentivirus, a herpes simplex virus, a vaccinia virus, a poxvirus, and an alphavirus. In some aspects, the delivery vehicle comprises a prokaryotic cell. In some aspects, the delivery vehicle comprises a eukaryotic cell.
[0183] The disclosure also provides a method of producing a population of cells expressing at least one heterologous gene under the control of a CCL20 promoter of the disclosure, i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof, the method comprising transfecting a cell with a composition comprising a polynucleotide comprising a promoter region comprising a CCL20 promoter of the disclosure, i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof, operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine (e.g., IL-α).
[0184] In some aspects, the population of cells is prepared for administration to a subject in need thereof. In other aspects, the population of cells is prepared for production of a recombinant protein in a cell culture. In some aspects, the cells are human cells. In some aspects, the cells are human or non-human cell lines suitable for production of proteins in a cell culture, e.g., CHO cells.
[0185] The present disclosure also provides a cell genetically modified to express a heterologous gene, wherein the cell comprises a polynucleotide disclosed herein, e.g., a polynucleotide comprising a promoter region comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine (e.g., IL-α).
[0186] In some aspects, the cells can be inserted into a device (e.g., an implantable device). In some aspects, the cells are microencapsulated. In some aspects, the cells are microencapsulated in alginate microcapsules. This approach has the advantage over traditional gene therapy that the cells act as a prosthetic device, requiring no modification of the host genome.
[0187] In other aspects, the cells are implanted using alternative cell implantation techniques, such as biocompatible hollow fibers, which can enable easy removal of the implanted device.
[0188] The present disclosure also provides a pharmaceutical composition comprising a polynucleotide, composition, or cell disclosed herein, and a pharmaceutically acceptable carrier or excipient. The pharmaceutically acceptable excipient or carrier is determined in part by the particular composition being administered, as well as the particular method used to administer the composition.
[0189] The present disclosure also provides a method of inducing, modulating, or enhancing expression of a heterologous gene in a subject, the method comprising (a) administering to the subject a polynucleotide, composition, cell, or pharmaceutical composition disclosed herein comprising a heterologous gene under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof); and (b) stimulating the CCL20 promoter with a cytokine (e.g., IL-α).
[0190] Also provided is a method of dose-dependent gene expression of a heterologous gene in a cell, the method comprising (a) contacting the cell with a polynucleotide, composition, cell, or pharmaceutical composition disclosed herein comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operatively linked to a heterologous gene; and (b) contacting the cell with an effective amount of a cytokine (e.g., IL-α) capable of stimulating the CCL20 promoter to induce expression of the heterologous gene in a dose-dependent manner.
[0191] The present disclosure also provides a method of controlling or inducing gene expression of a heterologous gene, the method comprising operatively coupling a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) to the heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a) controls or induces expression of the heterologous gene in response to the stimulation. Also provided is a method of treating a disease in a subject, the method comprising administering to the subject an effective amount of a polynucleotide, composition, cell, or pharmaceutical composition disclosed herein. In some aspects, administering to the subject a construct comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a heterologous gene comprises transfecting a cell from the subject or a cell from a donor with the construct. Transfecting the cell with the construct can be performed using any molecular biology methods known in the art. In some aspects, the construct is inserted into the genome of the cell using a nuclease system (e.g., CRISPR / Cas9).
[0192] The present disclosure also provides methods of controlling inflammation in a subject in need thereof, the methods comprising operatively coupling a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) to a heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL-6, sIL-6R, IL-17, or CD30) induces expression of the heterologous gene in response to the stimulation, wherein the heterologous gene directly or indirectly reduces immune activation via increasing or decreasing expression of another gene (e.g., a regulatory gene in an inflammatory pathway). In some aspects, expression of the heterologous gene induced by the CCL20 promoter functionally results in a reduction of a systemic effect associated with inflammation. For example, it can reduce fever, leukocytosis, leukopenia, vasodilation, septic shock, swelling, pain, loss of function, redness (erythema), necrosis, or any combination thereof.
[0193] As described above, the cytokines used to stimulate the CCL20 promoters of the disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) can be exogenous (i.e., the source of the cytokine is external) or endogenous (i.e., the cytokine has an internal source). In some aspects, the endogenous source of the cytokine is an ongoing inflammatory condition in the subject, e.g., a chronic condition. In some aspects, the endogenous source of the cytokine is a change in an inflammatory condition, e.g., a sudden onset or worsening of some inflammatory condition or an infection. In both of these cases, the inflammation will be naturally occurring, i.e., it will not be induced to trigger an increase in endogenous cytokines. In other aspects, the inflammation is induced, i.e., there is an external cause that deliberately causes inflammation, which in turn triggers the endogenous release of inflammatory cytokines.
[0194] In some aspects, the cytokines used to stimulate the CCL20 promoters are exogenous, e.g., they are administered to the subject to stimulate the promoters. When the CCL20 promoters of the disclosure are used for recombinant gene expression, the cytokines used to stimulate the CCL20 promoters can be added to the culture medium.
[0195] In some aspects, the expression of a heterologous gene under the control of a CCL20 promoter of the disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) relative to the expression of the same heterologous gene under the control of a reference promoter (e.g., the serum amyloid 3 (SAA3) promoter, a promoter that can be activated by IL-1 and IL-6) can result in increased expression of the heterologous gene. Thus, in some aspects, the disclosure provides methods of increasing the expression of a heterologous gene, the methods comprising expressing such a heterologous gene under the control of a CCL20 promoter of the disclosure (i.e., the CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof), wherein the expression under the control of the CCL20 promoter increases the expression of the heterologous gene by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200%, at least about 225%, at least about 250%, at least about 275%, at least about 300%, at least about 325%, at least about 350%, at least about 375%, at least about 400%, at least about 425%, at least about 450%, at least about 475%, or at least about 500% relative to the expression observed using a reference promoter, wherein the reference promoter is the SAA3 promoter.
[0196] In some aspects, the present disclosure provides methods of increasing expression of a heterologous gene, the methods comprising expressing such heterologous gene under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof), wherein expression under the control of the CCL20 promoter increases expression of the heterologous gene by about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, about 200%, about 225%, about 250%, about 275%, about 300%, about 325%, about 350%, about 375%, about 400%, about 425%, about 450%, about 475%, or about 500% relative to expression observed using a reference promoter, wherein the reference promoter is a SAA3 promoter.
[0197] In some aspects, the present disclosure provides methods of increasing expression of a heterologous gene, the methods comprising expressing such heterologous gene under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof), wherein expression under the control of the CCL20 promoter increases expression of the heterologous gene by between about 20% and about 30%, between about 30% and about 40%, between about 40% and about 50%, between about 50% and about 60%, between about 60% and about 70%, between about 70% and about 80%, between about 80% and about 90%, between about 90% and about 100%, between about 100% and about 110%, between about 110% and about 120%, between about 120% and about 130%, between about 130% and about 140%, between about 140% and about 150%, between about 150% and about 160%, between about 160% and about 170%, between about 170% and about 180%, between about 180% and about 190%, between about 190% and about 200%, between about 200% and about 225%, between about 225% and about 250%, between about 250% and about 275%, between about 275% and about 300%, between about 300% and about 325%, between about 325% and about 350%, between about 350% and about 375%, between about 375% and about 400%, between about 400% and about 425%, between about 425% and about 450%, between about 450% and about 475%, between about 475% and about 500% relative to expression observed using a reference promoter, wherein the reference promoter is a SAA3 promoter.
[0198] The present disclosure also provides a gene therapy vector comprising a heterologous gene that, when expressed, increases or decreases immune activation in a subject, wherein the gene is under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof). The present disclosure also provides a gene therapy cell comprising a heterologous gene that, when expressed, increases or decreases immune activation in a subject, wherein the gene is under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof). The present disclosure also provides a method of personalized medicine comprising administering a gene therapy vector or cell comprising a heterologous gene that, when expressed, increases or decreases immune activation in a subject, wherein the gene is under the control of a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof).
[0199] The present disclosure also provides a diagnostic sensor comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof). As used herein, the term “diagnostic sensor” refers to any compound, material, or device that can be used to indicate the level of inflammation when exposed to a sample of an animal comprising an inflammatory cytokine capable of stimulating a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof). In some aspects, the diagnostic sensor comprises a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) linked to an operable linker to a reporter gene (e.g., luciferase). In some aspects, the presence of an inflammatory cytokine such as IL-1a, IL-1b, TNF-a, TNF-b, IL6, sIL-6R, IL-17, or CD30 in the sample triggers expression of the reporter gene (e.g., luciferase) when the diagnostic sensor is contacted with the sampler. Accordingly, the present disclosure also provides methods of determining the level of an inflammatory cytokine or the level of inflammation, comprising contacting a sample from a subject with a diagnostic sensor disclosed herein.
[0200] This disclosure also provides a tunable regulatory system comprising a construct containing a GAL4-VP16 synthetic transcription factor under the control of the CCL20 promoter of this disclosure (i.e., the CCL20 promoter of any of SEQ ID NO: 1-5 or a functional fragment or variant thereof). GAL4-VP16 promotes transcription of a downstream heterologous gene when one or more homologous DNA binding sites (UAS, upstream activation sequences) of GAL4-VP16 are present. The number of UAS elements can control the amount of transcription of the downstream gene. Therefore, the number of UAS elements can be varied to control the expression level of the heterologous gene downstream of the UAS elements. In some aspects, the tunable regulatory system of this disclosure comprises a single polynucleotide containing a CCL20 promoter of this disclosure (i.e., the CCL20 promoter of any of SEQ ID NO: 1-5 or a functional fragment or variant thereof) operatively linked to the GAL4-VP16 synthetic transcription factor, and one or more UAS elements operatively linked further downstream in the construct to a nucleic acid encoding a heterologous protein. In some respects, the tunable regulatory system of this disclosure comprises two polynucleotides: (1) a first polynucleotide comprising the CCL20 promoter of this disclosure (i.e., the CCL20 promoter or a functional fragment or variant thereof of any of SEQ ID NO:1-5) operably linked to the GAL4-VP16 synthetic transcription factor, and (2) a second polynucleotide comprising one or more UAS sites operably linked to a nucleic acid encoding a heterologous protein.
[0201] In some aspects, this disclosure provides a method for controlling the expression of a heterologous protein using a tunable regulatory system disclosed herein, wherein the expression level of the heterologous protein is correlated with the number of UAS elements in the construct. In some aspects, the tunable regulatory system may include at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten UAS elements. In some aspects, the tunable regulatory system may include one, two, three, four, five, six, seven, eight, nine, or ten UAS elements.
[0202] III. Indications
[0203] The present disclosure provides methods of treating an inflammatory disease or condition in a subject in need thereof, comprising administering to the subject a construct comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL-6, sIL-6R, IL-17, or CD30) induces expression of the heterologous gene in response to the stimulation. The present disclosure also provides methods of preventing or ameliorating symptoms of a disease or condition in a subject in need thereof, comprising administering to the subject a construct comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional variant thereof) operably linked to a heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL-6, sIL-6R, IL-17, or CD30) induces expression of the heterologous gene in response to the stimulation.
[0204] The present disclosure also provides methods of preventing and / or treating a disease or disorder in a subject in need thereof, comprising administering to the subject a construct comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL-6, sIL-6R, IL-17, or CD30) induces expression of the heterologous gene in response to the stimulation. In some aspects, the treatment is prophylactic.
[0205] In other aspects, administering to a subject a construct comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a heterologous gene can be used to induce an immune response, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL-6, sIL-6R, IL-17, or CD30) induces expression of the heterologous gene in response to the stimulation. Thus, in some aspects, a construct comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a heterologous gene can be used to vaccinate a subject.
[0206] In some aspects, the compositions and methods disclosed herein can be used to treat an inflammatory disease of the central nervous system (CNS), such as encephalitis, myelitis, meningitis, or arachnoiditis; an inflammatory disease of the peripheral nervous system (PNS), such as neuritis; an inflammatory disease of the eye: lacrimalitis, scleritis, episcleritis, keratitis, retinitis, chorioretinitis, blepharitis, conjunctivitis, or uveitis; an inflammatory disease of the ear, such as otitis externa, otitis media, labyrinthitis, mastoiditis; an inflammatory disease of the cardiovascular system, such as carditis, endocarditis, myocarditis, pericarditis, vasculitis, arteritis, phlebitis, or capillaritis; an inflammatory disease of the respiratory system, such as sinusitis, rhinitis, pharyngitis, laryngitis, tracheitis, bronchitis, bronchiolitis, pneumonitis, pleuritis, or mediastinitis; an inflammatory disease of the digestive system and accessory digestive organs, such as stomatitis, gingivitis, gingivostomatitis, glossitis, tonsillitis, sialoadenitis / parotiditis, cheilitis, pulpitis, gnathitis, esophagitis, gastritis, gastroenteritis, enteritis, colitis, enterocolitis, duodenitis, ileitis, cecitis, appendicitis, diabetes, proctitis, hepatitis, ascending cholangitis, cholecystitis, or pancreatitis, or peritonitis; an inflammatory disease of the integumentary system, such as dermatitis, folliculitis, cellulitis, or hidradenitis; an inflammatory disease of the musculoskeletal system, such as arthritis, dermatomyositis, myositis, synovitis, tenosynovitis, bursitis, enthesitis, fasciitis, cystitis, epicondylitis, tendonitis, panniculitis, osteochondritis, osteitis, osteomyelitis, spondylitis, serositis, or chondritis; an inflammatory disease of the urinary system, such as nephritis, glomerulonephritis, pyelonephritis, ureteritis, cystitis, or urethritis; an inflammatory disease of the reproductive system, such as oophoritis, salpingitis, endometritis, parametritis, cervicitis, vaginitis, vulvitis, mastitis, orchitis, epididymitis, prostatitis, seminal vesiculitis, balanitis, foreskinitis, or balano-foreskinitis; an inflammatory disease of the endocrine system, such as insulitis, pituititis, thyroiditis, parathyroiditis, or adrenalitis; or an inflammatory disease of the lymphatic system, such as lymphangitis or lymphadenitis.
[0207] Inflammatory disorders are a large group of diseases that are the cause of many human diseases. The immune system is often implicated in inflammatory disorders, as exhibited in allergies and some myopathies, and many immune system diseases result in abnormal inflammation. In some aspects, the compositions and methods disclosed herein can be used to treat non-immune diseases that have an etiology rooted in inflammatory processes, including cancer, atherosclerosis, and ischemic heart disease. Inflammatory disorders also include acne vulgaris, rosacea, asthma, atopic eczema, allergic rhinitis, autoimmune diseases (e.g., celiac disease, irritable bowel syndrome, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, type 1 diabetes, Graves' disease, psoriasis, or aplastic anemia), autoinflammatory diseases (e.g., adult-onset Still's disease, systemic juvenile idiopathic arthritis, Schnitzler syndrome, chronic recurrent multifocal osteomyelitis, familial Mediterranean fever (FMF), hyperimmunoglobulinemia D with recurrent fever (HIDS), TNF receptor associated periodic syndrome (TRAPS), Muckle-Wells syndrome (Urticaria-Deafness-amyloidosis syndrome), familial cold urticaria, neonatal-onset multisystem inflammatory disease (NOMID), periodic fever-aphthous stomatitis-pharyngitis-adenitis (PFAPA) syndrome, Blau syndrome, pyogenic sterile arthritis-pyoderma gangrenosum-acne syndrome (PAPA), deficiency of interleukin-1 receptor antagonist (DIRA), or Yao syndrome), chronic prostatitis, colitis, diverticulitis, glomerulonephritis, hidradenitis suppurativa, hypersensitivity reactions, inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis, Behcet's disease, microscopic colitis, diversion colitis, or indeterminate colitis), interstitial cystitis, lichen planus, mast cell activation syndrome, mastocytosis, otitis, pelvic inflammatory disease, peripheral ulcerative keratitis, pneumonia, reperfusion injury, rheumatic fever, rheumatoid arthritis, rhinitis, sarcoidosis, transplant rejection, vasculitis, atherosclerosis, allergy, anaphylaxis, myopathy (e.g., systemic sclerosis, dermatomyositis, polymyositis, or inclusion body myositis), leukocyte defects (e.g., Chédiak-Higashi syndrome or chronic granulomatous disease), drug-induced inflammation, vitamin A deficiency, HIV and AIDS, or cancer (e.g., cancers associated with chronic inflammation such as mesothelioma, lung cancer, bladder cancer, oral squamous cell carcinoma, colorectal cancer, vulvar squamous cell carcinoma, pancreatic cancer, esophageal cancer, salivary gland cancer, MALT lymphoma, or melanoma; cancers associated with infectious agents such as cholangiocarcinoma, colon cancer, gallbladder cancer, gastric adenocarcinoma, hepatocellular carcinoma, B-cell non-Hodgkin's lymphoma, Burkitt's lymphoma, non-Hodgkin's lymphoma, squamous cell carcinoma, Kaposi's sarcoma, skin cancer, ovarian cancer, cervical cancer, anal cancer, bladder cancer, liver cancer, rectal cancer, or splenic follicular lymphoma).
[0208] In some aspects, the inflammation is caused by a pathogen, which is a microorganism that causes disease in humans, such as a virus, bacteria, prion, fungus, or parasite. In some aspects, the inflammation is caused by a viral disease, for example by a pathogen of the Adenoviridae, Picornaviridae, Herpesviridae, Hepadnaviridae, Coronaviridae, Flaviviridae, Retroviridae, Orthomyxoviridae, Paramyxoviridae, Papovaviridae, Polyomaviridae, Poxviridae, Rhabdoviridae, and Togaviridae. Some notable viral diseases include smallpox, influenza, mumps, measles, chickenpox, Ebola, rubella, Zika fever, yellow fever, West Nile fever, viral pneumonia, shingles, COVID-19, SARS, MERS, rotavirus infection, Rift Valley fever, respiratory syncytial virus infection, rabies, polio, norovirus infection, Epstein-Barr virus mononucleosis (glandular fever), herpes hepatitis, hepatitis A, hepatitis B, hepatitis C, hepatitis D, or hepatitis E, hantavirus pulmonary syndrome, Ebola, dengue fever, common cold, AIDS, or adenovirus infection. In some aspects, the inflammation is caused by a bacterial disease, for example anthrax (Bacillus anthracis infection), bacterial meningitis, bacterial pneumonia, bubonic plague (Yersinia pestis infection), botulism (Clostridium botulinum infection), cholera (Vibrio cholerae infection), diphtheria (Corynebacterium diphtheriae infection), epidemic typhus (Rickettsia prowazekii infection), glander (Burkholderia mallei infection), meningitis (Neisseria meningitidis infection), whooping cough (pertussis) (Bordetella pertussis infection), salmonella infection, scarlet fever (group A Streptococcus infection), sepsis, shigellosis (bacterial dysentery) (Shigella infection), toxic shock syndrome (TSS) (Staphylococcus aureus or Streptococcus pyogenes infection), tuberculosis (Mycobacterium tuberculosis infection), or typhoid fever (Salmonella typhi infection).
[0209] In some aspects, the disease or condition that can be treated using the compositions or methods disclosed herein is cancer. When a construct comprising a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a heterologous gene is administered to a subject having cancer, wherein stimulation of the CCL20 promoter by a cytokine (e.g., IL-1a, IL-1b, TNF (TNF-a or TNF-b), IL-6, sIL-6R, IL-17, or CD30) induces expression of the heterologous gene in response to the stimulation, in certain aspects, expression of the heterologous gene product can upregulate the immune response and enhance tumor targeting by the subject’s immune system. In other words, while in some cases the constructs disclosed herein can be used to reduce inflammation associated with cancer, in other cases, the constructs disclosed herein can be used to increase inflammation to improve tumor targeting. In the first case, the presence of endogenous inflammatory cytokines will induce expression of a heterologous gene encoding, for example, an anti-inflammatory cytokine. In the second case, low levels of presence of endogenous inflammatory cytokines can be amplified by the constructs of the disclosure: stimulation of the CCL20 promoter by endogenous inflammatory cytokines will induce expression of a pro-inflammatory cytokine.
[0210] IV. Kits and articles of manufacture
[0211] The disclosure also provides kits and articles of manufacture comprising a polynucleotide disclosed herein, e.g., a polynucleotide encoding a CCL20 promoter of the disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof), e.g., a vector.
[0212] In some aspects, the disclosure provides a kit or article of manufacture comprising (i) a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof; (ii) a vector comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof; or (iii) a diagnostic construct or sensor comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof operably linked to a reporter gene; and instructions for use.
[0213] In some aspects, the CCL20 promoter comprising the sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, is operably linked to a heterologous gene. In some aspects, the vector comprising the CCL20 promoter comprising the sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, comprises a heterologous gene operably linked to the CCL20 promoter. In some aspects, the diagnostic construct or sensor comprising the CCL20 promoter operably linked to a reporter gene comprises the sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, comprising an additional heterologous gene (e.g., encoding a therapeutic protein or therapeutic nucleotide) also operably linked to the CCL20 (e.g., in a bicistronic construct).
[0214] In some aspects, the CCL20 promoter comprising the sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, is not operably linked to a heterologous gene. In some aspects, the vector comprising the CCL20 promoter comprising the sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, does not comprise a heterologous gene operably linked to the CCL20 promoter. In some aspects, the diagnostic construct or sensor comprising the CCL20 promoter operably linked to a reporter gene comprises the sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, but does not comprise an additional heterologous gene (e.g., encoding a therapeutic protein or therapeutic nucleotide) also operably linked to the CCL20 promoter.
[0215] In some aspects, the present disclosure provides a kit or article of manufacture comprising (i) a polynucleotide disclosed herein, e.g., a polynucleotide encoding a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof), e.g., a vector comprising such a promoter), (ii) optionally a solvent and / or other reagents, and (iii) instructions explaining, e.g., how to generate a construct comprising a heterologous gene under the control of a CCL20 promoter of the present disclosure.
[0216] In some aspects, the present disclosure provides a kit or article of manufacture comprising a diagnostic sensor of the present disclosure and optional instructions for use. In some aspects, the diagnostic sensor comprises a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof) linked to a reporter gene (e.g., luciferase) via an operable linker.
[0217] In some aspects, the present disclosure provides a kit or article of manufacture comprising the tunable expression system of the present disclosure and optionally instructions for use. In some aspects, the tunable regulatory system comprises a single polynucleotide comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a GAL4-VP16 synthetic transcription factor, and one or more UAS elements operably linked to a nucleic acid encoding a heterologous protein further downstream in the construct. In some aspects, the tunable regulatory system comprises two polynucleotides: (1) a first polynucleotide comprising a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof) operably linked to a GAL4-VP16 synthetic transcription factor, and (2) a second polynucleotide comprising one or more UAS sites operably linked to a nucleic acid encoding a heterologous protein.
[0218] Such kits and articles of manufacture can comprise containers with one or more of the various components used in the methods disclosed herein, including, for example, the polynucleotides disclosed herein, e.g., a polynucleotide encoding a CCL20 promoter of the present disclosure (i.e., a CCL20 promoter of any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof), e.g., a vector comprising such a promoter. In some aspects, the kit comprises a printed instruction. Accordingly, kits provided in accordance with the present disclosure can also include a booklet or instructions. The instructions included in the kit can be affixed to the packaging material, or can be included as a package insert. While the instructions are typically written or printed material, they are not so limited. Any medium capable of storing such instructions and communicating them to the end-user is contemplated. Such media include, without limitation, electronic storage media (e.g., magnetic disks, magnetic tapes, cartridges, chips), optical media (e.g., CD ROMs) and the like. As used herein, the term “instructions” can include addresses to internet websites that provide the instructions.
[0219] ***
[0220] The following examples are provided by way of illustration, and not limitation.
[0221] Example
[0222] Example 1
[0223] In response to inflammation, gene expression under (operably linked to) the CCL20 promoter is increased.
[0224] A synthetic construct encoding the firefly luciferase gene without any promoter sequence was also obtained (designated Promoterless-FF-Luc, or Promoterless Control) (Promega pGL4.10[luc2]). A synthetic construct was generated from pGL4.10[luc2] (designated CCL20-FF-Luc or CCL20-Luc) that encodes the firefly luciferase gene under the control of (operably linked to) the CCL20 promoter of SEQ ID NO: 1. A third synthetic construct was also generated from pGL4.10[luc2] (designated SAA3-FF-Luc) that encodes the firefly luciferase under the control of (operably linked to) the SAA3 promoter. In addition, a synthetic control construct was also obtained (designated SV40-FF-Luc) that encodes the firefly luciferase under the control of (operably linked to) the SV40 constitutively active promoter (Promega pGL4.35[luc2 / SV40]).
[0225] Four groups of HeLa cells were transfected with Lipofectamine 3000 (Invitrogen) with either the CCL20-FF-Luc, Promoterless-FF-Luc, SAA3-FF-Luc, or SV40-FF-Luc construct and the construct pGL4.75[hRluc / CMV] to normalize the transfection differences. To mimic inflammatory conditions, the inflammatory cytokine interleukin-1 alpha (IL-1a) was added to each cell culture at a concentration of 5 ng / ml, and after 0.5, 2, 4, and 24 hours of IL-1a stimulation, luciferase expression was measured using the luciferase reporter assay (i.e., luciferase reporter assay). Expression of firefly and sea pansy luciferases was determined using the Promega Dual-Glo Luciferase Assay System and read on a luminometer that is capable of measuring luminescence.
[0226] Figure 1A and Figure 1B A graph showing the fold induction of gene expression induced by each promoter (CCL20, SAA3, or SV40) or Promoterless is shown. In cells transfected with both the CCL20-FF-Luc construct and the SAA3-FF-Luc construct, luciferase expression levels increased after 2 hours and 4 hours of IL-1a stimulation, while in cells transfected with the Promoterless-FF-Luc construct, luciferase levels remained unchanged at any time Figure 1A ).
[0227] The CCL20 promoter produced 117-fold higher levels of luciferase in the presence of IL-1 alpha stimulation for 4 hours than in the absence of IL-1 alpha, while the SAA3 promoter produced 27-fold higher levels of luciferase in the presence of IL-1 alpha stimulation than in the absence of IL-1 alpha. The no promoter construct did not differ in the presence or absence of IL-1 alpha. The SV40 promoter produced high levels of luciferase in the presence or absence of IL-1 alpha Figure 1B The results of the luciferase reporter assay described above show that the CCL20 promoter has a higher efficiency in inducing downstream gene expression in the presence of IL-1 alpha (an agent that mimics an inflammatory-like condition) than the SAA3 promoter. The results also show that the CCL20 promoter can effectively induce gene expression in response to stimulation by an inflammatory cytokine.
[0228] To further investigate the ability of the CCL20 promoter to control the level of expression of a specific gene in response to an inflammatory signal (here, IL-1 alpha stimulation), a synthetic fusion construct (CCL20-IL-1RA) was generated that encodes interleukin-1 receptor antagonist (IL-1RA) under the control of (operably linked to) the CCL20 promoter. A second synthetic construct (CMV-IL-1RA) was also produced that encodes IL-1RA under the control of a constitutively active CMV promoter.
[0229] HeLa cells were transfected with CCL20-IL-1RA, CMV-IL-1RA, or CCL20-FF-Luc construct using Lipofectamine 3000 (Invitrogen) and stimulated with 5 ng / ml IL-1 alpha. IL-1RA expression levels were measured over a period of 0 to 25 hours of IL-1 alpha stimulation. Cells transfected with the CCL20-FF-Luc construct (a control construct that does not encode IL-1RA) did not show any IL-1RA expression. Cells transfected with CMV-IL-1RA (IL-1RA under the control of a constitutively active CMV promoter) showed a constant high level of IL-1RA expression and did not show any change in IL-1RA expression upon IL-1 alpha stimulation. Cells transfected with the CCL20-IL-1RA construct showed increased levels of IL-1RA expression upon IL-1 alpha stimulation Figure 2 These results show that the CCL20 promoter is able to regulate IL-1RA expression in response to an inflammatory signal (here, IL-1 alpha).
[0230] Example 2
[0231] Proinflammatory cytokine expression under the control of the CCL20 promoter and upon exposure to an inflammatory signal is reduced.
[0232] To address whether IL-1RA expression under the control of the CCL20 promoter was able to reduce the level of pro-inflammatory cytokine expression and whether this reduction showed any dose-dependence relative to the amount of inducing cytokine used, HeLa cells were transfected with CCL20-IL-1RA, CMV-IL-1RA or CCL20-FF-Luc constructs using Lipofectamine 3000 (Invitrogen), stimulated with 5 ng / ml IL-1 and the levels of IL-8, IL-6 and MCP-1 in the extracellular environment were measured using the Biolegend Legendplex Human Inflammation Panel 1 from 0 to 25 hours of IL-1 alpha stimulation.
[0233] After stimulation of CCL20-FF-Luc (construct not encoding IL-1RA) transfected cells with IL-1 alpha, IL-8, IL-6 and MCP-1 expression levels remained at high levels ( Figures 3A to 3C ). In CMV-IL-1RA construct transfected cells, i.e. cells expressing high levels of IL-1RA constitutively under the control of the constitutively active CMV promoter, IL-8, IL-6 and MCP-1 expression levels remained at low levels (without increase) Figures 3A to 3C ) in response to IL-1 alpha stimulation. In CCL20-IL-1RA construct transfected cells, IL-8, IL-6 and MCP-1 expression levels also remained at low levels (without increase) in response to IL-1 alpha stimulation, indicating that the CCL20 promoter was able to produce high levels of IL-1RA Figures 3A to 3C ) after IL-1 alpha stimulation, which then could inhibit downstream inflammatory signaling.
[0234] These results show that by expressing a pro-inflammatory cytokine antagonist under the control of the CCL20 promoter, immune activation can be reduced. Furthermore, this regulation is at least equivalent to producing high levels of pro-inflammatory cytokine antagonist present at the time of pro-inflammatory signal initiation (IL-1 alpha stimulation).
[0235] Example 3
[0236] IL-10 expression in response to IL-1 alpha stimulation of the CCL20 promoter
[0237] HeLa cells were transfected with CCL20-IL10 constructs using Lipofectamine 3000 (Invitrogen) and stimulated with 5 ng / ml IL-1a. IL-10 expression levels were measured at 24 hours of IL-1a stimulation. Unstimulated cells produced only low levels of IL-10 immunomodulator, while stimulation resulted in high levels of IL-10 stimulation, as measured by IL-10 ELISA. See Figure 4 .
[0238] Example 4
[0239] Tunable secondary regulation using the CCL20 promoter
[0240] A construct was created using the GAL4-VP16, a synthetic transcription factor, under the control of the CCL20 promoter. GAL4-VP16 promotes transcription of downstream genes when its cognate DNA binding site, the UAS, is present. The number of UAS elements can control the amount of transcription of the downstream gene. A construct containing 9 UAS sites was obtained (Promega pGL4.35[luc2P / 9XGAL4UAS / Hygro]) and used to create a construct with 4 UAS sites and a construct with 2 UAS sites. Each UAS construct was co-transfected into HeLa cells with the CCL20-GAL4-VP16 construct and a CMV- Renilla luciferase construct. Cells were then stimulated with 0, 0.05, 0.1, 0.5, 1, 5, or 10 ng / ml IL-1a for 4 hours and luciferase levels were measured by the Dual Glo luciferase detection system, normalized to Renilla luciferase to eliminate any transfection differences, and then compared to the 0 ng / ml stimulation level to determine the fold increase in luciferase expression. The constructs exhibited a dose-dependent response relative to 1) the concentration of IL-1a stimulation and 2) the number of UAS elements present in the reporter construct. See Figure 5 .
[0241] ***
[0242] It is to be understood that the detailed description section is intended to be used for interpreting the claims, not the summary and abstract sections. The summary and abstract sections can set forth one or more but not all exemplary embodiments of the present application as contemplated by the inventors, and thus are not intended to limit the present application and the appended claims in any way.
[0243] The present application has been described above by means of functional building blocks illustrating the implementation of particular functions and their relationships. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternative boundaries can be defined so long as the specified functions and their relationships are appropriately performed.
[0244] The foregoing description of the specific embodiments will so fully reveal the general nature of the application that others can modify and / or adjust such specific embodiments without undue experimentation to accommodate particular situations without departing from the general concept thereof This disclosure is therefore to be considered as in all respects to be only illustrative and not restrictive and all such modifications are intended to be included within the meaning and range of equivalents of the disclosed embodiments. Accordingly, it should be understood that the application is not to be limited to the specific embodiments disclosed.
[0245] The breadth and scope of the application should not be limited to any of the above-described exemplary embodiments, but should be defined in accordance with the following claims and their equivalents.
[0246] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, suitable methods and materials are described herein.
[0247] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. Database entries and electronic publications disclosed in the present disclosure are incorporated by reference in their entirety. The version of a database entry or electronic publication incorporated by reference in the present application is the most recent version publicly available as of the filing date of this application. Database entries disclosed in the present application corresponding to gene or protein identifiers (e.g., identified by accession numbers or database identifiers of public databases such as Genbank, Refseq, or Uniprot) are incorporated by reference in their entirety. The incorporated information related to the gene or protein is not limited to the sequence data contained in the database entry. The information incorporated by reference includes the entire content of the database entry in the most recent version of the database publicly available as of the filing date of this application. In the event of a conflict between the present specification (including definitions) and the incorporated information, the present specification (including definitions) controls. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Claims
1. A polynucleotide comprising a promoter region comprising a C-C motif chemokine ligand 20 (CCL20) promoter operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine.
2. The polynucleotide of claim 1, wherein the CCL20 promoter comprises a sequence set forth in any one of SEQ ID NOs: 1-5.
3. The polynucleotide of claim 1, wherein the CCL20 promoter is a functional fragment or functional variant of a sequence set forth in any one of SEQ ID NOs: 1-5.
4. The polynucleotide of claim 3, wherein the CCL20 promoter is a functional fragment.
5. The polynucleotide of claim 4, wherein the functional fragment has a 5’ truncation, a 3’ truncation, or both, relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5.
6. The polynucleotide of claim 3, wherein the CCL20 promoter is a functional variant having a sequence with at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-5.
7. The polynucleotide of claim 3, wherein the CCL20 promoter functional variant has a sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 point mutations.
8. The polynucleotide of claim 7, wherein the point mutations are conservative point mutations.
9. The polynucleotide of claim 1, wherein the heterologous gene encodes a protein.
10. The polynucleotide of claim 9, wherein the protein is a therapeutic protein.
11. The polynucleotide of claim 10, wherein the therapeutic protein is a chimeric antigen receptor (CAR), an antibody, a tumor suppressor, an apoptosis inducer, an enzyme, or a hormone.
12. A composition comprising (a) a polynucleotide comprising a promoter region comprising a CCL20 promoter operatively linked to a heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine, and (b) a delivery vehicle for delivering the polynucleotide into a cell of a subject.
13. The composition of claim 12, wherein the delivery vehicle is a nucleic acid, a plasmid, a vector, a prokaryotic cell, a eukaryotic cell, or a lipid.
14. The composition of claim 13, wherein the lipid is comprised in a lipid vesicle.
15. The composition of claim 13, wherein the lipid vesicle is a micelle, a liposome, a lipid nanoparticle, or an extracellular vesicle.
16. The composition of claim 13, wherein the vector is a viral vector selected from the group consisting of an adeno-associated virus, an adenovirus, a retrovirus, an orthomyxovirus, a paramyxovirus, a papovavirus, a picornavirus, a lentivirus, a herpes simplex virus, a vaccinia virus, a poxvirus, and an alphavirus.
17. A vector comprising a promoter region, the promoter region comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5 or a functional fragment or functional variant thereof.
18. The vector of claim 17, wherein the CCL20 promoter is a functional fragment.
19. The vector of claim 18, wherein the functional fragment has a 5’ truncation, a 3’ truncation, or both, relative to the CCL20 promoter sequence set forth in any one of SEQ ID NOs: 1-5.
20. The vector of claim 17, wherein the CCL20 promoter is a functional variant having a sequence with at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-5.
21. The vector of claim 17, wherein the sequence of the CCL20 promoter functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 point mutations relative to the sequence set forth in any one of SEQ ID NOs: 1-5.
22. The vector of claim 21, wherein the point mutations are conservative point mutations.
23. A method of producing a cell expressing at least one heterologous gene, the method comprising introducing into the cell a composition comprising a polynucleotide comprising a promoter region comprising a CCL20 promoter operatively linked to the heterologous gene, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine.
24. A cell genetically modified to express a heterologous gene, the cell comprising the polynucleotide of any one of claims 1-11, the composition of any one of claims 12-16, or the vector of any one of claims 17-22.
25. A pharmaceutical composition comprising the polynucleotide of any one of claims 1-11, the composition of any one of claims 12-16, the vector of any one of claims 17-22, or the cell of claim 24, and a pharmaceutically acceptable carrier or excipient.
26. A method of inducing, modulating, or enhancing expression of a heterologous gene in a subject, the method comprising (a) administering to the subject the polynucleotide of any one of claims 1 to 11, the composition of any one of claims 12 to 16, the vector of any one of claims 17 to 22, the cell of claim 24, or the pharmaceutical composition of claim 25; and (b) stimulating the CCL20 promoter with a cytokine.
27. A method of inducing dose-dependent gene expression of a heterologous gene in a cell, the method comprising (a) contacting the cell with the polynucleotide of any one of claims 1 to 11, the composition of any one of claims 12 to 16, the vector of any one of claims 17 to 22, the cell of claim 24, or the pharmaceutical composition of claim 25; and (b) contacting the cell with an effective amount of a cytokine capable of stimulating the CCL20 promoter to induce expression of the heterologous gene in a dose-dependent manner.
28. A method of controlling or inducing gene expression of a heterologous gene, the method comprising stimulating a CCL20 promoter operatively linked to the heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine controls or induces expression of the heterologous gene in response to the stimulation.
29. A method of treating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the polynucleotide of any one of claims 1 to 11, the composition of any one of claims 12 to 16, the vector of any one of claims 17 to 22, the cell of claim 24, or the pharmaceutical composition of claim 25.
30. The method of claim 29, further comprising stimulating the CCL20 promoter with an exogenous cytokine.
31. A method of controlling inflammation in a subject, the method comprising operatively linking a CCL20 promoter to a heterologous gene, wherein stimulation of the CCL20 promoter by a cytokine induces expression of the heterologous gene in response to the stimulation, wherein the heterologous gene controls inflammation by increasing or decreasing immune activation or increasing or decreasing expression of a gene that modulates an inflammatory pathway.
32. The polynucleotide, composition, vector, cell, or method of any one of claims 1 to 31, wherein the cytokine that stimulates the CCL20 promoter is selected from the group consisting of IL-1a, IL-1b, TNF-a, IL-6, sIL-6R, IL-17, CD30, or any combination thereof.
33. The polynucleotide, composition, vector, cell, or method of any one of claims 1 to 31, wherein the cytokine that stimulates the CCL20 promoter is an interleukin.
34. The polynucleotide, composition, vector, vector, cell, or method of claim 33, wherein the interleukin is interleukin-1.
35. The polynucleotide, composition, vector, cell, or method of claim 34, wherein the interleukin-1 is IL-1a.
36. The polynucleotide, composition, vector, cell, or method of any one of claims 1 to 35, wherein the cytokine that stimulates the CCL20 promoter is an exogenous cytokine.
37. The polynucleotide, composition, vector, cell, or method of any one of claims 1 to 35, wherein the cytokine that stimulates the CCL20 promoter is an endogenous cytokine.
38. The polynucleotide, composition, vector, cell, or method of claim 37, wherein the endogenous cytokine that stimulates the CCL20 promoter is a result of inflammation.
39. The polynucleotide, composition, vector, cell, or method of claim 38, wherein the inflammation is naturally occurring.
40. The polynucleotide, composition, vector, cell, or method of claim 38, wherein the inflammation is induced.
41. The polynucleotide, composition, vector, cell, or method of any one of claims 1 to 40, wherein use of the CCL20 promoter increases expression of the heterologous gene by at least about 20%, at least about 40%, at least about 60%, at least about 80%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, or at least about 500% relative to expression observed using a reference promoter.
42. The polynucleotide, composition, vector, cell, or method of claim 41, wherein the reference promoter is serum amyloid A3 (SAA3 promoter).
43. A gene therapy vector or cell comprising a gene that, when expressed, increases or decreases immune activation in a subject, wherein the gene is under the control of a CCL20 promoter.
44. A gene therapy vector or cell comprising a gene that, when expressed, increases or decreases inflammatory response in a subject, wherein the gene is under the control of a CCL20 promoter.
45. A method of producing a recombinant protein, the method comprising culturing a cell comprising a polynucleotide comprising a CCL20 promoter operatively linked to a heterologous gene encoding the recombinant protein, wherein the CCL20 promoter induces expression of the heterologous gene in response to stimulation by a cytokine.
46. A method of determining the presence of one or more inflammatory cytokines in a sample from a subject, the method comprising (i) contacting a polynucleotide or cell comprising a CCL20 promoter operatively linked to a heterologous gene encoding a reporter protein with the sample, and (ii) determining expression of the reporter protein in response to stimulation of the CCL20 promoter by an inflammatory cytokine in the sample.
47. A kit or article of manufacture comprising (i) a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof; (ii) a vector comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof; or (iii) a diagnostic construct or sensor comprising a CCL20 promoter comprising a sequence set forth in any one of SEQ ID NOs: 1-5, or a functional fragment or functional variant thereof, operably linked to a reporter gene; and instructions for use.
Citation Information
Cited By
IPS cell-derived BDNF recombinant expression vector and application thereof
CN121780622A