A single-stranded DNA molecular weight standard based on light-controlled self-assembly and a preparation method thereof

Single-stranded DNA molecular weight standards were prepared by photo-controlled self-assembly technology. By combining photosensitive bridging groups and nucleic acid ligases, the problems of high cost and difficulty in modifying single-stranded small DNA fragment molecular weight standards were solved, and low-cost, high-efficiency preparation of multiple DNA molecular weight standards with equally increasing sequence lengths was achieved.

CN121087128BActive Publication Date: 2026-02-06XIANGFU LAB
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511640514.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-11
Publication Date
2026-02-06
Estimated Expiration
2045-11-11

AI Technical Summary

Technical Problem

In existing technologies, the preparation of molecular weight standards for single-stranded small DNA fragments is costly and difficult to modify, especially fluorescently labeled single-stranded DNA molecular weight standards, which are expensive to purchase and difficult to produce on a large scale.

Method used

Using photo-controlled self-assembly technology, a hairpin structure is formed by chemically synthesizing DNA sequences containing photosensitive bridging groups. The photosensitive bridging groups are then broken by ultraviolet light and self-assembled using nucleic acid ligase. A three-step inactivation method is then used to prepare single-stranded DNA molecular weight standards.

Benefits of technology

It enables low-cost and efficient preparation of single-stranded DNA molecular weight standards with multiple sequences of progressively increasing length, and is particularly suitable for chemically modified DNA molecular weight standards in the range of 20-100 nt. It solves the problems of high preparation cost and difficult modification, and has the advantages of simple process, low cost and strong scalability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121087128B_ABST
    Figure CN121087128B_ABST
Patent Text Reader

Abstract

The application discloses a single-stranded DNA molecular weight standard based on light-controlled self-assembly and a preparation method thereof, and comprises the following steps: S1, chemically synthesizing a DNA sequence containing a photosensitive bridging group, which can self-assemble to form a hairpin structure, and self-assembly can also occur between the hairpin structures; S2, annealing the DNA sequence, and self-assembly of individual DNA sequences to form hairpin structures; S3, mixing the hairpin structures with a nucleic acid ligase, under ultraviolet light, the photosensitive bridging group is broken, the exposed single-stranded sequence is paired with other hairpin structures through base complementation, and cascade self-assembly is realized through the nucleic acid ligase; S4, heat inactivation treatment; S5, ultraviolet light treatment is performed again, so that all the photosensitive bridging groups are broken; and S6, an electrophoresis loading buffer is added, and low-temperature preservation is carried out. The application adopts a one-pot method to rapidly prepare the DNA molecular weight standard, has the advantages of simple process, low manufacturing cost and strong expandability, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a single-stranded DNA molecular weight standard based on light-controlled self-assembly and a preparation method thereof. BACKGROUND

[0002] A DNA molecular weight standard is a series of mixed DNA fragment standard reagents with different molecular weight sizes. In the field of molecular biology, the DNA molecular weight standard is used to calibrate the molecular weight of a DNA fragment to be measured. The specific calibration method is to perform electrophoresis experiments on the same agarose gel or polyacrylamide for the DNA molecular weight standard and the DNA fragment to be measured. The DNA fragments with known lengths in the DNA molecular weight standard form a gradient distribution band, indicating the size and distribution of the unknown size of the DNA fragment to be measured.

[0003] In molecular biology experiments, since the DNA molecular weight standard is a necessary reagent with high frequency of use and large consumption, there is a great demand for its preparation, and it is required to have low production cost, high indication accuracy and high diversity.

[0004] In the prior art, there are two main methods for preparing a DNA molecular weight standard, namely PCR amplification and enzyme digestion of a plasmid. The main principle of PCR amplification is to design primers, amplify according to the required length by using a template DNA, purify after amplification, and finally mix the obtained different DNA fragments. The main principle of enzyme digestion of a plasmid is to design a pair of primers, amplify by using a template DNA, and obtain DNA fragments. However, for special modified DNA molecular weight standards, such as fluorescent labeling or single-stranded DNA molecular weight standards, there is a lack of simple and efficient preparation methods. In particular, small fragments of single-stranded DNA, such as 20 nt DNA molecular weight standards, have high costs due to their small fragment length when using the PCR amplification method, and the enzyme digestion of a plasmid method often produces extra bands, which is not conducive to subsequent purification and limits large-scale production. Currently, small fragment single-stranded DNA molecular weight standards or DNA molecular weight standards with fluorescent modification have high purchase costs, and there is no single-stranded DNA molecular weight standard with fluorescent modification. SUMMARY

[0005] The purpose of the present application is to provide a single-stranded DNA molecular weight standard based on light-controlled self-assembly and a preparation method thereof, thereby solving the technical bottleneck of high preparation cost and difficult modification of small fragment single-stranded DNA molecular weight standards in the prior art.

[0006] In order to solve the above problems, the present application adopts the following technical solutions:

[0007] According to a first aspect of the present application, there is provided a preparation method of single-stranded DNA molecular weight standard based on photo-controlled self-assembly, comprising the following steps: S1: chemically synthesizing a DNA sequence containing a photosensitive bridging group, the DNA sequence can self-assemble to form a hairpin structure, and self-assembly can also occur between the hairpin structures, the photosensitive bridging group is located in the middle of the DNA sequence, so that it can be broken to form two partially complementary DNA sequences after photolysis; S2: annealing the DNA sequence containing the photosensitive bridging group, and self-assembling individual DNA sequences to form hairpin structures; S3: mixing the hairpin structures obtained in step S2 with a nucleic acid ligase, under ultraviolet light, the photosensitive bridging group is broken, the exposed single-stranded sequence is paired with other hairpin structures through base complementation, and cascade self-assembly is realized through the nucleic acid ligase, and the time of the ultraviolet light determines the maximum length of the prepared DNA molecular weight standard; S4: after the ultraviolet light is turned off, the reaction system is placed at high temperature, and the nucleic acid ligase is heat-inactivated; S5: the reaction system after heat-inactivated treatment is subjected to ultraviolet light treatment again, so that all the photosensitive bridging groups are broken; S6: a corresponding volume of electrophoresis loading buffer is added to prepare a single-stranded DNA molecular weight standard solution, and the solution is stored at low temperature.

[0008] Preferably, in step S1, the photosensitive bridging group is selected from PC linker (3-(4,4'-Dimethoxytrityl)-1-(2-nitrophenyl)-propan-1-yl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite), o-nitrobenzyl, or p-hydroxyphenylpropionate, etc., to meet different light response requirements. It should be understood that any photosensitive bridging group having such properties is suitable for the present application, but the 5' end needs to retain a phosphate group after breaking.

[0009] According to the present application, if a single-stranded DNA molecular weight standard is prepared, the middle of the DNA chain needs to be modified with a photosensitive bridging group. It should be understood that the preparation of a single-stranded DNA molecular weight standard uses a hairpin structure design and modifies a photosensitive bridging group in the middle of the stem, which produces two equal-length single-stranded DNA fragments after breaking, and the length is determined by half of the total length of the hairpin DNA.

[0010] Preferably, the photosensitive hairpin DNA structure has a length of 40-120 nt. More preferably, 40 nt hairpin DNA is used as a raw material for preparing a single-stranded DNA molecular weight marker, i.e., the DNA sequences on both sides of the photosensitive bridging group PC linker are 20 nt, and thus the sequence length gradient of the DNA molecular weight marker prepared is 20 nt. It should be understood that the sequence length of the photosensitive hairpin DNA structure is only used as a preferred example for illustration and is not intended to be limiting. The sequence length is preferably 40-120 nt, which can ensure a high efficiency of self-assembly and a high accuracy and low cost in synthesis.

[0011] Preferably, in step S1, a functional group modification is performed during the synthesis of the DNA sequence, and the functional group modification is selected from a Cy3 fluorescent group, a Cy5 fluorescent group, an azido group, a methylation modification, a digoxin label, or a methylene blue modification.

[0012] Preferably, in step S3, the two single-stranded DNAs produced after the cleavage of the photosensitive bridging group have an equal number of bases, and the number of bases determines the sequence length difference of the DNA molecular weight marker prepared.

[0013] Preferably, in step S3, each self-assembly connection increases the number of bases of the DNA chain by a fixed number, forming a single-stranded DNA molecular weight marker with a fixed gradient, and the fixed gradient is selected from 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, etc.

[0014] Preferably, in step S3, the ultraviolet wavelength range is 315-405 nm, the light intensity is 0.1-1000 mW / cm², and the irradiation time is 0.1-60 min.

[0015] According to a preferred scheme of the present application, the ultraviolet wavelength range is 315-405 nm, the light intensity is 30 mW / cm², and the irradiation time is 1 min.

[0016] Preferably, in step S3, the nucleic acid ligase is an enzyme with DNA ligation function, including T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, 9°N DNA Ligase, E. coli DNA ligase, SplintR ligase, 5´ App DNA / RNA thermostable ligase, T4 RNA ligase, T4 RNA ligase 2, or RtcB ligase.

[0017] According to an embodiment of the present application, the nucleic acid ligase is T4 DNA ligase, and the final concentration of the T4 DNA ligase is 0.1-100 U / μL.

[0018] According to the method of the present application, the concentration of the nucleic acid ligase and the reaction time jointly determine the number of self-assembly, but the concentration and the reaction time mentioned above are the preferred conditions used in the experiment and are not intended to be limiting.

[0019] It should also be understood that, according to the method of the present application, the concentration of the hairpin DNA is not limited. Preferably, in step S3, the concentration of the hairpin DNA is 0.01-100 μM, and the DNA concentration is adjusted according to the requirement of the target product.

[0020] Preferably, in step S4, three-step inactivation of heating at 65°C for 10 minutes, ice bath quenching, and EDTA chelation is performed in sequence to ensure complete elimination of the enzyme activity. The present application first adopts such a three-step inactivation method to ensure complete inactivation and product stability. The heating at 65°C for 10 minutes is to make the protein structure of the nucleic acid ligase denatured by heat, the ice bath quenching is to quickly fix the inactivated state of the enzyme to prevent its renaturation, and the EDTA chelation is to further ensure complete elimination of the enzyme activity by combining with the metal ions to remove the metal ions required by the active center of the nucleic acid ligase.

[0021] According to the present application, different functional groups or different numbers of functional groups can be modified during the synthesis, and the functional groups are selected from Cy3 fluorescent group, Cy5 fluorescent group, azide, methylation, digoxin, or methylene blue, etc. to prepare different modified DNA molecular weight standards. For example, the modification of the fluorescent groups such as Cy3 and Cy5 can make the DNA molecular weight standards easy to be detected and tracked in the fluorescence detection experiment; the methylation modification can affect the certain biological activity of the DNA and has different application values in the specific experimental requirements.

[0022] The reaction buffer includes but is not limited to 6.6 mM MgCl2, 1 mM ATP, 10 mM DTT, 66 mM Tris-HCl buffer with pH 7.6, or other concentrations and pH buffers as long as they can ensure the activity of the enzyme, which can be used in the present application, such as PBS, D-PBS, potassium phosphate buffer, etc., and different concentrations of ATP solution in the range of 0.1-10 mM. It should be understood that the reaction buffer is the preferred condition in the experiment and is not intended to be limiting, and any nucleic acid ligase buffer can be used in the present application.

[0023] According to the second aspect of the present application, a single-stranded DNA molecular weight standard prepared by using the preparation method is provided, and the single-stranded DNA molecular weight standard includes a plurality of single-stranded DNA molecular weight standards with equal-difference incremental sequence lengths.

[0024] According to the present application, since the photosensitive bridging group is located in the middle of the DNA sequence, the number of bases of the two single-stranded DNAs generated after the photosensitive bridging group is broken is equal, and the number of bases determines the sequence length difference of the DNA molecular weight standard prepared therefrom.

[0025] According to a preferred embodiment of the present application, a method for preparing a DNA molecular weight standard based on DNA light-controlled self-assembly is provided, comprising the following steps:

[0026] Directional self-assembly control: 0.01-100 μM DNA sequence containing a photosensitive bridging group (such as a PC linker) forms a self-assembly structure in a 66 mM Tris-HCl buffer (pH 7.6) containing 6.6 mM MgCl2, 1 mM ATP, 10 mM DTT;

[0027] Molecular weight gradient generation: T4 DNA ligase is added to a final concentration of 20 U / μL, under ultraviolet light irradiation, the photosensitive bridging group (such as a PC linker) is broken, the exposed single-stranded region binds to the complementary region of the adjacent hairpin structure, and the connection reaction is realized by the DNA ligase, and the number of fixed bases is increased by controlling the reaction time (0.5-8 minutes) to accurately regulate the number of self-assembly times, forming an arithmetic gradient;

[0028] Product stabilization treatment: a three-step inactivation method is used, i.e. heating at 65°C for 10 minutes → ice bath quenching → EDTA chelation to ensure complete elimination of enzyme activity, and then the reaction system is irradiated with ultraviolet light to break all the photosensitive bridging groups.

[0029] Product storage: dilute the product to the corresponding concentration, and add the corresponding volume of electrophoresis loading buffer to the system to prepare a DNA molecular weight standard solution, and store it at 4°C.

[0030] According to the preparation method of the DNA molecular weight standard provided by the present application, combined with Figure 1 As shown in the figure, the working principle is as follows: the DNA containing the photosensitive bridging group can form a hairpin structure, and the sequence exposed after the photosensitive bridging group is broken can self-assemble with another hairpin structure and be connected by a nucleic acid ligase, and each connection assembly increases the same number of bases, forming a gradient-increasing DNA fragment, i.e. a single-stranded DNA molecular weight standard. When preparing a DNA molecular weight standard with modification, a single-stranded DNA raw material with corresponding modification is used.

[0031] According to the preparation method of the DNA molecular weight standard provided by the present application, a total of two self-assemblies are involved, one in step S2 and one in step S3.

[0032] In the present application, the self-assembly in step S2 refers to the self-assembly of single DNA sequences through annealing to form hairpin structures.

[0033] In the present application, the self-assembly in step S3 refers to the process in which the sequences exposed after the cleavage of the photosensitive bridging group can spontaneously form specific spatial structures with another hairpin structure through base complementary pairing. Specifically, the sequences exposed after the cleavage of the photosensitive bridging group can recognize and bind with another hairpin structure through base pairing (such as A-T, C-G pairing), so that the two hairpins are directionally assembled together to form a stable composite structure. The complementary sequence is to preliminarily orient the two hairpins close to each other in the self-assembly process, and the self-assembly complementary sequence determines the specificity and stability of the final self-assembly structure. This self-assembly is the basis for the subsequent action of DNA ligase, and the assembled structure provides a recognizable ligation site for the ligase, so that the nucleic acid ligase can connect adjacent DNA chains, and then by controlling the reaction time and other conditions, DNA molecular weight standards with equal difference increments (such as 20 nt, 40 nt, 60 nt, etc.) are generated.

[0034] According to the present application, the lengths of the "complementary sequence" and "self-assembly complementary sequence" of the two hairpin DNAs are not fixed, and the number of bases at both ends of the photosensitive bridging group is the same (which determines the sequence length difference of the molecular weight standard), which provides the basis for the flexibility and gradient control of self-assembly.

[0035] Although self-assembly and enzyme ligation are prior art, the main point of the present application is to introduce hairpin structure and photosensitive bridging group to achieve gradient precision control and raw material versatility. The pre-folded conformation of the hairpin structure realizes precise spatial positioning through complementary sequences, so that the exposed sequence is quickly oriented and paired after light control, avoiding non-specific binding, and its stem loop structure also enhances the rigidity of the complex, providing a stable template for the ligase. At the same time, the hairpin design can flexibly control the gradient interval (such as 20 nt, 40 nt, etc.) by adjusting the length ratio of the complementary sequence, and its closed structure significantly inhibits error hybridization and side reactions, improving product purity. The photosensitive bridging group realizes instantaneous and precise sequence cutting and assembly initiation through light control triggering, and its symmetry design strictly guarantees the consistency of sequence length, thereby forming an accurate arithmetic gradient. In addition, the same photosensitive bridging group can be adapted to different hairpin sequences, and only the complementary region needs to be adjusted to extend the application, greatly improving the versatility of raw materials. The method of the present application overcomes the high cost of preparing traditional single-stranded DNA molecular weight standards and the high complexity of the preparation process, and can prepare multiple sequence length arithmetic increasing DNA molecular weight standards through a simple reaction process. The innovation of the present application is that the starting raw material is only one DNA chain, avoiding the problem of mixed ratio of two DNA chains, which still has residual DNA chains that are not complementary after double-stranded annealing assembly, affecting product purity, and the method is more simple and efficient.

[0036] Compared with the prior art, the superiority of the technical scheme of the present application mainly lies in the following aspects:

[0037] 1) Light-controlled self-assembly control: using the self-assembly characteristics between hairpins, cutting through light control, and realizing directional ligation through base complementary pairing, which is different from the random fragment generation of traditional enzyme cutting or PCR;

[0038] 2) Gradient precise control: by controlling the reaction time of nucleic acid ligase, realizing the arithmetic gradient of increasing fixed base number each time, solving the problem of irregular gradient interval in the prior art;

[0039] 3) Three-step inactivation method: through the combination of heating, ice bath and EDTA complexation, the enzyme activity is completely eliminated, and the product stability is improved, while the prior art may only use single heating inactivation, which has relatively limited effect;

[0040] 4) Raw material versatility: using short chain DNA (such as 40 nt) as raw material, which can be extended to long fragments through self-assembly, reducing the synthesis cost, while the traditional chemical synthesis method has high cost for long fragments.

[0041] In summary, the preparation method of the single-stranded DNA molecular weight standard based on light-controlled self-assembly provided by the present application can prepare single-stranded DNA molecular weight standards with different gradients, and the process is simple and the preparation cost is low. The method can also prepare DNA molecular weight standards with different modifications, such as fluorescent molecule modification and cholesterol modification. It is particularly suitable for preparing DNA molecular weight standards with a chemical modification function in the range of 20-100 nt, and solves the technical bottleneck of high preparation cost and difficult modification of single-stranded small fragment DNA molecular weight standards in the prior art. The present application uses one-pot method to quickly prepare DNA molecular weight standards, which has the advantages of simple process, low manufacturing cost, strong expandability and good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 A flow chart for preparing a single-stranded DNA molecular weight standard based on light-controlled self-assembly according to the method of the present application, it should be understood that the step of annealing self-assembly from DNA sequence into hairpin structure is omitted, mainly showing the steps of light-controlled self-assembly and inactivation treatment;

[0043] Figure 2 A denaturing electrophoresis comparison chart of the 20 nt single-stranded DNA molecular weight standard prepared according to Example 1 of the present application and a commercial single-stranded DNA molecular weight standard; wherein band 1 is a commercial molecular weight standard, and band 2 is a molecular weight standard prepared by the method;

[0044] Figure 3 A denaturing electrophoresis gel chart of the 20 nt single-stranded DNA molecular weight standard prepared according to Example 1 of the present application and a known 42 nt single-stranded DNA; wherein band 1 is a 20 nt single-stranded DNA molecular weight standard prepared by the method, and band 2 is a 42 nt single-stranded DNA;

[0045] Figure 4 A denaturing electrophoresis gel chart of the 25 nt single-stranded DNA molecular weight standard prepared according to Example 2 of the present application and a known 42 nt single-stranded DNA; wherein band 1 is a 25 nt single-stranded DNA molecular weight standard prepared by the method, and band 2 is a 42 nt single-stranded DNA;

[0046] Figure 5Molecular weight standard of 20 nt single-stranded DNA prepared according to Example 3 of the present application using different UV reaction times; wherein, lane 1 is a commercial molecular weight standard, lane 2 is a single-stranded DNA molecular weight standard prepared by UV reaction for 0.5 min, lane 3 is a single-stranded DNA molecular weight standard prepared by UV reaction for 1 min, lane 4 is a single-stranded DNA molecular weight standard prepared by UV reaction for 2 min, lane 5 is a single-stranded DNA molecular weight standard prepared by UV reaction for 3 min, lane 6 is a single-stranded DNA molecular weight standard prepared by UV reaction for 4 min, lane 7 is a single-stranded DNA molecular weight standard prepared by UV reaction for 5 min, lane 8 is a single-stranded DNA molecular weight standard prepared by UV reaction for 6 min, lane 9 is a single-stranded DNA molecular weight standard prepared by UV reaction for 7 min, and lane 10 is a single-stranded DNA molecular weight standard prepared by UV reaction for 8 min;

[0047] Figure 6 Molecular weight standard of 20 nt single-stranded DNA prepared according to Example 4 of the present application using different reaction concentrations of DNA hairpin structure; wherein, lane 1 is a commercial molecular weight standard, lane 2 is a single-stranded DNA molecular weight standard prepared by 0.1 μM, lane 3 is a single-stranded DNA molecular weight standard prepared by 0.5 μM, lane 4 is a single-stranded DNA molecular weight standard prepared by 1 μM, lane 5 is a single-stranded DNA molecular weight standard prepared by 2 μM, lane 6 is a single-stranded DNA molecular weight standard prepared by 4 μM, lane 7 is a single-stranded DNA molecular weight standard prepared by 6 μM, lane 8 is a single-stranded DNA molecular weight standard prepared by 8 μM, and lane 9 is a single-stranded DNA molecular weight standard prepared by 10 μM;

[0048] Figure 7The assembly effect of different concentrations of different types of DNA ligase using 20 nt single-stranded molecular weight marker and ultraviolet reaction for 1 min according to embodiment 5 of the present application; wherein, band 1 is a single-stranded DNA molecular weight marker prepared by 15 U / μL T3 DNA ligase, band 2 is a single-stranded DNA molecular weight marker prepared by 75 U / μL T3 DNA ligase, band 3 is a single-stranded DNA molecular weight marker prepared by 150 U / μL T3 DNA ligase, band 4 is a single-stranded DNA molecular weight marker prepared by 225 U / μL T3 DNA ligase, band 5 is a single-stranded DNA molecular weight marker prepared by 300 U / μL T3 DNA ligase, band 6 is a single-stranded DNA molecular weight marker prepared by 1.75 U / μL T4 DNA ligase, band 7 is a single-stranded DNA molecular weight marker prepared by 8.75 U / μL T4 DNA ligase, band 8 is a single-stranded DNA molecular weight marker prepared by 17.5 U / μL T4 DNA ligase, band 9 is a single-stranded DNA molecular weight marker prepared by 26.25 U / μL T4 DNA ligase, band 10 is a single-stranded DNA molecular weight marker prepared by 35 U / μL T4 DNA ligase, band 11 is a single-stranded DNA molecular weight marker prepared by 15 U / μL T7 DNA ligase, band 12 is a single-stranded DNA molecular weight marker prepared by 75 U / μL T7 DNA ligase, band 13 is a single-stranded DNA molecular weight marker prepared by 150 / μL T7 DNA ligase, band 14 is a single-stranded DNA molecular weight marker prepared by 225 U / μL T7 DNA ligase, and band 15 is a single-stranded DNA molecular weight marker prepared by 300 U / μL T7 DNA ligase. DETAILED DESCRIPTION

[0049] The present application is further described in conjunction with the following specific examples. It should be understood that the following examples are intended to illustrate the application and are not intended to limit the scope of the application. Unless otherwise indicated, the techniques utilized in the examples are routine procedures available to those skilled in the art, or are performed according to the manufacturer's instructions for the kit and apparatus used. The reagents and materials used in the examples are commercially available unless otherwise indicated.

[0050] Table 1 DNA sequences used in the present specification

[0051] Name 5’ - 3’ PC20nt GGCACACACTTGAAAACCGG / iPCLink / GTGTGTGCCCCGGTTTTCAA PC25nt GGCACACACACAATAAAACCGGAAG / iPCLink / TGTGTGTGTGCCCTTCCGGTTTTAT

[0052] Example 1: Preparation of 20 nt single-stranded DNA molecular weight marker

[0053] 10 μM 40 nt PC linker-containing DNA (PC20nt) was annealed to hybridize with itself to form a hairpin structure. The annealed hairpin structure was mixed with T4 DNA ligase (the final concentration of DNA was 2 μM) and placed under a UV lamp (30 mW) for 1 min. After the reaction, the system was placed at 65°C for 10 min. After the heat inactivation of the ligase, the above system was reacted under a UV lamp (200 mW) for 10 min. The same volume of 2× denaturation loading buffer was added to the system, and the system was stored at 4°C.

[0054] As shown in the results in Figure 2 , band 1 is a commercial DNA molecular weight marker of a certain company, and band 2 is the DNA molecular weight marker prepared in this example. It can be seen that 11 DNA molecular weight markers are successfully prepared according to the method of this example for 1 min.

[0055] As shown in the results in Figure 3 , band 1 is a DNA molecular weight marker prepared from 20 nt single-stranded DNA, and band 2 is a 42 nt single-stranded DNA chain. It can be seen that the DNA molecular weight marker prepared according to the method of this example for 1 min meets the expectation.

[0056] Example 2: Preparation of a 25 nt single-stranded DNA molecular weight marker

[0057] 10 μM 50 nt PC linker-containing DNA (PC25nt) was annealed to hybridize with itself to form a hairpin structure. The annealed hairpin structure was mixed with T4 DNA ligase (the final concentration of DNA was 2 μM) and placed under a UV lamp (30 mW) for 1 min. After the reaction, the system was placed at 65°C for 10 min. After the heat inactivation of the ligase, the above system was reacted under a UV lamp (200 mW) for 10 min. The same volume of 2× denaturation loading buffer was added to the system, and the system was stored at 4°C.

[0058] As shown in the results in Figure 4 , band 1 is a DNA molecular weight marker prepared from PC25nt, and band 2 is a 42 nt single-stranded DNA chain. It can be seen that the DNA molecular weight marker prepared according to the method of this example for 1 min meets the expectation.

[0059] Example 3: Preparation of a 20 nt single-stranded DNA molecular weight marker with different ligation times

[0060] 10 μM 40 nt DNA containing PC linker (PC20nt) was annealed to form hairpin structure, and the annealed hairpin structure was mixed with T4 DNA ligase (the final concentration of DNA was 2 μM) and placed under ultraviolet light (30 mW) for different reaction times (0.5-8 min); after the reaction, the system was placed at 65 ℃ for 10 min, and after the heat inactivation of the ligase, the above system was reacted under ultraviolet light (200 mW) for 10 min, and the same volume of 2×denaturing loading buffer was added to the system, and the system was stored at 4 ℃.

[0061] The results are shown in Figure 5 As shown in the table, the assembly effects of the DNA molecular weight standards prepared using PC20nt as raw material and using DNA ligase for different times are different, and with the increase of the reaction time, the molecular weight standards with higher molecular weight (such as 220 nt, 200 nt) are also more.

[0062] Example 4: Preparation of 20 nt single-stranded DNA molecular weight standard with different ligase concentrations

[0063] 10 μM 40 nt DNA containing PC linker (PC20nt) was annealed to form hairpin structure, and the annealed hairpin structure was mixed with T4 DNA ligase (the final concentration of DNA was 2 μM) and placed under ultraviolet light (30 mW) for different reaction times (0.5-8 min); after the reaction, the system was placed at 65 ℃ for 10 min, and after the heat inactivation of the ligase, the above system was reacted under ultraviolet light (200 mW) for 10 min, and the same volume of 2×denaturing loading buffer was added to the system, and the system was stored at 4 ℃.

[0064] The results are shown in Figure 6 As shown in the table, band 1 is a commercial DNA molecular weight standard of a certain company, and bands 2-9 are the products obtained in this example, and thus it can be seen that with the increase of the concentration of single-stranded DNA, the molecular weight standards with lower molecular weight (such as 40 nt, 60 nt) are also more.

[0065] Example 5: Preparation of 20 nt single-stranded DNA molecular weight standard using different DNA ligases with different concentrations

[0066] 10 μM 40 nt DNA containing PC linker (PC20nt) was annealed to hybridize with itself to form a hairpin structure, the annealed hairpin structure was mixed with different concentrations (0.1x-2x) of DNA ligase (T3 DNA ligase, T4 DNA ligase, T7 DNA ligase) (the final concentration of DNA was 2 μM) and placed under ultraviolet light (30 mW) for 1 min; after the reaction, the system was placed at 65 ℃ for 10 min, after the heat inactivation of the ligase, the above system was reacted under ultraviolet light (200 mW) for 10 min, the same volume of 2x denaturation loading buffer was added to the system, and the system was stored at 4 ℃.

[0067] The results are shown in Figure 7 The ligation effects of different DNA ligases are equivalent, and as the concentration of the ligase increases, the molecular weight standard with higher molecular weight is more.

[0068] The above is only a preferred embodiment of the present application, and is not intended to limit the scope of the present application. The above embodiment of the present application can be variously changed. Any simple, equivalent changes and modifications made according to the content of the claims and the specification of the present application fall within the scope of protection of the present patent. The present application is not described in detail, and is of conventional technical content.

Claims

1. A method for preparing a single-stranded DNA molecular weight standard based on photocontrolled self-assembly, characterized by, The method comprises the following steps: S1: synthesizing a DNA sequence with a PC linker by chemical synthesis, the DNA sequence being equal in length and identical in sequence, the DNA sequence being capable of self-assembly to form a photosensitive hairpin DNA structure, the photosensitive hairpin DNA structure having a length of 40-120 nt and a concentration of 0.01-100 μM, the PC linker being located in the middle of the DNA sequence so that the PC linker is broken to form two equal-length single-stranded DNA sequences that are partially complementary after photolysis, the two equal-length single-stranded DNA sequences having a length of half the total length of the photosensitive hairpin DNA structure; S2: annealing the DNA sequence with the PC linker, and self-assembly of individual DNA sequences to form a photosensitive hairpin DNA structure; S3: mixing the photosensitive hairpin DNA structure obtained in step S2 with a DNA ligase, and under ultraviolet light, the PC linker is broken, the exposed single-stranded sequence is paired with the complementary region of other photosensitive hairpin DNA structures by base complementary pairing, and the DNA ligase is used to realize cascade self-assembly, the other photosensitive hairpin DNA structures being the same as the photosensitive hairpin DNA structure in step S2, and the time of ultraviolet light determines the maximum length of the DNA molecular weight standard prepared; S4: after the ultraviolet light is turned off, the reaction system is placed at 65°C for heat inactivation of the DNA ligase; S5: the reaction system after heat inactivation is subjected to ultraviolet light treatment again so that all the PC linkers are broken; S6: an electrophoresis loading buffer is added to prepare a single-stranded DNA molecular weight standard solution, and the solution is stored at 4°C.

2. The method of claim 1, wherein: In step S1, functional group modification can be performed when the DNA sequence is synthesized, and the functional group modification is selected from one or more combinations of a Cy3 fluorescent group, a Cy5 fluorescent group, an azide group, methylation modification, digoxin labeling, and methylene blue modification.

3. The production method according to claim 1, characterized by, In step S3, the two single-stranded DNAs generated after the PC linker is broken are equal in base number, and the base number determines the sequence length difference of the DNA molecular weight standard prepared therefrom.

4. The production method according to claim 1, characterized by, In step S3, each self-assembly connection increases the DNA chain by a fixed number of bases to form a single-stranded DNA molecular weight standard with a fixed gradient, and the fixed gradient is selected from 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, and 40 nt.

5. The production method according to claim 1, characterized by, In step S3, the ultraviolet wavelength ranges from 315 nm to 405 nm, the light intensity is 0.1-1000 mW / cm², and the irradiation time is 0.1-60 min.

6. The method of claim 1, wherein, In step S4, three steps of heating at 65°C for 10 minutes, ice bath quenching, and EDTA chelation are sequentially performed to ensure complete elimination of enzyme activity.

Citation Information

Patent Citations

  • Preparation method of DNA molecular weight standard based on self-assembly

    CN120608126A