Method for synthesizing and assembling large-fragment DNA
By splitting small DNA fragments in overlapping regions and using rolling circle amplification and enzymatic circularization with Phi29 DNA polymerase, the problems of low efficiency, high cost, and poor accuracy in the synthesis of large DNA fragments in existing technologies have been solved, achieving efficient and low-cost DNA assembly.
Patent Information
- Application Number
- CN202511172386.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-21
- Publication Date
- 2025-12-12
AI Technical Summary
Existing technologies are insufficient for efficiently and cost-effectively synthesizing large DNA fragments, and the assembly process is complex, time-consuming, and has a low success rate, which cannot meet the development needs of the biotechnology field.
The target large DNA fragment was split into smaller fragments, overlapping regions were designed for in vitro recombination, two rounds of rolling circle amplification were performed using Phi29 DNA polymerase, combined with enzyme digestion and ligation circularization, and finally the target DNA was obtained by transformation and screening in competent cells.
It significantly improves the assembly efficiency and sequence accuracy of large DNA fragments, reduces costs, and enables efficient and low-cost DNA synthesis.
Smart Images
Figure CN121109376A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biotechnology, and particularly to a method for synthesizing and assembling large-fragment DNA. BACKGROUND
[0002] In the modern biotechnology development, the demand for large-fragment DNA (usually refers to DNA molecules with a length of more than 10 kb) is showing explosive growth in the fields of synthetic biology, gene therapy, biopharmaceuticals, vaccine development, and metabolic engineering. As the core material for gene editing, artificial genome construction, and complex biological pathway reconstruction, the level of large-fragment DNA synthesis technology directly determines the upper limit of the development of these fields.
[0003] For example, in the field of synthetic biology, constructing artificial genomes containing complete metabolic pathways (such as yeast artificial chromosomes or microbial artificial genomes) requires efficient synthesis of large-fragment DNA with tens to hundreds of kb. In the field of gene therapy, the full sequence of the plasmid vector commonly used in the gene delivery system based on adeno-associated virus (AAV) is usually more than 10 kb, and the sequence accuracy requirement is extremely high. In the field of vaccine development, rapid synthesis of viral whole genomes (such as the coronavirus genome of about 30 kb) is a key prerequisite for rapid iteration of vaccines.
[0004] However, the existing large-fragment DNA synthesis technology still has many bottlenecks that are difficult to break through, which seriously restricts the development of the above-mentioned fields. As the length of the DNA fragment increases, the assembly efficiency will decrease significantly; at the same time, the cost of assembling long fragments is too high with the existing technology; in addition, the operation process of synthesis and assembly is complex, long in cycle and low in success rate.
[0005] In summary, the current technology cannot meet the demand for large-scale, low-cost, and high-precision synthesis of large-fragment DNA, which limits the further development of related fields. Therefore, developing a low-cost, high-efficiency, and high-fidelity large-fragment DNA synthesis technology has become a key problem to be solved in the field of biotechnology. SUMMARY
[0006] The purpose of the present application is to provide a method for synthesizing and assembling large-fragment DNA to solve the above-mentioned deficiencies in the prior art.
[0007] In order to achieve the above-mentioned purpose, the present application provides the following technical scheme: a method for synthesizing and assembling large-fragment DNA, comprising the following steps:
[0008] S01, sequence splitting: splitting the target large-fragment DNA into N small-fragment DNAs with a length of 3000-5000 bp, designing a 25-40 bp overlapping region between adjacent fragments, and introducing a 30 bp complementary sequence homologous to a linearized vector at the head and tail fragments, respectively;
[0009] S02, in vitro recombination: the small fragment DNA is mixed with linearized vector at a molar ratio of 1:1 (inter-fragment) and 3:1 (single fragment: vector), and recombination enzyme is added for Gibson homologous recombination;
[0010] S03, first round of rolling circle amplification: the recombination product of step S02 is used as a template, primer Primer-F is added for denaturation and annealing, the temperature is 95°C, the time is 3 minutes, after which ice bath is performed for 5 minutes, then Phi29 DNA polymerase is added, and amplification is performed at 30°C for 5-6 hours;
[0011] S04, second round of rolling circle amplification: the amplification product of step S03 is used as a template, primer Primer-R is added for denaturation and annealing, the temperature is 95°C, the time is 3 minutes, after which ice bath is performed for 5 minutes, then Phi29 DNA polymerase is added, and amplification is performed at 30°C for 5-6 hours;
[0012] S05, enzyme digestion and circularization: the amplification product of step S04 is purified, and after restriction enzyme digestion, T4 DNA ligase is used for circularization;
[0013] S06, transformation and screening: the circularization product is transformed into competent cells, and plasmids containing the target large fragment DNA are obtained by screening.
[0014] As preferred, the length of the target large fragment DNA is 10-30 kb, and the number N of small fragment DNA is 4-7.
[0015] As preferred, the linearized vector is prepared by enzyme digestion or PCR, and the recombination reaction conditions are 50°C, 1h, and 85°C, 5min inactivation.
[0016] As preferred, the Phi29 DNA polymerase amplification system in steps S03 and S04 includes:
[0017] 10X Phi29 reaction buffer;
[0018] dNTP at a final concentration of 1mM;
[0019] primer at a final concentration of 10-25μM.
[0020] As preferred, the restriction enzyme in step S05 is selected from NotI, MluI, AscI, or a single enzyme digestion enzyme, and the enzyme digestion site is located at both ends of the target large fragment DNA.
[0021] As preferred, the amplification primers Primer-F / Primer-R in steps S03 and S04 are specific primers targeting the vector backbone, with a length of 20-30nt.
[0022] As preferred, the recombinase in the step S02 is a seamless cloning reagent, the total volume of the reaction is ≤15 μl, and the amount of the vector is 60-200 ng.
[0023] As preferred, after the purification of the enzyme digestion product in the step S05, the T4 ligation reaction conditions are a temperature of 16℃ and a duration of 1 h.
[0024] As preferred, the competent cell in the step S06 is DH5α E. coli, and the screening method is colony PCR and sequencing verification.
[0025] As preferred, the method is suitable for synthesizing large fragment DNA of an adeno-associated virus vector, an artificial chromosome or a viral genome.
[0026] As preferred, after two rounds of rolling circle amplification on the basis of conventional in vitro homologous groups, the enzyme digestion and ligation are performed.
[0027] In the above technical solution, the method for synthesizing and assembling large fragment DNA provided by the application has the following beneficial effects: through two rounds of phi29 polymerase-mediated amplification, large fragment plasmids are effectively enriched, and the proportion of large fragment plasmids in samples is significantly improved. This enrichment process directly enhances the subsequent transformation efficiency of large fragment plasmids. The advantage of phi29 polymerase lies in its strong strand displacement activity, which can effectively unravel and replicate DNA templates with complex secondary structures, so it also shows high activity to “difficult templates” that are usually difficult to amplify. In addition, phi29 polymerase has high template affinity, and can realize continuous extension of up to 100 kb in a single polymerization reaction. What is particularly important is that its replication fidelity is about 1000 times higher than that of Taq enzyme. Therefore, it has the combined effects of efficient enrichment, complex structure processing capability, ultra-long extension length and high fidelity, so that the large fragment plasmid prepared by using the method has extremely high sequence accuracy. BRIEF DESCRIPTION OF DRAWINGS
[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments described in the present application, and other drawings can also be obtained by those skilled in the art based on these drawings.
[0029] Figure 1 The flow structure schematic diagram provided for the first embodiment of the present application;
[0030] Figure 2 The sequence splitting schematic diagram provided for the second embodiment of the present application;
[0031] Figure 3A purified product detection gel map provided for the second embodiment of the present application;
[0032] Figure 4 An NGS sequencing result comparison map provided for the second embodiment of the present application and the target sequence;
[0033] Figure 5 A purified product detection gel map provided for the third embodiment of the present application;
[0034] Figure 6 An NGS sequencing result comparison map provided for the third embodiment of the present application. DETAILED DESCRIPTION
[0035] In order for those skilled in the art to better understand the technical solutions of the present application, the present application will be further described in detail below in conjunction with the accompanying drawings.
[0036] The present application provides a technical solution:
[0037] Embodiment I
[0038] In conjunction with Figure 1 The present embodiment aims to provide a method for large fragment DNA synthesis assembly, comprising the following steps:
[0039] S01, sequence splitting: the target large fragment DNA (its length is 10-30 kb, and the number N of small fragment DNA is 4-7) is split into N small fragment DNAs with a length of 3000-5000 bp, a 25-40 bp overlapping region is designed between adjacent fragments, and 30 bp complementary sequences homologous to linearized vectors are introduced at the head and tail fragments;
[0040] S02, in vitro recombination: the small fragment DNAs are mixed with linearized vectors (linearized vectors are prepared by enzyme digestion or PCR, and the recombination reaction conditions are temperature at 50℃ for 1h, and then temperature at 85℃ for 5min inactivation) at a molar ratio of 1:1 (between fragments) and 3:1 (total fragments: vectors), and Gibson homologous recombination is performed by adding recombination enzyme (seamless cloning reagent, the total reaction volume is ≤15μl, and the carrier amount is 60-200ng);
[0041] S03, first round of rolling circle amplification: the recombination product of step S02 is used as a template, primer Primer-F is added for denaturation and annealing, the temperature is 95℃, the time is 3 minutes, after the time, ice bath for 5 minutes, then Phi29 DNA polymerase is added, and the amplification is carried out at 30℃ for 5-6 hours;
[0042] S04, second round of rolling circle amplification: using the amplification product of step S03 as template, primer Primer-R is added for denaturation and annealing, the temperature is 95℃, the time is 3 minutes, after which ice bath is performed for 5 minutes, then Phi29 DNA polymerase is added, and amplification is performed at 30℃ for 5-6 hours;
[0043] S05, enzyme digestion and circularization: the amplification product of step S04 is purified, and after digestion by a restriction enzyme (selected from NotI, MluI or AscI, the enzyme digestion site is located at both ends of the target large fragment DNA), T4 DNA ligase is used for circularization;
[0044] S06, transformation and screening: the circularization product is transformed into a competent cell, and a plasmid containing the target large fragment DNA is obtained by screening.
[0045] It should be noted that the Phi29 DNA polymerase amplification system in steps S03 and S04 described above includes:
[0046] 10X Phi29 reaction buffer;
[0047] dNTP at a final concentration of 1 mM;
[0048] primer at a final concentration of 10-25 μM.
[0049] Further, the amplification primers Primer-F / Primer-R in steps S03 and S04 in the above embodiment are specific primers targeting the vector backbone, with a length of 20-30 nt.
[0050] Furthermore, after purification of the enzyme digestion product in step S05, the T4 ligation reaction conditions are a temperature of 16℃ and a duration of 1 h.
[0051] Secondly, in step S06, the competent cell is DH5α E. coli, and the screening method is colony PCR and sequencing verification.
[0052] The method provided in this embodiment is suitable for synthesizing large fragment DNA of adeno-associated virus vectors, artificial chromosomes or viral genomes.
[0053] Example Two
[0054] Based on the above embodiment one, this embodiment aims to provide a method for solving large fragment DNA synthesis and assembly, as shown in Figures 2-4 which includes the following steps:
[0055] S01, sequence splitting: the goal is to synthesize a large piece of DNA with a length of 21 kb into a Bac vector. It is split into 7 small pieces of DNA sequence with a length of about 3000 bp, named A, B, C, D, E, F, G, and each small piece is designed to have an overlapping region of 25-30 nt, and a 30 bp sequence homologous to the subsequent linear vector is introduced at the end of the A fragment and a 30 bp sequence homologous to the subsequent linear vector is introduced at the end of the G fragment (see Figure 2 ). The A, B, C, D, E, F, G fragments are synthesized by Jiudian Gene Technology (Tianjin) Co., Ltd. and cloned into the pUC57-Kan vector, and NotI is left at both ends of the fragment for enzyme digestion to recover the synthesized small fragments.
[0056] The A-G small fragment plasmid is extracted and digested with NotI. The enzyme digestion system is 34 ul of small fragment plasmid (concentration 200-300 ng / ul), 2 ul of NotI endonuclease (Thermo Fisher FD0593), 4 ul of enzyme digestion buffer, and incubated at 37°C for 2 hours. The gel is run according to the Genomed recovery kit (DP204) and the target fragment is recovered. BAC is the target vector of this embodiment, and the cloning site is NotI-BamHI. The vector BAC is digested with NotI and BamHI according to the same operation as described above, and the linearized vector is recovered.
[0057] S02, in vitro recombination: 2 ul (about 200 ng) of each of the collected fragments A-G are mixed with 80 ng (about 2 ul) of linearized vector (length ~ 8000 bp), then 16 ul of recombination enzyme (Jiudian Gene Efficlone Seamless Cloning Kit JT-201) is added, mixed well, incubated at 50°C for 45 minutes, and incubated at 85°C for 5 minutes.
[0058] S03, first round of rolling circle amplification: primer F1: tgcgattaccagcaggcctgttatt is used for the first round of amplification. 5 ul of the recombination product from the previous step is taken as a template, and 1 ul of 10X Phi29 reaction buffer, 2.5 ul of F1 primer (100 uM) is added to the system. Incubate at 95°C for 3 min, immediately cool on ice for 5 min. And 1 ul of dNTP (10 mM) and 0.5 ul of Phi29 amplification enzyme are added to the system. Shake well and centrifuge briefly to collect; incubate at 30°C for 5 hours.
[0059] S04, second round of rolling circle amplification: using R1 primer (cgaggaacaatgataaacctgatatacatataatg) for the second round of amplification, 5ul of the first round of amplification product was taken as a template, and 2ul of 10X Phi29 reaction buffer, 5ul of R1 primer (100uM) were added to the system. Incubate at 95℃ for 3min, immediately cool on ice for 5min. 2ul of dNTP (10mM) and 1ul of Phi29 amplification enzyme were added to the system. Shake well and centrifuge briefly to collect. Incubate at 30℃ for 6 hours (in order to ensure the experimental effect, the present application amplifies 2 copies).
[0060] The product after the second round of amplification was purified according to the DNA purification kit, and finally eluted with 30ul of water. The recovered product was tested by dispensing, and the gel map was as follows Figure 3 .
[0061] S05, enzyme digestion and circularization: the purified product was subjected to enzyme digestion according to the following system: restriction endonuclease MluI 2ul; 10X endonuclease buffer 4ul; purified product 30ul; make up water 4ul. 37℃, enzyme digestion for 30min, then purified using the DNA purification kit, finally eluted with 30ul of water. Take 8ul of the purified enzyme digestion product; add T4 enzyme 1ul; T4 buffer 1ul; 16℃ reaction, 1 hour, circularization. The circularized product was transformed into DH5a competent cells, plated and incubated overnight. The next day, the clones were picked and subjected to colony PCR verification using specific bacterial detection primers. Three bacterial detection verification correct bacteria were picked and plasmid was extracted, and NGS sequencing was performed.
[0062] S06, transformation and screening: using Snap to compare the assembled NGS sequencing results with the map (see Figure 4 ), the sequencing results are correct. The product after the third step of multi-fragment recombination was taken out 10ul and directly transformed into DH5a E. coli for control experiment, the next day the clones were picked and subjected to colony PCR verification using specific bacterial detection primers, and no correct clones were detected. The experimental results show that a 21kb target large fragment DNA is successfully assembled, and has high assurance.
[0063] Example Three
[0064] Based on the above example two, this example aims to provide a method for solving large fragment DNA synthesis and assembly, as shown in Figures 5-6 , which comprises the following steps:
[0065] A 24kb long large fragment DNA was synthesized into a Bac vector.
[0066] S01, sequence splitting: the 24 kb large fragment is split into 5 small fragments (A2, B2, C2, D2, E2) of about 5K. The small fragments are synthesized by the same method as in Example 2.
[0067] Linearized vector and fragments are prepared by the same method as in Example 2.
[0068] S02, in vitro recombination: 2.5ul (about 200ng) of each of the collected fragments A2-E2, and 80ng (about 2ul) of linearized vector (length ~8000bp) are mixed evenly, then 15ul of recombination enzyme (Jitian Gene Efficlone Seamless Cloning Kit JT-201) is added, mixed evenly by blowing and sucking, incubated at 50℃ for 45 minutes, and incubated at 85℃ for 5 minutes.
[0069] Rolling circle amplification: 2 rounds of rolling circle amplification and purification are performed by the same method as in Example 2. The primers are F2: tgcgattaccagcaggcctgttatt; and R2: gtgaatgacacaagaagcgttagtg. The gel map of the purified product is shown in Figure 5 .
[0070] Enzymatic cleavage and circularization: the same as in Example 2, using ASCI for enzymatic cleavage, and T4 ligation for circularization. The circularized product is transformed into E. coli DH5a, plated and incubated overnight. The next day, 3 colonies are picked for colony PCR verification using specific primers. The plasmids of the 3 colonies verified to be correct are extracted, and NGS sequencing is performed. The assembled NGS sequencing results are aligned with the map using Snap, and the sequencing results are correct (the alignment results are shown in Figure 6 , and it is particularly pointed out that the NGS sequencing results are not completely spliced at the beginning of the target sequence, which is verified by sanger sequencing). At the same time, a control experiment is also performed, in which the recombined product is directly transformed, and no correct assembly is detected. From the above examples, it can be seen that the large fragment DNA synthesis method of the present application has the advantages of high efficiency, low cost and high fidelity, and can effectively meet the needs of the biotechnology field for large fragment DNA synthesis.
[0071] The above only describes certain exemplary embodiments of the present application by way of illustration, and it is needless to say that those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present application. Therefore, the above figures and description are illustrative in nature and should not be understood as limiting the scope of protection of the claims of the present application.
Claims
1. A method for synthesizing and assembling large DNA fragments, characterized in that, Includes the following steps: S01, Sequence splitting: The target large DNA fragment is split into N small DNA fragments with a length of 3000–5000 bp. A 25–40 bp overlap region is designed between adjacent fragments. The first and last fragments are respectively introduced with a 30 bp complementary sequence homologous to the linearized vector. S02, In vitro recombination: The small DNA fragment is mixed with the linearized vector at a molar ratio of 1:1 (between fragments) and 3:1 (single fragment: vector), and recombinase is added to perform Gibson homologous recombination; S03, First round of rolling circle amplification: Using the recombinant product from step S02 as a template, primer Primer-F is added for denaturation and annealing at 95°C for 3 minutes, followed by an ice bath for 5 minutes. Then, Phi29 DNA polymerase is added and amplified at 30°C for 5–6 hours. S04, Second round of rolling circle amplification: Using the amplification product of step S03 as a template, add primer Primer-R for denaturation and annealing at 95°C for 3 minutes, followed by an ice bath for 5 minutes, then add Phi29 DNA polymerase and amplify at 30°C for 5–6 hours. S05, Enzyme digestion and circularization: Purify the amplification product from step S04, digest it with a restriction endonuclease, and then circularize it with T4 DNA ligase; S06. Transformation and screening: Transform the circularized product into competent cells and screen to obtain plasmids containing the target large DNA fragment.
2. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The target large DNA fragment is 10–30 kb in length, and the number of small DNA fragments N is 4–7.
3. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The linearized vector was prepared by enzyme digestion or PCR, and the recombination reaction conditions were 50℃ for 1 h and 85℃ for 5 min for inactivation.
4. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The amplification system of Phi29 DNA polymerase in steps S03 and S04 includes: 10XPhi29 reaction buffer; dNTPs at a final concentration of 1 mM; Primers with a final concentration of 10–25 μM.
5. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, In step S05, the restriction endonuclease is selected from NotI, MluI, AscI, or a single restriction enzyme, and the restriction sites are located at both ends of the target large DNA fragment.
6. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The amplification primers Primer-F / Primer-R used in steps S03 and S04 are specific primers targeting the vector backbone, with a length of 20–30 nt.
7. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The recombinase mentioned in step S02 is a seamless cloning reagent with a total reaction volume ≤15μl and a carrier amount of 60–200ng.
8. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, After purification of the enzyme digestion product in step S05, the T4 ligation reaction conditions are 16℃ for 1 hour.
9. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The competent cells in step S06 are DH5α Escherichia coli, and the screening method is colony PCR and sequencing verification.
10. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, The method is applicable to the synthesis of large fragments of DNA from adeno-associated virus vectors, artificial chromosomes, or viral genomes.
11. The method for synthesizing and assembling large DNA fragments according to claim 1, characterized in that, Based on conventional in vitro homologous groups, after two rounds of rolling circle amplification, the cells were then cleaved and ligated into circular groups.