Application of TRIM38 gene / protein as target spot in screening medicine for preventing or treating Seneca virus

Abstract

The invention relates to the technical field of biology, in particular to application of TRIM38 gene / protein as a target spot to screening of drugs for preventing or treating Seneca virus and application of an expression activator or an activity enhancer of the TRIM38 gene / protein to preparation of drugs for preventing or treating Seneca virus infection. The invention proves that TRIM38 can play an anti-SVV role by inhibiting SVV virus titer and structural protein expression for the first time, and provides a new target and strategy for prevention and treatment of SVV infection.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the use of TRIM38 gene / protein as a target in screening drugs for preventing or treating Senecavirus. BACKGROUND

[0002] Senecavirus (SVV) is the only member of Senecavirus genus in the family Picornaviridae, and the Senecavirus disease caused by SVV is a newly emerging porcine infectious disease worldwide. The clinical symptoms of the disease are similar to those of foot-and-mouth disease virus (FMDV) infection, and the skin and mucosa of the mouth, nose and hoof of sick pigs appear blister-like lesions.

[0003] Due to the strong variability of the RNA virus genome, the virulence and transmission speed of SVV are constantly evolving, further increasing the difficulty of disease prevention and control. However, there is currently no commercial vaccine or specific treatment drug for SVV infection, and existing prevention and control measures mainly rely on biological safety measures, which are difficult to effectively curb the spread of the virus.

[0004] TRIM (Tripartite Motif) family proteins are key regulators of host innate immunity, which mediate ubiquitination of target proteins through E3 ubiquitin ligase activity, and are involved in processes such as viral invasion, replication and immune signal activation. TRIM38, as a member of the family, contains a conserved RING domain, B-box domain and Coiled-coil domain, and has been shown to inhibit herpes virus and coronavirus replication by regulating the NF-κB signaling pathway, but the expression dynamics, functional localization and mechanism of action of TRIM38 in SVV infection have not been reported. SUMMARY

[0005] To solve the problem that Senecavirus causes serious economic losses to the pig industry, there is currently no commercial vaccine and specific treatment drug, and existing prevention and control measures mainly rely on biological safety measures, which are difficult to effectively curb the spread of the virus, the present application provides the use of TRIM38 gene / protein as a target in screening drugs for preventing or treating Senecavirus, which solves the above problems.

[0006] The technical solution of the present application is as follows: The present application provides the use of TRIM38 gene or protein as a target in screening drugs for preventing or treating Senecavirus infection.

[0007] The present application provides the use of an expression activator or activity enhancer of TRIM38 gene or protein in the preparation of a drug for preventing or treating Senecavirus infection.

[0008] Preferably, the expression activator or activity enhancer of the TRIM38 gene or protein is at least one of a nucleic acid molecule, a small molecule compound, a polypeptide, a protein, or an antibody.

[0009] Preferably, the nucleic acid molecule is a TRIM38 overexpression plasmid or a viral vector containing a TRIM38 gene.

[0010] Preferably, the TRIM38 overexpression plasmid is a HA-tagged TRIM38 overexpression plasmid, and the nucleotide sequence thereof corresponds to the complete coding region of the TRIM38 gene (GenBank Accession No: XM_040756199.1).

[0011] The present application also provides a pharmaceutical composition for preventing or treating Senecavirus infection, characterized in that it comprises a therapeutically effective amount of an expression activator or activity enhancer of a TRIM38 gene or protein, and a pharmaceutically acceptable carrier.

[0012] Preferably, the pharmaceutical composition is configured to be capable of at least one of the following functions: (a) in cells infected with SVV, the viral titer is reduced by at least one order of magnitude at 6 hours post-infection; (b) in cells infected with SVV, the expression of SVV VP3 protein is inhibited, and the inhibitory effect is time-dependent; (c) in cells administered with the composition, the mRNA level of TRIM38 is up-regulated by at least 70%, or the protein level of TRIM38 is up-regulated by at least 60%; (d) in porcine-derived cells, the anti-SVV activity is maintained.

[0013] The present application also provides an siRNA for silencing the TRIM38 gene, characterized in that its sequence is selected from any one of the following pairs: sequence pair TRIM38-Sus-1 against porcine TRIM38: the sense strand is 5'-GAAUGUAUGAAGCUGAAGA-3' (SEQ ID NO: 1), and the antisense strand is 5'-UCUUCAGCUUCAUACAUUC-3' (SEQ ID NO: 2); or sequence pair TRIM38-Sus-2 against porcine TRIM38: the sense strand is 5'-GCCUGCACCUCAUGUCUAA-3' (SEQ ID NO: 3), and the antisense strand is 5'-UUAGACAUGAGGUGCAGGC-3' (SEQ ID NO: 4).

[0014] The application also provides an siRNA for silencing the TRIM38 gene, characterized in that the sequence is selected from any one of the following pairs: the sequence pair Trim38-Mesocricetus auratus-1 for hamster TRIM38: the positive strand is 5'-CCUCUGCUGACGCUAUAAU-3' (SEQ ID NO: 5), and the negative strand is 5'-AUUAUAGCGUCAGCAGAGG-3' (SEQ ID NO: 6); or the sequence pair Trim38-Mesocricetus auratus-2 for hamster TRIM38: the positive strand is 5'-CCAGGUUUAUGGAAAUUCU-3' (SEQ ID NO: 7), and the negative strand is 5'-AGAAUUUCCAUAAACCUGG-3' (SEQ ID NO: 8).

[0015] The application has the following beneficial effects: The application verifies that TRIM38 can play an anti-SVV role by inhibiting SVV viral titer and structural protein expression through a triple experimental design of "silencing-overexpression-transcell line verification" in hamster (BHK21) and pig (PK-15) cell lines, which is the first time to prove that TRIM38 is a key host factor for regulating SVV replication, fills the research gap of TRIM family proteins in the field of SVV prevention and control, and provides a new specific target for anti-SVV drug research and development.

[0016] The TRIM38 target provided by the application is innovative, which is the first time to prove that TRIM38 is a key host factor for regulating SVV replication, fills the research gap of TRIM family proteins in the field of SVV prevention and control, and provides a new specific target for anti-SVV drug research and development; the experimental results of the application are highly reliable, which verifies the anti-SVV function of TRIM38 in hamster (BHK21) and pig (PK-15) cell lines, and excludes species-specific interference, laying a foundation for in vivo experiments and clinical applications of pigs; the use of TRIM as a target site provided by the application has a clear mechanism of action, which proves that TRIM38 plays a role by inhibiting the time-dependent expression of SVV viral titer and VP3 protein, providing experimental basis for optimizing the action time of drugs; and the technology has high operability, the siRNA silencing efficiency provided is clear (≥60%), the overexpression plasmid construction method is mature, the drug composition adopts a freeze-dried powder injection dosage form, has good stability, is convenient to administer, and is suitable for large-scale production; the use application scenario is diversified, which can be used for developing anti-SVV therapeutic drugs, constructing SVV infection models (for drug screening), and also can cultivate SVV-resistant pig breeds through gene editing technology, realizing multi-scene coverage of "treatment-screening-breeding". BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1: Effect of TRIM38 silencing on SVV replication: A: WB detection of TRIM38 protein silencing efficiency; B: qRT-PCR detection of TRIM38 mRNA silencing efficiency; C: TCID50 results of SVV at different time points after silencing TRIM38; D: WB results and gray scale analysis of VP3 protein at 16h, 24h after silencing TRIM38 (*P<0.05, **P<0.01, compared with the control group).

[0018] Figure 2: Effect of TRIM38 overexpression on SVV replication: A: TCID50 results of SVV at different time points after overexpression of HA-TRIM38; B: WB results of VP3 protein after overexpression of HA-TRIM38; C: fluorescence microscope images after rSVV-GFP infection; D: quantitative analysis of rSVV-GFP fluorescence intensity (**P<0.01, compared with the empty vector group). Figure 3: Verification of TRIM38 anti-SVV function in PK-15 cells: A: WB detection of TRIM38 protein silencing efficiency in PK-15 cells; B: qRT-PCR detection of TRIM38 mRNA silencing efficiency in PK-15 cells; C: TCID50 results of SVV at 6h, 12h after silencing TRIM38; D: WB results of VP3 protein at 16h, 24h after silencing TRIM38; E: WB results of VP3 protein after overexpression of HA-TRIM38; F: TCID50 results of SVV at 6h, 12h after overexpression of HA-TRIM38 (**P<0.01, compared with the HA-empty vector group or the DMSO group). DETAILED DESCRIPTION

[0019] The technical solutions of the present application will be described in detail below in conjunction with the examples. It should be understood that the following examples are only used to explain and illustrate the present application, and are not used to limit the scope of the present application.

[0020] In the following examples, the reagents not specifically explained are all conventional reagents in the art, which can be commercially available or prepared according to conventional methods in the art, and the specifications are laboratory pure grade; the vectors, cells and experimental animals not specifically explained are commercially available; the experimental methods and conditions not specifically explained are conventional experimental methods and conditions in the art, which can be referred to relevant experimental manuals, known literature or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present application belongs.

[0021] The cells used in the following examples, BHK-21 cells (hamster kidney cells) and PK-15 cells (pig kidney cells), were provided and preserved by the Animal Biological Agents Research Laboratory of the Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agricultural and Forestry Sciences. They were cultured in DMEM medium containing 10% fetal bovine serum (FBS), 100 U / mL penicillin and 100 μg / mL streptomycin, and incubated at 37°C in a 5% CO2 incubator.

[0022] Virus: The standard SVV strain (SVV CHhb17 strain) was provided by the laboratory of the High Technology Research Laboratory of Livestock and Poultry Biological Agents, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agricultural and Forestry Sciences; siRNA: Synthesized by Suzhou Gemma Gene Co., Ltd., with a purity ≥98%. NC siRNA is from Suzhou Gemma Gene Co., Ltd.

[0023] Reagents: CCK-8 kit, DAPI staining solution, Western blot reagents (VP3 antibody, β-actin antibody, HRP-labeled secondary antibody), TCID. 50 The culture medium used for the test was DMEM medium containing 2% fetal bovine serum (FBS), 100 U / mL penicillin and 100 μg / mL streptomycin.

[0024] Example 1. The effect of knocking down TRIM38 on SVV replication (1) Experimental materials: Cells: BHK-21 cells (hamster kidney cells); Virus: SVV standard strain (SVV CHhb17 strain, GenBank accession number: MG983756.1); Antibodies: Anti-TRIM38 rabbit polyclonal antibody (Proteintech, catalog number 13405-1-AP), anti-SVV VP3 rabbit polyclonal antibody (prepared in our laboratory), anti-β-actin mouse monoclonal antibody (Sigma, catalog number A5441). Reagents: siRNAs (Trim38-Mesocricetus auratus-1, Trim38-Mesocricetusauratus-2, negative control NC siRNA), Lipofectamine 2000 (Invitrogen) RIPA lysis buffer, protease inhibitor mixture, BCA protein quantification kit, SDS-PAGE gel preparation kit, ECL chemiluminescence kit, TRIzol reagent, reverse transcription kit, qPCR kit.

[0025] Trim38-Mesocricetus auratus-1: The justice chain is 5'-CCUCUGCUGACGCUAUAAU-3' (SEQ ID NO: 5), and the antisense chain is 5'-AUUAUAGCGUCAGCAGAGG-3' (SEQ ID NO: 6); Trim38-Mesocricetus auratus-2: The justice chain is 5'-CCAGGUUUAUGGAAAUUCU-3' (SEQ ID NO:7), and the antisense chain is 5'-AGAAUUUCCAUAAACCUGG-3' (SEQ ID NO:8).

[0026] (2) Experimental method: Cell transfection and sample collection: BHK21 cells were transfected at 5 × 10⁻⁶ cells per cell line. 5 Cells were seeded per well in 12-well plates and transfected with siRNA (50 nM) at a density of 60%-70%. Samples were collected 36 hours later. The culture medium was discarded, and the cells were washed twice with PBS. 1 mL of PBS was added, and the cells were collected using a cell scraper into clean 1.5 mL centrifuge tubes. The tubes were centrifuged at 1500 rpm for 5 min at room temperature, and the supernatant was discarded. The cells were then placed on ice for later use. Western blotting (WB) was performed: Total protein was extracted from the collected cells using RIPA lysis buffer (containing protease inhibitors). Quantification was performed using the BCA method, followed by SDS-PAGE electrophoresis and transfer to a PVDF membrane. After blocking with 5% skim milk for 1 hour, primary antibodies (anti-TRIM38: 1:1000 dilution, anti-VP3: 1:2000 dilution, anti-β-actin: 1:5000 dilution) were added and incubated overnight at 4°C. HRP-labeled secondary antibody (1:10000 dilution) was added and incubated at room temperature for 1 hour. The cells were then visualized by ECL chemiluminescence. ImageJ software was used to perform grayscale analysis on the bands, and the relative expression level of TRIM38 was calculated with β-actin as an intrinsic parameter.

[0027] qRT-PCR detection: Total RNA was extracted from collected cells using TRIzol reagent, and cDNA was synthesized via reverse transcription. Using cDNA as a template, hamster TRIM38-specific primers were used: F (Mesocricetus auratus): 5'- AGCTTGACAATACTGTGACAAA -3' (SEQ ID NO: 9); R (Mesocricetus auratus): 5'- TCTTCTTCATTCTCCAACCTC -3' (SEQ ID NO: 10), Internal reference β-actin primers: F: 5'-TTCACACCCCAGCCATGTACG-3' (SEQ ID NO: 11); R: 5'-CAGCCAGGTCCAGACGCAGGAT-3 (SEQ ID NO: 12)' qPCR was performed to detect the relative expression level of TRIM38 mRNA.

[0028] Viral titer detection: Transfected cells were infected with SVV at MOI=1. Cell supernatant was collected at 3h, 6h, 9h and 12h post-infection, and viral titer was calculated using the TCID50 method (Reed-Muench method).

[0029] Viral protein (VP3) detection: Transfected cells were infected with SVV at MOI=1, and protein samples were collected at 16h and 24h. VP3 expression was detected by Western blot (WB) (primary antibody 1:2000 dilution).

[0030] (3) Experimental results: TRIM38 protein expression changes: After siRNA transfection into BHK-21 cells, the relative expression level of TRIM38 protein was significantly downregulated compared to the control group. Figure 1 A) TRIM38 mRNA expression changes: qRT-PCR results showed that, compared with the control group, after 36 h of siRNA transfection into BHK-21 cells, the relative transcription level of TRIM38 mRNA was significantly downregulated, with a silencing efficiency of approximately 70%. Figure 1 B).

[0031] Changes in viral titer after silencing TRIM38: Silencing TRIM38 significantly upregulated viral replication levels. Compared with the control group, the viral titer increased by 1.5 orders of magnitude (10^6) at 6 hours after SVV infection. 5.5 vs 10 4.0 TCID50 / mL Figure 1 C).

[0032] Changes in viral protein expression after TRIM38 silencing: The expression level of viral protein VP3 significantly increased after TRIM38 silencing, and the expression level of viral protein continued to increase with the duration of infection, showing a time-dependent effect. Figure 1 D).

[0033] Example 2: Effect of TRIM38 overexpression on SVV replication (1) Experimental materials: Cells: BHK-21 cells; Reagents: TRIM38 overexpression plasmid fused with HA tag (pCMV-HA-TRIM38, constructed in our laboratory based on the complete coding sequence of hamster TRIM38, GenBank accession number: XM_040756199.1), empty vector plasmid (pCMV-HA), and lipo2000 liposome transfection reagent.

[0034] (2) Experimental method: TRIM38 overexpression: BHK-21 cells were seeded in 12-well plates and cultured until the density reached 60%-70%. Then, the cells were transfected with either the HA-TRIM38 plasmid (2 μg / well) or the empty vector plasmid (2 μg / well). Subsequent experiments were performed 48 hours after transfection.

[0035] Viral titer detection: TRIM38 was overexpressed in BHK21 cells, and the replication level of SVV in BHK21 cells was detected at different time points after infection with BHK21 cells using the TCID50 method. The infection time was set to 3h, 6h, 9h, and 12h.

[0036] Viral protein expression detection: TRIM38 was overexpressed in BHK-21 cells, and Western blotting was used to detect protein changes at different time points of SVV infection. The infection time was set at 0h, 6h, and 12h. The pCMV-HA empty vector group was set as a control. VP3 was used to indicate viral proteins, and β-actin was used as an internal control.

[0037] Recombinant virus fluorescence observation: Recombinant virus with chimeric GFP gene (rSVV-GFP) was used to infect BHK-21 cells that had been silenced by siRNAs or overexpressed the TRIM38 gene. The fluorescence intensity was observed and counted by direct microscopic examination using a fluorescence microscope to assess changes in viral replication level.

[0038] (3) Experimental results: Viral titer changes: Compared with the control group, overexpression of TRIM38 significantly downregulated SVV replication levels, with viral titers decreasing by 1.5 orders of magnitude at 6 hours after infection. (10) 3.5 vs 10 5.0 TCID50 / mL Figure 2 A).

[0039] Changes in viral protein expression: Compared with the control group, VP3 protein expression was significantly reduced after overexpression of HA-TRIM38, with the most significant reduction observed at 6 hours after SVV infection, where VP3 protein expression was downregulated by approximately 80%. Figure 2 B).

[0040] Recombinant virus fluorescence analysis: In cells overexpressing TRIM38, the GFP fluorescence intensity of rSVV-eGFP was reduced by 40% compared to the control group; in cells silencing TRIM38, the GFP fluorescence intensity was increased by 15% compared to the control group. Figure 2 C, 2D).

[0041] Example 3. Verification of TRIM38 anti-SVV function using porcine cell line (PK-15) 1. Knock down TRIM38 (1) Experimental materials: Cells: PK-15 cells; Virus: SVV standard strain (SVV CHhb17 strain, GenBank accession number: MG983756.1); Antibodies: Anti-TRIM38 rabbit polyclonal antibody, anti-SVV VP3 rabbit polyclonal antibody (prepared in our laboratory), anti-β-actin mouse monoclonal antibody (Sigma, catalog number A5441); Reagents: siRNAs (Trim38-Sus-1, Trim38-Sus-2, negative control NC siRNA), Lipofectamine 2000 (Invitrogen) RIPA lysis buffer, protease inhibitor mixture, BCA protein quantification kit, SDS-PAGE gel preparation kit, ECL chemiluminescence kit, TRIzol reagent, reverse transcription kit, qPCR kit.

[0042] TRIM38-Sus-1: The positive chain is 5'-GAUGUAUGAAGCUGAAGA-3' (SEQ ID NO: 1), and the negative chain is 5'-UCUUCAGCUUCAUACAUUC-3' (SEQ ID NO: 2); TRIM38-Sus-2: The positive chain is 5'-GCCUGCACCUCAUGUCUAA-3' (SEQ ID NO: 3), and the negative chain is 5'-UUAGACAUGAGGUGCAGGC-3' (SEQ ID NO: 4).

[0043] (2) Experimental method: Cell transfection and sample collection: Same as in Example 1.

[0044] Western blot (WB) detection: Same as in Example 1.

[0045] qRT-PCR detection: Total RNA was extracted from collected cells using TRIzol reagent, and cDNA was synthesized via reverse transcription. Using cDNA as a template, porcine TRIM38-specific primers were used: Sequence: F (Sus scrofa): 5'- TCTGAGGAGACTGAGGGACA -3' (SEQ ID NO: 13); R (Sus scrofa): 5'-AACTTCACAGCCCAACTCCT-3' (SEQ ID NO: 14), Virus titer detection: Same as in Example 1.

[0046] Viral protein (VP3) detection: Same as in Example 1.

[0047] (3) Experimental results: Silencing efficiency: After silencing TRIM38, mRNA levels decreased by more than 60%, and protein levels decreased by about 80%. Figure 3 A, 3B); Viral titer changes: After silencing TRIM38, the viral titer of SVV infection at 6 and 12 hours was one order of magnitude higher than that of the control group. Figure 3 C); Viral protein changes: After silencing TRIM38, the expression level of VP3 was significantly increased 24 hours after SVV infection compared with that at 16 hours. Figure 3 D); 2. Overexpression of TRIM38 (1) Experimental materials: Cells: PK-15 cells; Virus: SVV standard strain (SVV CHhb17 strain, GenBank accession number: MG983756.1); Reagents: HA-tagged TRIM38 overexpression plasmid (pCMV-HA-TRIM38, constructed in our laboratory based on the complete coding sequence of porcine TRIM38, GenBank accession number: XM_021098422), empty vector plasmid (pCMV-HA), and lipo2000 liposome transfection reagent.

[0048] (2) Experimental method: TRIM38 overexpression: PK-15 cells were seeded in 12-well plates and cultured until the density reached 60%-70%. Then, the cells were transfected with either the HA-TRIM38 plasmid (2 μg / well) or the empty vector plasmid (2 μg / well). Subsequent experiments were performed 48 hours after transfection.

[0049] Viral titer detection: TRIM38 was overexpressed in PK-15 cells, and the replication level of SVV in PK-15 cells was detected at different time points after infection with 3h, 6h, 9h, and 12h using the TCID50 method.

[0050] Viral protein expression detection: TRIM38 was overexpressed in PK-15 cells, and Western blot was used to detect protein changes at different time points of SVV infection. The infection time was set at 0h, 6h, and 12h. The pCMV-HA empty vector group was set as a control. VP3 was used to indicate viral proteins, and β-actin was used as an internal control.

[0051] Recombinant virus fluorescence observation: Recombinant virus with chimeric GFP gene (rSVV-GFP) was used to infect PK-15 cells that had been silenced by siRNAs or overexpressed the TRIM38 gene. The fluorescence intensity was observed and counted by direct microscopic examination using a fluorescence microscope to assess changes in viral replication level.

[0052] (3) Experimental results: Changes in viral protein and titer after overexpression: After overexpression of HA-TRIM38, the expression level of VP3 in SVV-infected cells was significantly lower than that in the empty vector group at 6 and 12 hours, and the viral titer decreased by one order of magnitude. Figure 3 E, 3F).

Claims

1. The use of the TRIM38 gene or protein as a target in screening drugs for the prevention or treatment of Seneca virus infection.

2. Use of TRIM38 gene or protein expression activators or activity enhancers in the preparation of medicaments for the prevention or treatment of Seneca virus infection.

3. The use according to claim 2, characterized in that, The expression activator or activity enhancer of the TRIM38 gene or protein is at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, or antibodies.

4. The use according to claim 3, characterized in that, The nucleic acid molecule is a TRIM38 overexpression plasmid or a viral vector containing the TRIM38 gene.

5. The use according to claim 4, characterized in that, The TRIM38 overexpression plasmid is a TRIM38 overexpression plasmid fused with an HA tag, and its nucleotide sequence corresponds to the complete coding region of the TRIM38 gene. The GenBank accession number of the TRIM38 gene is XM_040756199.

1.

6. A pharmaceutical composition for the prevention or treatment of Seneca virus infection, characterized in that, It contains a therapeutically effective amount of an expression activator or activity enhancer of the TRIM38 gene or protein, and a pharmaceutically acceptable vector.

7. The pharmaceutical composition according to claim 6, characterized in that, The pharmaceutical composition is configured to achieve at least one of the following functions: (a) reducing viral titer by at least one order of magnitude in SVV-infected cells 6 hours after infection; (b) inhibiting the expression of SVV VP3 protein in SVV-infected cells in a time-dependent manner; (c) upregulating TRIM38 mRNA levels by at least 70% or TRIM38 protein levels by at least 60% in cells to which the composition is administered; and (d) maintaining anti-SVV activity in porcine cells.

8. A siRNA for silencing the TRIM38 gene, characterized in that, The sequence is selected from any of the following pairs: TRIM38-Sus-1 for porcine TRIM38: 5'-GAUGUAUGAAGCUGAAGA-3' (SEQ ID NO: 1), 5'-UCUUCAGCUUCAUACAUUC-3' (SEQ ID NO: 2); or TRIM38-Sus-2 for porcine TRIM38: 5'-GCCUGCACCUCAUGUCUAA-3' (SEQ ID NO: 3), 5'-UUAGACAUGAGGUGCAGGC-3' (SEQ ID NO: 4).

9. A siRNA for silencing the TRIM38 gene, characterized in that, The sequence is selected from any of the following pairs: For the hamster TRIM38 sequence pair Trim38-Mesocricetus auratus-1: the positive strand is 5'-CCUCUGCUGACGCUAUAAU-3' (SEQ ID NO: 5), and the antisense strand is 5'-AUUAUAGCGUCAGCAGAGG-3' (SEQ ID NO: 6); or for the hamster TRIM38 sequence pair Trim38-Mesocricetus auratus-2: the positive strand is 5'-CCAGGUUUAUGGAAAUUCU-3' (SEQ ID NO: 7), and the antisense strand is 5'-AGAAUUUCCAUAAACCUGG-3' (SEQ ID NO: 8).

Images