Use of cryzl1 gene / protein as target in screening for drug for preventing or treating seneca virus infection

Abstract

Use of a CRYZL1 gene / protein expression inhibitor or knockout agent in the preparation of a drug for preventing or treating a Seneca virus infection. The drug can inhibit the endocytosis, growth, proliferation, and invasion of the Seneca virus. A pharmaceutical combination for preventing or treating a Seneca virus infection, comprising a CRYZL1 gene / protein expression inhibitor or knockout agent. Use of the CRYZL1 gene in the preparation of a formulation for breeding a Seneca virus-resistant breed of pig or in the preparation of a formulation for improving the germplasm resource of a breed of pig with Seneca virus-related resistance.

Description

Use of CRYZL1 gene / protein as a target in screening drugs for the prevention or treatment of Seneca virus infection Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the use of the CRYZL1 gene / protein as a target in screening drugs for the prevention or treatment of Seneca virus infection. Background Technology

[0002] Seneca virus (formerly known as Seneca Valley virus) was discovered in 2002 by American researchers culturing adenovirus using embryonic retinal cells. When it was first isolated, purified, and analyzed, it was very similar to members of the cardivirus genus and was considered a recombinant virus of cardivirus. However, after in-depth research, it was found that its complete nucleotide sequence and microstructure differed, ultimately classifying it as belonging to the Picornaviridae family, Senecavirus genus. In 2015, the International Committee on Taxonomy of Viruses named it Senecavirus A (SVA). Initially, most research focused on its oncolytic properties; it wasn't until 2007 that Seneca virus was linked to porcine primary vesicular disease, attracting widespread attention in the veterinary field.

[0003] Seneca virus (SVA) infection can cause vesicular disease characterized by diarrhea, lameness, anorexia, and vesicles and erosions around the mouth and nose, and its clinical features are difficult to distinguish from those caused by foot-and-mouth disease virus (FMDV) infection. Since 2014, SVA-induced swine vesicular disease has been reported in the United States, Brazil, China, Thailand, and other countries. SVA infection was first reported in my country in 2015. Studies have shown that pigs are the main host of SVA, and SVA virus nucleic acid has also been detected in houseflies and mice. Overall, current research on SVA is insufficient; there are no effective treatments or commercially available vaccines for SVA infection, and molecular breeding also lacks original target genes.

[0004] Lens proteins were first discovered in 1894 as structural proteins of the lens. The ζ-lens (Crystallinzeta, CRYZ) is an important member of the lens protein family, first discovered in the lens of guinea pigs. Subsequent studies found that homologous genes encoding CRYZ are widely distributed in animals, plants, and microorganisms (Huang et al., 1987). In 1999, ζ-lens-like 1 (Crystallinzeta-like1, CRYZL1) was discovered on human chromosome 21q22.1. Due to its high similarity to CRYZ, it was named CRYZL1. The CRYZL1 gene is highly expressed in the lungs, brain, heart, and liver (Kimetal., 1999). There is currently very little research on CRYZL1. Lim et al. used miRNA microarray to detect the genome-wide miRNA expression profile and found that miRNAs targeting CRYZL1 are associated with Down syndrome (Limetal., 2015), but there are no reports on the relationship between CRYZL1 and the prevention and treatment of SVA. Summary of the Invention

[0005] In view of the above-mentioned shortcomings in the prior art, the present invention provides the use of CRYZL1 gene / protein as a target in screening drugs for the prevention or treatment of SVA infection. By silencing or knocking out the CRYZL1 gene, SVA infection can be effectively inhibited.

[0006] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is as follows:

[0007] The use of the CRYZL1 gene / protein as a target in screening drugs for the prevention or treatment of SVA infection, wherein the CRYZL1 gene ID is ENSSSCG00000028377.

[0008] Use of CRYZL1 gene / protein expression inhibitors or knockout agents in the preparation of drugs for the prevention or treatment of SVA infection.

[0009] Furthermore, drugs for the prevention or treatment of SVA infection have at least one of the following functions:

[0010] A1) Inhibit SVA endocytosis;

[0011] A2) Inhibits SVA growth or proliferation;

[0012] A3) Inhibit SVA invasion.

[0013] Furthermore, the CRYZL1 gene / protein expression inhibitor or knockout agent is at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0014] Furthermore, inhibiting, silencing, or knocking out the CRYZL1 gene expression can be achieved through gene mutation, gene silencing, gene knockout, gene editing, or gene knockdown techniques well known to those skilled in the art. For example, RNA interference (RNAi) technology can be used to specifically eliminate or shut down the expression of a particular gene; gene editing tools can include, but are not limited to, CRISPR / Cas9 technology, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs).

[0015] Furthermore, CRYZL1 gene / protein expression inhibitors or knockout agents include sgRNAs that target and knock out the CRYZL1 gene / protein, or siRNAs that silence and inhibit CRYZL1 gene expression.

[0016] Furthermore, sgRNA is a double-stranded fragment formed by the annealing of sgRNA-F and sgRNA-R, and its target sequence is: GAGAAGGATTTCTTTCCTGT;

[0017] The sequences of sgRNA-F and sgRNA-R are as follows:

[0018] sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3';

[0019] sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

[0020] Furthermore, the siRNA is CRYZL1-si256-F / R, CRYZL1-si415-F / R, or CRYZL1-si526-F / R.

[0021] A combination of drugs for the prevention or treatment of SVA infection, comprising the above-mentioned CRYZL1 gene / protein expression inhibitor or knockout agent; or a combination of the above-mentioned inhibitor and an endocytosis inhibitor.

[0022] Furthermore, the endocytosis inhibitors are CPZ or EIPA.

[0023] The use of the CRYZL1 gene in the preparation of formulations for breeding SVA-resistant pig breeds.

[0024] Use of the CRYZL1 gene in the preparation of formulations for the improvement of germplasm resources in SVA-related disease-resistant pig breeds.

[0025] The beneficial effects of this invention are:

[0026] This invention demonstrates that knocking out the CRYZL1 gene in cell lines significantly enhances the resistance of these cell lines to SVA infection. Attached Figure Description

[0027] Figure 1 shows the changes in CRYZL1 mRNA and SVA virus RNA copy numbers in IBRS-2 cells after CRYZL1 knockdown;

[0028] Figure 2 shows the expression of SVA viral proteins after CRYZL1 knockdown;

[0029] Figure 3 shows the structure of the three-plasmid system;

[0030] Figure 4 is a schematic diagram of the sequencing of the CRYZL1 gene-targeted cell line.

[0031] Figure 5 shows the DNA sequencing and CRYZL1 mRNA detection results of the CRYZL1 knockout cell line.

[0032] Figure 6 shows the cell morphology of CRYZL1-KO1 cells after infection with SVA virus;

[0033] Figure 7 shows the results of viral RNA copy number and viral protein detection in CRYZL1-KO1 cells after infection with SVA virus;

[0034] Figure 8 shows the effect of CRYZL1 knockout on viral adsorption and internalization;

[0035] Figure 9 shows the effect of inhibitor treatment on the SVA endocytosis pathway;

[0036] Figure 10 shows the infection status of SVA in CRYZL1-KO1 cells after inhibitor treatment;

[0037] Figure 11 shows the effect of knocking out the CRYZL1 gene on the viral endocytosis pathway mediated by macropinocytosis;

[0038] Figure 12 shows the effect of knocking out the CRYZL1 gene on the clathrin-mediated viral endocytosis pathway. Detailed Implementation

[0039] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0040] Example 1: Effect of inhibiting CRYZL1 gene expression on SVA infection

[0041] 1. Synthesis of siRNA

[0042] Interference sequences CRYZL1-si256, CRYZL1-si415, and CRYZL1-si526 were designed and synthesized based on the CRYZL1 gene with gene number ENSSCG00000028377. The specific sequences are shown in Table 1.

[0043] Table 1 siRNA sequences

[0044] 2. The effect of inhibiting CRYZL1 gene expression on SVA infection

[0045] Wild-type IBRS-2 cells were seeded in 12-well plates. When the cell density reached 60%-70%, CRYZL1-siRNA and CRYZL1-siNC were transfected. After 36 hours, cells in each group were infected with SVA (MOI=1). Total RNA was extracted 12 hours after viral infection, and the relative content of CRYZL1 mRNA and viral RNA copy number were detected by qRT-PCR. GAPDH was used as an internal control gene. The horizontal axis represents different interfering sequences, and the vertical axis represents the relative content of CRYZL1 or SVA mRNA. One-way ANOVA was used for statistical analysis, and the results are shown in Figure 1. Figure A shows the relative content of CRYZL1 mRNA after CRYZL1 knockdown; Figure B shows the results of viral RNA copy number detection after CRYZL1 knockdown. * represents p<0.05, ** represents p<0.01, and *** represents p<0.001.

[0046] As shown in Figure 1, knocking down CRYZL1 in IBRS-2 cells reduces the relative content of CRYZL1 mRNA. CRYZL1-si256, CRYZL1-si415, and CRYZL1-si526 can all achieve CRYZL1 knockdown. After knocking down CRYZL1, the viral RNA copy number is also significantly reduced.

[0047] 3. SVA VP2 protein content detection

[0048] The expression of SVA VP2 protein in the cell samples treated in step 2 was detected. The results are shown in Figure 2. After knocking down the expression level of CRYZL1 gene, the expression of SVA VP2 protein was also significantly reduced, indicating that CRYZL1 plays an important role in the process of SVA infection of IBRS-2 cells.

[0049] Example 2 Construction of CRYZL1 gene knockout cell line

[0050] 1. This invention uses the CRISPR-PB vector system (see Figure 3), which contains three plasmids: the piggyBac transposon backbone vector pSg4 containing sgRNA (containing the puro resistance gene), the plasmid pPBase transiently expressing PB transposase, and the plasmid pS10 (containing the doxorubicin-induced expression of Cas9-flag protein) containing the neo resistance gene.

[0051] 2. Based on the CRYZL1 gene with gene number ENSSSCG00000028377, sgRNA-F / R sequences were designed: sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; and sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

[0052] During synthesis, we added the corresponding sticky ends of the endonuclease Bbs I. After obtaining the sequence, we annealed the two single strands of sgRNA to form a double strand. The annealing reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0053] Then, it is ligated with the BbsI-digested vector backbone pSg4. The ligation reaction system is shown in Table 4. The digestion reaction conditions are: overnight in a metal bath at 16°C. When the ligated PCR fragment is small, the ligation time can be shortened. During the ligation reaction, the molar ratio of vector backbone DNA to insert fragment DNA is generally 1:2-10.

[0054] Finally, the ligated vector was sequenced for verification, yielding the CRISPR targeting vector for the host gene. Simultaneously, a pair of verification primers, CRYZL1-F: 5'-TTGGATCTGGTGTCACTGTGG-3' and CRYZL1-R: 5'-GAGCAAAGTGATTCAGGCTTACA-3', were designed and synthesized approximately 250 bp flanking the sgRNA sequence to verify the host gene targeting.

[0055] Table 2 sgRNA annealing reaction system

[0056] Table 3 sgRNA annealing reaction procedure

[0057] Table 4 Connection Reaction System

[0058] 3. 1.5 μg pSg4 plasmid, 1.5 μg pS10 plasmid, and 1 μg pPBase plasmid were transfected into two wild-type IBRS-2 cells using liposome transfection. Simultaneously, plasmids expressing green fluorescence were also transfected. To remove untransfected cells, 24 h after transfection, cells were treated with a medium containing 2 μg / mL puromycin and 4 μg / mL doxorubicin. Puromycin was used to select for positively transfected cells, and doxorubicin induced Cas9 protein expression, thus targeting the target gene.

[0059] Cells screened with puromycin were restored to culture, and the genome of the cells was extracted after about a week. PCR amplification and DNA sequencing were performed to determine the knockout status of the candidate genes. The results are shown in Figure 4, indicating that the CRYZL1 gene knockout system was successfully constructed.

[0060] 4. IBRS-2 monoclonal cell lines with CRYZL1 knockout were picked, revived in 10cm dishes, and then cultured in medium containing 4 μg / mL puromycin for 36 hours. The medium was then replaced with puromycin-free growth medium. After about one week of culture, distinct monoclonal cell spots appeared in the 10cm dishes. Monoclonal cells were picked using a cloning loop and sequenced for verification, yielding the IBRS-2 monoclonal cell line CRYZL1-KO1 with the CRYZL1 gene knockout. The results are shown in Figure 5. Figure A shows the CRYZL1-KO1 genome sequencing results, where the sgRNA target sequence is: GAGAAGGATTTCTTTCCTGT; the PAM sequence is: TGG. Figure B shows the expression of CRYZL1 mRNA in CRYZL1-KO1 cells.

[0061] As shown in Figure 5, this invention successfully obtained the IBRS-2 monoclonal cell line CRYZL1-KO1, which features a CRYZL1 gene knockout. Both strands of CRYZL1-KO1 are mutated; one strand has a 3-base deletion and a 1-base addition, while the other strand has a 24-base deletion. Furthermore, as shown in Figure B, the mRNA expression level of CRYZL1 is significantly reduced after gene knockout. Both strands of CRYZL1-KO2 have a 1-base addition.

[0062] Example 3: Detection of disease resistance in CRYZL1 gene knockout cell lines

[0063] 1. CRYZL1-KO1 disease resistance test

[0064] (1) Wild-type cells and CRYZL1-KO1 cells were seeded in 12-well plates. When the cell density was 80-90%, they were infected with SVA with MOI=1. After infection with the virus, the cell morphology of wild-type cells and CRYZL1-KO1 cells was observed. The results are shown in Figure 6.

[0065] As shown in Figure 6, wild-type cells showed significant CPE 24 hours after viral infection, while CRYZL1-KO1 cells did not show significant CPE.

[0066] (2) Wild-type IBRS-2 cells and CRYZL1-KO1 cells were infected with SVA, and cell samples were collected 6 h and 12 h after infection. Total RNA and total protein were extracted, and the viral RNA copy number and VP2 protein expression were detected. The results are shown in Figure 7. In Figure 7, A and B are the results of viral RNA copy number detection 6 h and 12 h after viral infection, respectively. C is the expression of VP2 protein 12 h after viral infection.

[0067] As shown in Figure 7, compared with wild-type cells, the number of viral RNA copies in CRYZL1-KO1 cells was significantly reduced at 6 h and 12 h after viral infection, and the expression of viral VP2 protein was also significantly reduced, indicating that the CRYZL1 knockout cell line can resist SVA infection.

[0068] (3) Wild-type IBRS-2 cells and CRYZL1-KO1 cells were seeded in 12-well plates. When the cell density reached 80%-90%, each group of cells was infected with SVA (MOI=10). After incubation at 4℃ for 1 h, the adsorption of the virus was detected, and after incubation at 37℃ for 30 min, the internalization of the virus was detected. The virus adsorption results are shown in Figure 8A. Compared with wild-type cells, the relative content of viral RNA adsorbed on the cell surface after CRYZL1 knockout was not significantly affected. The virus internalization results are shown in Figure 8B. The relative content of intracellular viral RNA was significantly reduced after CRYZL1 knockout.

[0069] (4) IBRS-2 cells were seeded in 12-well plates. When the cell density reached 60%-70%, CRYZL1-si526 and CRYZL1-siNC were transfected into the cells. After 36 h of transfection, the cells in each group were infected with SVA (MOI=10). After incubation at 37 °C for 30 min, the internalization of the virus was detected. The results are shown in Figure 8C. Knockdown of CRYZL1 also affected the internalization of the virus.

[0070] Example 4: Effect of CRYZL1 knockout on SVA endocytosis

[0071] 1. Determine the endocytosis pathway

[0072] IBRS-2 cells were seeded in 12-well plates. When the cell density reached 80%-90%, the cells were treated with DMSO or 50 nM MBCD (cryptin-mediated endocytosis inhibitor), CPZ (clathrin-mediated endocytosis inhibitor), or EIPA (macropinocytosis-mediated endocytosis inhibitor) for 6 h. Cells were then infected with SVA (MOI=10) and incubated at 37°C for 30 min. Cell samples were collected, total RNA was extracted, and the relative content of viral RNA was detected by qRT-PCR. GAPDH was used as an internal control gene. The horizontal axis represents different inhibitors, and the vertical axis represents the relative content of SVA mRNA. The results are shown in Figure 9.

[0073] As shown in Figure 9, compared with wild-type cells, MBCD treatment did not affect viral internalization, while CPZ and EIPA treatments significantly reduced the relative content of intracellular viral RNA, inhibiting viral internalization. This study is the first to discover that SVA infects host cells via two pathways: clathrin-mediated endocytosis and macropinocytosis-mediated endocytosis.

[0074] The effects of different inhibitors, MBCD, CPZ, and EIPA, on SVA infection were also examined. The results, as shown in Figure 10, were consistent with the results on viral internalization; MBCD treatment did not affect viral infection, while CPZ and EIPA treatments significantly reduced intracellular viral RNA copy numbers and inhibited viral infection.

[0075] 2. Effects of CRYZL1 on the macropinocytosis-mediated viral endocytosis pathway

[0076] Wild-type IBRS-2 cells and CRYZL1-KO1 cells were seeded in 24-well plates. When the cell density reached 80%-90%, each group of cells was infected with a mixture of 250 μg / mL FITC-Dextran and SVA (MOI=10). After incubation at 37℃ for 30 min, the culture medium was discarded, and the endocytosis of Dextran was observed by immunofluorescence. The results are shown in Figure 11. In the figure, DAPI staining of cell nuclei showed a blue signal, and Dextran showed a green signal. The Merge group is an overlay image of DAPI and GFP. The scale bar is 400 μm. (Since the attached images were converted to black and white, the different fluorescence colors cannot be directly shown in the figures. The fluorescence colors of different images are explained here.)

[0077] As shown in Figure 11, compared with wild-type cells, the green fluorescence signal was significantly reduced after CRYZL1 knockout, indicating that CRYZL1 affected the endocytosis of Dextran, suggesting that CRYZL1 can affect the viral endocytosis pathway mediated by macropinocytosis.

[0078] 3. Effects of CRYZL1 on the clathrin-mediated viral endocytosis pathway

[0079] Wild-type IBRS-2 cells and CRYZL1-KO1 cells were seeded in 24-well plates. When the cell density reached 80%-90%, each group of cells was infected with a mixture of 50 μg / mL Bio-Transferrin and SVA (MOI=10). After incubation at 37°C for 30 min, the culture medium was discarded. Immunofluorescence was performed using streptavidin, a fluorescently conjugated label, to observe the internalization of Transferrin. The results are shown in Figure 12. In the figure, DAPI staining of cell nuclei showed a blue signal, while Dextran showed a green signal. The Merge group is an overlay image of DAPI and GFP. The scale bar is 400 μm. (Since the attached images were converted to black and white, the different fluorescence colors cannot be visually represented in the figures. The fluorescence colors of different images are explained here.)

[0080] As shown in Figure 12, compared with wild-type cells, the green fluorescence signal was significantly reduced after CRYZL1 knockout, indicating that Transferrin endocytosis was affected, suggesting that CRYZL1 affects the clathrin-mediated viral endocytosis pathway.

[0081] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The use of CRYZL1 gene / protein as a target in screening drugs for the prevention or treatment of SVA infection.

2. Use of CRYZL1 gene / protein expression inhibitors or knockout agents in the preparation of drugs for the prevention or treatment of SVA infection.

3. The use according to claim 2, characterized in that, The drug for preventing or treating SVA infection has at least one of the following functions: A1) Inhibit SVA endocytosis; A2) Inhibits SVA growth or proliferation; A3) Inhibit SVA invasion.

4. The use according to claim 2, characterized in that, The CRYZL1 gene / protein expression inhibitor or knockout reagent is at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

5. The use according to claim 4, characterized in that, The CRYZL1 gene / protein expression inhibitors or knockout agents include sgRNAs that target and knock out the CRYZL1 gene / protein, or siRNAs that silence and inhibit CRYZL1 gene expression.

6. The use according to claim 5, characterized in that, The sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R, and its target sequence is: GAGAAGGATTTCTTTCCTGT; The sequences of sgRNA-F and sgRNA-R are as follows: sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

7. The use according to claim 5, characterized in that, The siRNA is CRYZL1-si256-F / R, CRYZL1-si415-F / R, or CRYZL1-si526-F / R.

8. A combination of drugs for the prevention or treatment of SVA infection, characterized in that, Includes any one of the CRYZL1 gene / protein expression inhibitors or knockout agents as claimed in claims 2 to 7; Or a combination of the CRYZL1 gene / protein expression inhibitor or knockout agent and the endocytosis inhibitor as described in any one of claims 2 to 7.

9. The use of the CRYZL1 gene in the preparation of formulations for breeding SVA-resistant pig breeds.

10. Use of the CRYZL1 gene in the preparation of formulations for the improvement of germplasm resources in SVA-related disease-resistant pig breeds.

Images