Recombinant porcine Seneca virus for expressing porcine circovirus 2d genotype Cap gene as well as preparation method and application of recombinant porcine Seneca virus
By constructing a recombinant porcine Seneca virus vaccine expressing the Cap gene of porcine circovirus 2d genotype in mammalian cells, the problem of low protective efficacy of existing vaccines in Escherichia coli and baculovirus systems was solved, achieving stable expression and efficient control of porcine circovirus and porcine Seneca virus.
Patent Information
- Application Number
- CN202511584341.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-31
- Publication Date
- 2026-03-03
AI Technical Summary
Existing vaccines for porcine circovirus and porcine Seneca virus based on E. coli expression systems and baculovirus expression systems do not provide high protection after immunization, and the production of mammalian cell-derived vaccines suffers from quality instability, making it difficult to effectively control porcine circovirus disease and porcine Seneca virus disease.
Recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype was constructed and produced using a mammalian cell system. The Cap gene of porcine circovirus 2d genotype was recombined into the porcine Seneca virus vector using seamless cloning technology. The recombinant virus was rescued using a CMV polymerase transcription system and an inactivated vaccine was prepared.
This technology enables stable expression of the Cap protein in mammalian cells, improving vaccine quality and immunization efficacy. It can simultaneously control porcine circovirus and porcine Seneca virus, providing a highly efficient bivalent vaccine technology solution.
Smart Images

Figure CN121592607A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of recombinant virus technology, specifically relating to a recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype, its preparation method, and its application. Background Technology
[0002] Porcine circovirus disease (PCV2) is the most common chronic wasting disease in pigs, primarily caused by porcine circovirus type 2 (PCV2). PCV2 can cause various diseases, including multifocal wasting syndrome in weaned piglets, swine dermatitis and nephropathy syndrome, swine respiratory disease, and reproductive disorders in sows. PCV2 infection mainly causes respiratory dysfunction in piglets and nurseries, and can also cause immunosuppression in infected pigs, often leading to secondary infections with other pathogens, significantly increasing mortality rates and making it one of the most important diseases threatening modern pig farming. PCV2 has multiple genotypes, including 2a, 2b, 2c, 2d, 2e, and 2f. Our laboratory and other domestic swine disease research groups have isolated and identified multiple circulating PCV2 strains, confirming that PCV2d is currently the dominant strain circulating in domestic pig herds. Control of PCV2 mainly relies on vaccination. The PCV2 vaccines used domestically and internationally are mainly whole-virus inactivated vaccines and genetically engineered subunit vaccines. PCV2 viral particles consist of only one structural protein, Cap. Cap protein-based genetically engineered subunit vaccines offer advantages such as good safety and simple, low-cost preparation processes. The production of PCV2 subunit vaccines using E. coli expression systems and baculovirus expression systems has been extensively studied and developed. In recent years, with the rapid development of cell biology and vaccinology technologies, it has become increasingly clear that viral subunit vaccine antigen proteins produced from non-mammalian cells differ from natural viral particles in terms of post-translational modifications and virus-like particle self-assembly. This difference is considered a significant factor limiting the quality of current PCV2 subunit vaccines. Therefore, constructing safe and efficient mammalian cell-derived PCV2 subunit vaccines is a key research direction for improving the quality of current PCV2 vaccines.
[0003] Senecavirus disease in pigs is a newly emerging vesicular infectious disease caused by Senecavirus A (SVA) infection. The main clinical manifestations are idiopathic vesicular disease and death of newborn piglets.
[0004] SVA exhibits pantropy, capable of infecting various passaged cell lines in vitro, including BHK-21 cells, Vero cells, PK-15 cells, ST cells, and 293T cells, and causing significant cytopathic effects in infected cells. In recent years, with the development and promotion of suspension culture technology for animal vaccine antigen production cell lines, suspension culture technology for multiple SVA-sensitive cell lines, such as BHK-21 cells, Vero cells, and PK-15 cells, has been successfully applied, greatly advancing the research and development of SVA inactivated vaccines. PCV2 infection of PK-15 cells does not induce significant cytopathic effects. The production of whole-virus inactivated vaccines often encounters the problem of unstable virus harvesting time, leading to inconsistent quality of different batches of PCV2 antigen. The production of subunit vaccine antigens largely relies on E. coli expression systems and baculovirus expression systems. Cap proteins produced by non-mammalian cells differ from natural virus particles in terms of post-translational modifications and virus-like particle self-assembly, often resulting in low post-immunization protective efficacy.
[0005] Regarding the serious and difficult-to-control problems of porcine circovirus disease and porcine Seneca virus disease, research on mammalian cell-derived PCV2 subunit vaccines and SVA vaccines has lagged behind both domestically and internationally. Currently, there are no related PCV2-SVA vaccines on the market, and most mammalian cell-derived PCV2 subunit vaccines and SVA vaccine biopharmaceuticals are still in the early stages of research and development, with a long time lag before clinical application. This cannot effectively solve the current problem of "one injection for two preventions" for these two diseases. Summary of the Invention
[0006] To address the shortcomings and problems of low post-immunization protection efficacy of current subunit vaccines based on E. coli expression systems and baculovirus expression systems, this invention provides a recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype, its preparation method, and its applications.
[0007] This invention provides a recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype, the full genome sequence of which is shown in SEQ ID NO:1.
[0008] The aforementioned recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype is obtained by constructing an infectious cloning vector with the full-length genome of porcine Seneca virus as a vector. The Cap gene of porcine circovirus 2d genotype is recombined into the infectious cloning vector using seamless cloning technology to obtain a ligation product. The ligation product is transformed into competent cells, and after culture and verification, a recombinant plasmid is obtained, which is then rescued using the CMV polymerase transcription system.
[0009] The recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype had a viral titer of 10. 7.25 TCID 50 / 0.1mL.
[0010] The recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype mentioned above was porcine Seneca virus HeN-1 / 2018.
[0011] The recombinant porcine Seneca virus of the porcine circovirus 2d genotype Cap gene described above was recombined into the infectious cloning vector using seamless cloning technology to obtain the ligation product. Specifically, the porcine circovirus 2d genotype Cap gene with the nuclear localization signal removed was first combined with the porcine cyclosporine virus 2A gene to synthesize the PCV2d Cap-P2A gene. Then, the PCV2d Cap-P2A gene was recombined into the infectious cloning vector using seamless cloning technology to obtain the ligation product.
[0012] This invention also provides a method for preparing a recombinant virus expressing the Cap gene of porcine circovirus 2d genotype, comprising the following steps: (1) The PCV2d Cap-P2A gene was synthesized by removing the nuclear localization signal from the PCV2d Cap gene and the porcine swine virus 2A gene; (2) Construct the whole genome recombinant infectious cloning vector pcDNA-rHeN-1 / 2018 of porcine Senecavirus HeN-1 / 2018; (3) The PCV2d Cap-P2A gene was cloned into the whole genome recombinant infectious cloning vector pcDNA-rHeN-1 / 2018 of HeN-1 / 2018 strain using seamless cloning technology to obtain the ligation product; the ligation product was transformed into competent cells, and the recombinant plasmid pSVA-PCV2d-Cap was extracted after culture. (4) Based on the CMV polymerase transcription system, the recombinant plasmid pSVA-PCV2d-Cap was rescued into recombinant porcine Seneca virus rSVA-PCV2d-Cap expressing the Cap gene of porcine circovirus 2d genotype.
[0013] The above-described method for preparing recombinant virus expressing the Cap gene of porcine circovirus 2d genotype involves step (3) transforming the ligation product into DH10B competent cells, picking single colonies and culturing them in 15 mL LB medium containing ampicillin sodium, extracting plasmids and identifying them by PCR. The PCR primers are: SVA-3394F:CGGTGTACGTTCGGTACAAG; SVA-3665R: CCCCACTAGCTCACTGAGC.
[0014] The preparation method of the recombinant virus expressing the Cap gene of porcine circovirus 2d genotype described above, step (4) specifically involves the following steps: BHK21 cells were seeded in 6-well plates and, when confluence reached approximately 85%, were treated with Lipofectamine. TM Using the 3000 Transfection Reagent kit, the recombinant plasmid pSVA-PCV2d-Cap was transfected into healthy BHK21 cells. The medium was changed 6 h after transfection, and the cells were cultured for another 2 days. After freezing and thawing, the cells were centrifuged and the cell culture medium was collected to obtain the recombinant virus rSVA-PCV2d-Cap P0 passage. Subsequently, PK-15 cells were inoculated and blindly passaged until obvious cytopathic effects were observed to obtain the recombinant virus rSVA-PCV2d-Cap.
[0015] The above-mentioned application of recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype in the preparation of drugs for the prevention and treatment of porcine circovirus disease and / or porcine Seneca virus disease.
[0016] In the above applications, the drug is an inactivated vaccine.
[0017] In the above application, the preparation method of the inactivated vaccine is as follows: recombinant virus is inoculated into PK-15 cells for propagation to obtain recombinant virus culture, 1 mmol / L diethyleneimine is added to the culture to inactivate the pathogen, and the inactivation reaction is terminated by treatment with sodium thiosulfate solution. After confirming complete inactivation, an equal volume of ISA 206 adjuvant is added and mixed and emulsified to obtain a porcine circovirus type 2 virus-like inactivated vaccine based on Seneca virus vector.
[0018] Compared with the prior art, the beneficial effects of the present invention are: 1. This invention uses mammalian-derived cells to simultaneously produce SVA and PCV2 structural proteins, utilizing natural viral particles, which can significantly improve the quality of current biological products for the prevention and control of porcine circovirus disease and porcine Seneca virus disease.
[0019] 2. This invention, based on the SVA reverse genetics operating system, constructs a recombinant SVA vector containing the Cap gene of the chimeric dominant prevalent strain PCV2d structural protein, rescuing a recombinant SVA strain stably expressing the Cap protein. Antigen identification and immunogenicity assessment of SVA and PCV2d structural proteins were then conducted. Results verify that the vaccine produced from the constructed recombinant viral rSVA-PCV2d-Cap strain can induce high titers of neutralizing antibodies against both SVA and PCV2 in immunized animals, simultaneously controlling both SVA and PCV viruses. This achieves a single-dose prevention and treatment of both diseases, laying the foundation for the development of a highly efficient bivalent vaccine technology for SVA-PCV2 derived from mammalian cells and providing an effective means for the prevention and control of porcine circovirus disease and porcine Seneca virus disease. Attached Figure Description
[0020] Figure 1 PCR identification results of five single colony cultures during the construction of the recombinant viral vector; Figure 2 Electrophoretic patterns of the backbone plasmid pcDNA-rHeN-1 / 2018 and the recombinant plasmid pSVA-PCV2d-Cap containing the chimeric Cap gene; Figure 3 The rescue results of the recombinant virus rSVA-PCV2d-Cap are shown; Figure A shows untransfected PK-15 cells; Figure B shows PK-15 cells infected with rSVA-PCV2d-Cap; Scale bar: 400 μm; Figure 4 PCR identification results for recombinant virus rSVA-PCV2d-Cap; Figure 5 Western blot identification results of recombinant virus rSVA-PCV2d-Cap; Figure 6 The results of IFA identification of the recombinant virus rSVA-PCV2d-Cap. Detailed Implementation
[0021] This invention, based on the SVA reverse genetics operating system, constructs a recombinant SVA vector containing the Cap gene of the chimeric dominant prevalent strain of PCV2d structural protein, rescuing a recombinant SVA strain stably expressing the Cap protein. A vaccine composition is prepared based on this recombinant strain after inactivation. Identification of SVA and PCV2d structural protein antigens and immunogenicity assessment are performed, laying the foundation for the development of a highly efficient mammalian cell-derived SVA-PCV2 bivalent vaccine and providing an effective means for the prevention and control of porcine circovirus disease and porcine Seneca virus disease. The invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0022] The materials, reagents, and methods used in this invention are as follows: (1) Virus strains, cells and vectors Strains: SVA strain HeN-1 / 2018 and PCV2 strain HeN-11 / 2019 were isolated and preserved in our laboratory; the recombinant SVA virus rCH / HeN-2018-EGFP with chimeric EGFP gene was constructed, rescued and preserved in our laboratory (published in our laboratory: Zhang Xiaozhan, Yang Lei, Deng Tongwei, et al. Construction and preliminary application of recombinant porcine Seneca virus expressing green fluorescent protein [J]. Journal of Animal Husbandry and Veterinary Medicine, 2021, 52(10):2978-2985.).
[0023] Cells: Porcine kidney cell line (PK-15) and baby hamster kidney cells (BHK21) were purchased from the American Type Culture Collection (ATCC). Vector: pcDNA3.1(+) plasmid was preserved and provided by the Animal Medicine and Animal Disease Prevention and Control Team of Henan University of Animal Husbandry and Economics; pcDNA-rHeN-1 / 2018 was prepared using the reverse genetic operating system and its establishment method for rescuing porcine Seneca virus based on dual promoters, as per our laboratory's previously authorized patent CN111057715A.
[0024] (2) Main reagents RNA extraction reagent TRIzol Reagent, reverse transcription kit and transfection reagent (Lipofectamine™ 2000 Transfection Reagent) were purchased from Invitrogen. Fetal bovine serum and cell culture medium (DMEM) were purchased from Gibco. Viral RNA extraction kit, plasmid extraction kit, and gel extraction kit were purchased from Qiagen. The TOPO blunt-ended fragment cloning kit and the seamless assembly cloning kit were purchased from CloneSmarter. The high-fidelity DNA polymerase PrimeSTAR HS was purchased from TAKARA. The viral RNA extraction kit was purchased from Guangzhou Meiji Biotechnology Co., Ltd. HRP-conjugated Goat Anti-Mouse IgG (H+L) was purchased from Wuhan Sanying Biotechnology Co., Ltd. Rabbit anti-SVA-VP2 polyclonal antibody and rabbit anti-PCV2d-Cap polyclonal antibody were prepared and preserved in our laboratory.
[0025] (3) Cell culture, virus proliferation and virus titer determination PK15 and BHK21 cells were cultured in DMEM medium containing 8% fetal bovine serum, 100 U / mL penicillin, and 100 g / mL streptomycin and placed in a 37 ℃, 5% CO2 incubator.
[0026] Once the cells had grown into a monolayer, they were inoculated with SVA strain HeN-1 / 2018 and PCV2 strain HeN-11 / 2019, respectively. Adsorption was carried out at 37°C for 1 h. The inoculum was then discarded, and maintenance medium (DMEM medium containing 2% fetal bovine serum, 100 U / mL penicillin, and 100 g / mL streptomycin) was added for further culture. The virus was harvested when cytopathic effects reached 80%. The cells were subjected to three freeze-thaw cycles to ensure complete detachment, and the supernatant was collected by centrifugation. The collected cells were aliquoted and stored at -80°C for later use.
[0027] The digested and dispersed PK-15 cell suspension was seeded into 96-well cell culture plates at 150 μL per well and cultured overnight; the virus solution was serially diluted 10-fold with cell maintenance medium, starting from 10... -1 Up to 10 -10 Discard the cell culture medium from the 96-well cell culture plates, wash PK-15 cells once with sterile PBS, and add 100 μL of cell maintenance medium per well. Then, add 100 μL of CH-FJZZ-2017 strain virus dilutions at various dilutions to each 96-well plate, with 8 replicates per dilution. Include an uninoculated negative control group in each cell culture plate. Incubate at 37°C in a 5% CO2 incubator. Observe and record the lesion condition daily for 4 consecutive days. Calculate TCID using the Reed-Muench method. 50 .
[0028] Example 1: Construction of recombinant virus rSVA-PCV2d-Cap 1. Construction of the recombinant viral vector pSVA-PCV2d-Cap The PCV2 strain HeN-11 / 2019, a prevalent PCV2 strain obtained in Henan Province, was used as the source of the PCV2d gene. Its sequence is shown in SEQ ID NO:2, totaling 705 bp.
[0029] The Cap gene sequence used in the experiment was obtained by removing 81 bases (21aa, N-terminus and localization signal) from the N-terminus of the Cap gene, adding a CCT(P) cleavage site to the N-terminus, and a TGA terminator at the C-terminus. The sequence is shown in SEQ ID NO:3, totaling 624 bp. The 2A and P2A sequences of porcine cyclovir are shown in SEQ ID NO:4, totaling 63 bp. Encoding 21aa, the amino acid sequence is shown in SEQ ID NO:5. The PCV2d Cap gene and porcine swine virus 2A gene, after the nuclear localization signal above was removed, were sent to Suzhou Hongxun Biotechnology Co., Ltd. for synthesis to obtain the PCV2d Cap-P2A gene.
[0030] An infectious cloning vector, pcDNA-rHeN-1 / 2018, was constructed to store the full-length genome of the SVA virus HeN-1 / 2018. This vector served as the backbone (with the HeN-1 / 2018 genome sequence inserted between the SVA genome 2A and 2B gene sequences). Subsequently, the PCV2d Cap-P2A gene was cloned into pcDNA-rHeN-1 / 2018 using a seamless cloning method. The ligation product was transformed into DH10B competent cells. Single colonies were picked and cultured in 15 mL of LB medium containing ampicillin sodium. Plasmids were extracted and identified by colony PCR using SVA-3394F / SVA-3665R primers. The results are as follows: Figure 1 As shown; the PCR primers are as follows: SVA-3394F: CGGTGTACGTTCGGTACAAG (SEQ ID NO: 6); SVA-3665R: CCCCACTAGCTCACTGAGC (SEQ ID NO:7).
[0031] like Figure 1 As shown, three single-colony cultures amplified the target band of 959 bp. After propagating positive bacteria #3, plasmids were extracted and sequenced to further confirm the correctness of the recombinant plasmid. The insertion position of the PCV2dCap-P2A gene was verified to be correct and without mutation. The recombinant plasmid, named pSVA-PCV2d-Cap (mainly containing the CMV promoter, T7 RNA polymerase promoter sequence, HamRz sequence (containing 10base), HeN-1 / 2018 genome sequence (containing the PCV2dCap and P2A genes between genes 2A and 2B), NotI restriction site, HDVRz sequence, and T7 terminator sequence), is shown in SEQ ID NO:8.
[0032] Subsequently, the vector backbone pcDNA-rHeN-1 / 2018 and the recombinant plasmid pSVA-PCV2d-Cap containing the chimeric Cap gene were subjected to 0.8% agarose gel electrophoresis, and the results are as follows: Figure 2As shown, the two plasmids exhibit distinct target bands at positions 12848 bp and 13535 bp.
[0033] 2. Rescue of the recombinant virus rSVA-PCV2d-Cap Recombinant SVA virus was rescued using the CMV polymerase transcription system. BHK21 cells were seeded in 6-well plates and, when confluence reached approximately 85%, were treated with Lipofectamine. TM Using the 3000 Transfection Reagent kit, the recombinant plasmid pSVA-PCV2d-Cap was transfected into healthy BHK21 cells. The medium was changed 6 h after transfection, and the cells were cultured for another 2 days. After freezing and thawing, the cells were centrifuged, and the cell culture medium was collected as the P0 passage of the recombinant virus rSVA-PCV2d-Cap. Subsequently, PK-15 cells were inoculated and blindly passaged until obvious cytopathic effects were observed to obtain the recombinant virus rSVA-PCV2d-Cap, the sequence of which is shown in SEQ ID NO:1.
[0034] The results showed that in the second generation of blind passage, significant cytopathic effects appeared at 72 hpi. Figure 3 As shown, from passage P3 onwards, 90% of cells developed pathogenesis within 60 hours. This was confirmed by TCID... 50 The viral titer of the recombinant virus rSVA-PCV2d-Cap strain was determined to be 10. 7.25 TCID 50 / 0.1mL.
[0035] 3. Identification of the recombinant virus rSVA-PCV2d-Cap (1) PCR identification of recombinant virus rSVA-PCV2d-Cap To determine whether the PCV2d Cap-P2A gene was completely inserted into the recombinant virus and to assess the genetic stability of the inserted gene, rSVA-PCV2d-Cap and the parental strain HeN-1 / 2018 were passaged 10 times in PK-15 cells. Viral cultures from passages P2, P4, P6, P8, and P10 were collected, and viral RNA was extracted using a viral RNA extraction kit. The RNA was reverse transcribed into cDNA, and the target gene was amplified and sequenced using the specific primers 3394F / 3665R flanking the Cap gene expression cassette and the high-fidelity enzyme PrimeSTAR HS. The PCR products were then subjected to agarose gel electrophoresis and nucleic acid sequencing to verify the presence and genetic stability of the Cap gene in each passage of rSVA-PCV2d-Cap. The results are as follows: Figure 4 As shown.
[0036] The results showed that the P2-P10 sites of the recombinant virus rSVA-PCV2d-Cap successfully amplified a 959 bp target band, and sequencing confirmed the absence of base insertions and mutations. The parental strain HeN-1 / 2018 control group amplified a 272 bp target band using 3394F / 3665R, demonstrating the stable presence of the Cap gene in the recombinant virus rSVA-PCV2d-Cap.
[0037] (2) Western blot identification of recombinant virus rSVA-PCV2d-Cap To verify whether the recombinant virus rSVA-PCV2d-Cap stably expresses the Cap protein, Western blot assays were used to determine the expression of the Cap protein during recombinant SVA virus infection. P3 recombinant virus rSVA-PCV2d-Cap was seeded into PK-15 cells at 0.1 MOI, with both parental SVA virus-infected and uninfected groups established. Cell samples were collected at 36 hpi, and the protein concentration of each group was determined using a BCA protein concentration assay kit. Equal volumes of samples from each group were subjected to SDS-PAGE gel electrophoresis. After transfer, the membranes were blocked with TBST buffer containing 5% skim milk powder at room temperature for 2 h. The membranes were incubated overnight at 4°C with either a 1:500 dilution of rabbit anti-SVA-VP2 polyclonal antibody or rabbit anti-PCV2d-Cap polyclonal antibody as primary antibodies, washed three times, and then incubated with a 1:5000 dilution of HRP-labeled goat anti-rabbit IgG at room temperature for 1 h. After washing three times with TBST buffer, the membranes were processed using an ECL colorimetric assay kit for analysis. The results are shown below. Figure 5 As shown.
[0038] Depend on Figure 5 It can be seen that the recombinant virus rSVA-PCV2d-Cap can detect SVA VP2 protein and PCV2d Cap protein, with protein molecular weights of 32 kDa and 29 kDa respectively, consistent with the expected theoretical protein size. The parental strain HeN-1 / 2018 infection group can only detect SVA VP2 protein, proving that the recombinant virus rSVA-PCV2d-Cap can correctly express PCV2d Cap protein.
[0039] (3) Indirect immunofluorescence (IFA) identification of recombinant virus rSVA-PCV2d-Cap The expression of Cap protein during infection with recombinant virus rSVA-PCV2d-Cap was further determined using an IFA assay. PK-15 cells were seeded in 24-well plates and, when confluence reached 90%, were inoculated with P3 recombinant virus rSVA-PCV2d-Cap at a multiplicity of infection (MOI) of 0.1. Both parental SVA-infected and uninfected groups were established. After incubation at 37°C for 1 h, the cells were washed twice with PBS, and cell maintenance medium was added for further culture. At 24 hpi, the cell supernatant was aspirated, and the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 30 min, treated with 0.5% Triton X-100 at room temperature for 30 min, and then treated with a 1:200 dilution of rabbit anti-SVA-VP2 polyclonal antibody or rabbit anti-PCV2d-Cap polyclonal antibody for 1 h. After washing the cells three times, they were treated with a 1:500 dilution of FITC-labeled goat anti-rabbit IgG for 1 h. Finally, the cells were washed four times with PBS and then treated with 1 μM DAPI for 10 min to stain the nuclei. Fluorescence was observed using an EVOS FL cell imaging system. The results are as follows: Figure 6 As shown.
[0040] Depend on Figure 6 It can be seen that the cells infected with the recombinant virus rSVA-PCV2d-Cap showed obvious immunofluorescence signals of SVA VP2 protein and PCV2d Cap protein, while the cells infected with the parental strain HeN-1 / 2018 could only show immunofluorescence signals of SVA VP2 protein. This proves that the recombinant virus rSVA-PCV2d-Cap can not only produce SVA virus during infection, but also produce PCV2d Cap protein in cells.
[0041] Example 2: Preparation of recombinant virus rSVA-PCV2d-Cap inactivated vaccine Recombinant virus rSVA-PCV2d-Cap, SVA strain HeN-1 / 2018, and PCV2 strain HeN-11 / 2019 were inoculated into PK-15 cells for propagation to obtain sufficient recombinant virus cultures. Diethyleneimine was added to a final concentration of 1 mmol / L to inactivate the pathogen, and the inactivation reaction was terminated with sodium thiosulfate solution. Virus inactivation was verified by a virus inoculation experiment. An equal volume of ISA 206 adjuvant was added to the completely inactivated virus cultures for emulsification. The quality of the vaccine emulsification was determined according to national quality standards.
[0042] Example 3: Efficacy verification of recombinant virus rSVA-PCV2d-Cap inactivated vaccine To analyze the immunogenicity of the SVA antigen and Cap protein produced by the recombinant virus rSVA-PCV2d-Cap, the preparation method of Example 2 was used to inactivate cultures of the recombinant virus rSVA-PCV2d-Cap, the SVA strain HeN-1 / 2018, and the PCV2 strain HeN-11 / 2019, respectively. These were then emulsified with ISA 206 adjuvant to prepare an inactivated vaccine. The immunogenicity of the recombinant virus rSVA-PCV2d-Cap was evaluated based on mouse immunization experiments. Specifically, 20 four-week-old SPF-grade BALB / c female mice were randomly divided into four groups: an rSVA-PCV2d-Cap group, an SVA inactivated vaccine group, and a PCV2 inactivated vaccine group (n=5 each), and a control group (n=5). Mice in the experimental groups were subcutaneously injected with an immunogen dose of 200 μL per mouse, while the control group was injected with sterile PBS. Two weeks after the initial immunization, mice were boosted with the same dose and route. Blood samples were collected within 10 days of the second immunization, and serum samples were separated. Neutralization tests were performed to detect antibody titers against SVA and PCV2 in the serum of each group of mice, and to determine the changes in antibody levels after immunization with recombinant virus rSVA-PCV2 d-Cap. Specifically: (1) SVA neutralizing antibody assay The neutralization assay combined with fluorescent virus technology was used to detect SVA neutralizing antibodies produced in mice immunized with inactivated vaccine. The specific steps are as follows: 1) All the serum from the mice to be tested was incubated in a 56℃ water bath for 30 min to inactivate the serum; 2) Each serum sample was serially diluted at 1:8, 1:16, 1:32, 1:64, 1:128, 1:256 and 1:512, with 3 replicates for each dilution. Each well contained 100 μL of diluted serum for the SVA neutralizing antibody assay.
[0043] 3) Dilute the recombinant SVA virus rCH / HeN-2018-EGFP virus solution containing the chimeric EGFP gene to 200 TCID using cell maintenance medium. 50 Add 0.1 mL of the diluted virus solution to the serum diluted in the above steps, mix well, and incubate at 37°C in a 5% CO2 incubator for 2 hours.
[0044] 4) Transferred healthy PK-15 cells to 96-well plates in advance. When the confluence reached 90%, washed once with PBS, and added 200 μl / well of the above virus-serum mixture to each well. Positive and negative control groups were set up, one with virus solution and the other without. The cells were incubated at 37°C in a 5% CO2 incubator. The intracellular green fluorescence signal was observed and recorded daily. The serum neutralizing titer was determined by the maximum serum dilution that could inhibit 50% rCH / HeN-2018-EGFP infection. The SVA neutralizing antibody levels in the serum of each group of mice were recorded. The results are shown in Table 1 below.
[0045] As shown in Table 1, secondary immunization with the recombinant virus rSVA-PCV2d-Cap and the inactivated SVA strain HeN-1 / 2018 vaccine induced specific neutralizing antibodies in immunized mice. The levels of neutralizing antibodies in the two groups of mice were comparable, with most immunized mice maintaining a serum neutralizing antibody ratio of 1:128, and a few mice reaching a maximum antibody ratio of 1:256, meeting the immunization requirements. However, no neutralizing antibodies against the SVA virus were detected in mice in both the PCV2 strain HeN-11 / 2019 inactivated vaccine group and the control group.
[0046] (2) PCV2 neutralizing antibody assay The level of PCV2 neutralizing antibodies induced in mice by this inactivated vaccine was detected using a neutralization assay combined with indirect immunofluorescence. The specific steps are as follows: 1) All the serum from the mice to be tested was incubated in a 56℃ water bath for 30 min to inactivate the serum; 2) Each serum sample was serially diluted at 1:8, 1:16, 1:32, 1:64, 1:128, 1:256 and 1:512, with 3 replicates for each dilution. Each well contained 100 μL of diluted serum for the PCV2 neutralizing antibody assay.
[0047] 3) Dilute the PCV2 strain HeN-11 / 2019 virus solution to 200 TCID using cell maintenance medium. 50 Add 0.1 mL of the diluted virus solution to the serum diluted in the above steps, mix well, and incubate at 37°C in a 5% CO2 incubator for 2 hours.
[0048] 4) Transfer healthy PK-15 cells to 96-well plates in advance. When the cells reach 80% confluence, wash once with PBS. Add 200 μl of the above virus-serum mixture to each well. Set up positive and negative control groups (one with virus solution and one without). Incubate at 37°C in a 5% CO2 incubator.
[0049] 5) Sixty h post-infection, the cell supernatant was discarded, and the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 30 min, treated with 0.5% Triton X-100 at room temperature for 30 min, and then treated with rabbit anti-PCV2d-Cap polyclonal antibody diluted 1:200 for 1 h. After washing the cells three times, they were treated with FITC-labeled goat anti-rabbit IgG diluted 1:500 for 1 h. Finally, the cells were washed four times with PBS and then treated with 1 μM DAPI for 10 min for nucleus staining.
[0050] 6) The intracellular green fluorescence signal was observed and recorded using the EVOS FL cell imaging system. The serum neutralizing titer was determined by the maximum serum dilution that could inhibit 50% of PCV2 strain HeN-11 / 2019 infection. The results are shown in Table 2 below.
[0051]
[0052] Table 2 shows that secondary immunization with the recombinant virus rSVA-PCV2d-Cap and the PCV2 strain HeN-11 / 2019 inactivated vaccine induced specific neutralizing antibodies in immunized mice. The levels of neutralizing antibodies in the two groups of mice were comparable, with most immunized mice maintaining a serum neutralizing antibody ratio of 1:32, and a few mice reaching a maximum antibody ratio of 1:64, meeting the immunization requirements. However, no neutralizing antibodies against the PCV2 virus were detected in mice in both the SVA strain HeN-1 / 2018 PCV2 inactivated vaccine group and the control group.
[0053] As can be seen from Tables 1 and 2, the vaccine produced by the recombinant virus rSVA-PCV2d-Cap strain constructed in this invention can induce immunized animals to produce neutralizing antibodies with high titers against SVA and PCV2.
[0054] The above description is only a preferred embodiment of the present invention and does not limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype, characterized in that: Its complete genome sequence is shown in SEQ ID NO:
1.
2. The recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype according to claim 1, characterized in that: The recombinant virus was constructed using porcine Seneca virus as a vector to create an infectious cloning vector containing its full-length genome. The Cap gene of the porcine circovirus 2d genotype was recombined into the infectious cloning vector using seamless cloning technology to obtain a ligation product. The ligation product was then transformed into competent cells, and after culturing and verification, a recombinant plasmid was obtained. The plasmid was then rescued using the CMV polymerase transcription system.
3. The recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype according to claim 1, characterized in that: The viral titer of the recombinant porcine Senecavirus strain expressing the Cap gene of porcine circovirus 2d genotype was 10. 7.25 TCID 50 / 0.1mL.
4. The recombinant porcine Seneca virus expressing the Cap gene of porcine circovirus 2d genotype according to claim 2, characterized in that: The porcine Seneca virus used as a vector is porcine Seneca virus HeN-1 / 2018.
5. The recombinant porcine Seneca virus of the Cap gene of porcine circovirus 2d genotype according to claim 2, characterized in that: The ligation product was obtained by recombining the Cap gene of porcine circovirus 2d genotype into the infectious cloning vector using seamless cloning technology. Specifically, the Cap gene of porcine circovirus 2d genotype with nuclear localization signal removed was first synthesized with the porcine cyclovir 2A gene to form the PCV2d Cap-P2A gene. Then, the PCV2d Cap-P2A gene was recombined into the infectious cloning vector using seamless cloning technology to obtain the ligation product.
6. The method for preparing recombinant virus expressing the Cap gene of porcine circovirus 2d genotype as described in any one of claims 1-5, characterized in that: Includes the following steps: (1) The PCV2d Cap-P2A gene was synthesized by removing the nuclear localization signal from the PCV2d Cap gene and the porcine swine virus 2A gene; (2) Construct the whole genome recombinant infectious cloning vector pcDNA-rHeN-1 / 2018 of porcine Senecavirus HeN-1 / 2018; (3) The PCV2d Cap-P2A gene was cloned into the recombinant infectious cloning vector pcDNA-rHeN-1 / 2018 using seamless cloning technology to obtain the ligation product; the ligation product was transformed into competent cells, and the recombinant plasmid pSVA-PCV2d-Cap was extracted after culturing. (4) Based on the CMV polymerase transcription system, the recombinant plasmid pSVA-PCV2d-Cap was rescued into recombinant porcine Seneca virus rSVA-PCV2d-Cap expressing the Cap gene of porcine circovirus 2d genotype.
7. The method for preparing recombinant virus expressing the Cap gene of porcine circovirus 2d genotype according to claim 6, characterized in that: In step (3), the ligation product was transformed into DH10B competent cells, and a single colony was picked and cultured in 15 mL of LB medium containing ampicillin sodium. The plasmid was extracted and identified by PCR. The PCR primers were: SVA-3394F:CGGTGTACGTTCGGTACAAG; SVA-3665R: CCCCACTAGCTCACTGAGC.
8. The use of recombinant porcine Senecavirus expressing the Cap gene of porcine circovirus 2d genotype as described in any one of claims 1-5 in the preparation of drugs for the prevention and treatment of porcine circovirus disease and / or porcine Senecavirus disease.
9. The application according to claim 8, characterized in that: The drug in question is an inactivated vaccine.
10. The application according to claim 9, characterized in that: The method for preparing the inactivated vaccine is as follows: recombinant virus is inoculated into PK-15 cells for propagation to obtain a recombinant virus culture. 1 mmol / L diethyleneimine is added to the culture to inactivate the pathogen, and the inactivation reaction is terminated by treatment with sodium thiosulfate solution. After confirming complete inactivation, an equal volume of ISA 206 adjuvant is added and mixed and emulsified to obtain a porcine circovirus type 2 virus-like inactivated vaccine based on the Seneca virus vector.