Primer pairs related to resistance to wheat scab and application thereof

By designing primers for PCR detection of M11098, the problem of insufficient number of molecular markers for wheat scab resistance in existing technologies was solved, and effective screening of superior allelic variants was achieved, which promoted the improvement of disease resistance in wheat breeding.

CN121137252BActive Publication Date: 2026-04-28ZHEJIANG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511635533.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-10
Publication Date
2026-04-28
Estimated Expiration
2045-11-10

AI Technical Summary

Technical Problem

The number of molecular markers that aggregate multiple disease resistance sites in existing technologies is limited, making it difficult to effectively improve the resistance level of wheat scab. The lack of abundant disease resistance resources also affects the improvement effect of genetic breeding.

Method used

A set of primer pairs M11098 related to wheat resistance to Fusarium head blight was designed. PCR detection was used to determine whether wheat contained superior allelic variants for resistance to Fusarium head blight. The positions of the primer ends were adjusted by artificially introducing mutant bases to improve amplification specificity, and new variant sequences were developed for PCR amplification.

Benefits of technology

This study enabled the effective detection of superior allelic variations in wheat scab, enriched disease-resistant resources, promoted the genetic improvement of wheat scab, and improved the selection efficiency of breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121137252B_ABST
    Figure CN121137252B_ABST
Patent Text Reader

Abstract

The application discloses a primer pair related to wheat scab resistance and application, the nucleotide sequence of the primer pair is shown as SEQ ID NO.1 and SEQ ID NO.2, and the primer pair can be used to detect wheat scab resistance; namely, taking wheat genome DNA as a template, performing PCR amplification on the template by using the primer pair, performing electrophoresis on the amplification product on a 1% agarose gel to obtain a detection result, and if the amplification product contains a 154bp band, it is indicated that the wheat material contains an excellent allelic variation based on T, and the wheat material has scab resistance; and the method can be applied to screening of the wheat resistant to scab and selection of early generations in breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of wheat genetics and breeding and molecular biology, and in particular to a primer pair related to wheat scab resistance and its application. Background Technology

[0002] Fusarium head blight is one of the major fungal diseases of wheat, affecting the wheat ear and impacting yield and quality. Furthermore, the mycotoxins carried by diseased wheat grains affect seed quality, endanger human and animal health, and threaten food security. Utilizing Fusarium head blight resistance genes / locus is an effective way to mitigate the damage caused by wheat Fusarium head blight.

[0003] Wheat scab resistance is a complex quantitative trait controlled by multiple genes, which can be divided into five types: I. resistance to invasion; II. resistance to spread; III. resistance to toxin accumulation; IV. resistance to grain infection; and V. disease tolerance. Meta-analysis identified 77 high-confidence QTLs located on all 21 wheat chromosomes, with resistance types mainly concentrated in resistance to invasion, resistance to spread, and resistance to toxin accumulation. Of the nine currently identified wheat scab resistance loci, only... Fhb1 and Fhb7 It was cloned and functionally validated, and applied to improve resistance to Fusarium head blight. In certain wheat-growing regions of North America and Europe, it is found in commercially available wheat varieties. Fhb1 The frequency exceeds 80%, and its donor is Sumai 3. Among the domestically approved varieties, the wheat variety resistant to Fusarium head blight is... Fhb1 Over 90% of the frequency comes from Ningmai No. 9; in addition... Fhb1 The frequency of these strains in high-generation breeding lines at the International Maize and Wheat Improvement Center is increasing year by year, accumulating breeding materials for improving wheat scab resistance in South America and East Asia.

[0004] Molecular marker detection techniques based on single nucleotide polymorphisms and PCR have the following advantages: 1. They do not rely on high-throughput sequencing technology and have shorter reaction times; 2. They utilize the specific binding characteristics of primers to artificially introduce mutant bases, resulting in high specificity; 3. Agarose gel amplification fragments are generally dominant markers, making them easy to interpret. While aggregating multiple resistance loci can significantly improve wheat scab resistance, the number of loci / genes or markers practically applicable to genetic breeding is limited. Therefore, developing and analyzing new resistance loci / superior allelic variant loci to enrich resistance resources and promote genetic improvement of wheat resistance to scab has become a pressing technical challenge in this field. Summary of the Invention

[0005] To develop molecular markers for wheat resistance to Fusarium head blight that can be used for genetic breeding-assisted selection, this application designed primer pairs based on the molecular marker M11098 for PCR amplification of novel variant sequences. The PCR detection results using these M11098 primer pairs can determine whether wheat contains superior allelic variants for Fusarium head blight resistance, and can be applied to the screening of Fusarium head blight-resistant wheat and the selection of early generations in breeding.

[0006] This invention is achieved through the following technical solution:

[0007] First, this application provides a set of primer pairs related to wheat scab resistance, the nucleotide sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0008] This application is the first to discover the molecular marker M11098 associated with resistance to wheat scab and further develops its primer pair. Specifically, the physical distance of the single nucleotide polymorphism (SNP) sequence is determined by manual alignment and correction, the primer ends are adjusted to anchor the mutation site, a mutant base is introduced at the 3' end (position 3), and amplification is performed. A mutation is artificially introduced at the 3' end (position 3) of the sequence in SEQ ID NO.1, resulting in a base "A". The marker can be used for amplification detection only if and only if the base at this position is "A".

[0009] Secondly, this application provides the application of the above primer pairs in detecting wheat scab resistance. The specific steps are as follows: using sample wheat genomic DNA as a template, PCR amplification is performed using the primer pairs shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, followed by electrophoresis. If a DNA band of 154 bp appears, it indicates that the wheat material contains the excellent allelic variant base "T" for resistance to scab and has wheat scab resistance.

[0010] The above PCR amplification system consisted of: 10× buffer 1 µl, 25 mM MgCl2 0.5 µl, 2.5 mM dNTP 0.5 µl, 10 µM primer SEQ ID NO.1 0.5 µl, 10 µM primer SEQ ID NO.2 0.5 µl, 5 U / µl Taq polymerase 0.2 µl, template DNA 200 ng, and ddH2O to a final volume of 10 µl.

[0011] PCR amplification program: 94˚C for 3 minutes; 94˚C for 15 seconds, 58˚C for 30 seconds, 72˚C for 30 seconds extension, 30 cycles; 72˚C extension for 5 minutes.

[0012] The above method can be applied to the detection of wheat resistance to Fusarium head blight, especially the detection of Fusarium head blight resistance in Ningmai 3 and its derivative lines.

[0013] In this application, the term "Fusarium head blight resistance" refers to wheat varieties that meet the "medium resistance" and "resistance" standards when tested according to the industry standard NY / T2954-2016.

[0014] This application marks the first discovery of the molecular marker M11098 and the development of a superior allelic variant locus for PCR detection of wheat resistance to Fusarium head blight. This locus can be used for early-generation selection in genetic breeding for resistance to Fusarium head blight. The analysis of new resistance loci / superior allelic variants and the development of molecular markers will greatly enrich resistance resources and promote the genetic improvement of wheat against Fusarium head blight. Attached Figure Description

[0015] Figure 1 The amplification results of the primers for the molecular marker M11098;

[0016] Wherein, M: molecular weight standard DL2000, P1 is wheat variety Anong 8455, P2 is wheat variety Ningmai 3, and two replicates are amplified each time. SEQ ID 3 / 2: Amplification results of primer pairs SEQ ID NO. 3 and SEQ ID NO. 2, where no artificially introduced mutation is present in the SEQ ID NO. 3 sequence, and the 3rd base at the 3' end is "C"; SEQ ID 4 / 2: Amplification results of primer pairs SEQ ID NO. 4 and SEQ ID NO. 2, where an artificially introduced mutation is present in the SEQ ID NO. 4 sequence, and the 3rd base at the 3' end is changed from "C" to "G"; SEQ ID 1 / 2: Amplification results of primer pairs SEQ ID NO. 1 and SEQ ID NO. 2, where an artificially introduced mutation is present in the SEQ ID NO. 1 sequence, and the 3rd base at the 3' end is changed from "C" to "A"; SEQ ID 5 / 2: Amplification results of primer pairs SEQ ID NO. 5 and SEQ ID NO. 2, where an artificially introduced mutation is present in the SEQ ID NO. 5 sequence, and the 3rd base at the 3' end is changed from "C" to "T".

[0017] Figure 2 The results of early-generation selection using the molecular marker M11098 in wheat genetic breeding;

[0018] Among them, M: molecular weight standard DL2000, the template DNA of lanes 1-24 is the F2 generation wheat line of the selection nursery, and its corresponding numbers are as follows: B001, B002, B003, B004, B005, B006, B007, B008, B009, B010, B011, B012, B013, B014, B015, B016, B017, B018, B019, B020, B021, B022, B023, B024. Detailed Implementation

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0020] In the following examples, the lowercase letters in the nucleotide sequences refer to artificially introduced mutant bases:

[0021] SEQ ID NO.1: AGGCCCCAACGAAGTaTA;

[0022] SEQ ID NO.2: CAGGGAACGTCATCTAGGAT;

[0023] SEQ ID NO.3: AGGCCCCAACGAAGTCTA;

[0024] SEQ ID NO.4: AGGCCCCAACGAAGTgTA;

[0025] SEQ ID NO. 5: AGGCCCCAACGAAGTtTA.

[0026] The sources of materials involved in the embodiments:

[0027] F2 generation wheat lines in the seed selection nursery: F1 generation seeds were obtained through sexual hybridization using Ningmai 3 and Ningmai 13 as parents, and F2 generation wheat lines were obtained through self-pollination, i.e., single-seed transmission. These lines are preserved by the Wheat Genetics and Breeding Research Laboratory of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences.

[0028] Fusarium graminearum: Fusarium graminearum Fa0609, preserved by the Tritice Crops Research Laboratory of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences, is a common Fusarium graminearum.

[0029] Example 1: Amplification results of the molecular marker M11098 primer pair

[0030] Molecular marker M11098 was derived from parental genetic mapping and physical location comparison. A single nucleotide polymorphism (T / C, physical location 19380541 bp) located on chromosome 2D is associated with wheat resistance to Fusarium head blight. The Fusarium head blight-resistant variety Ningmai 3 contains the superior allelic variant "T" associated with Fusarium head blight resistance, while the highly susceptible variety Anong 8455 has an allelic variant "C". Genomic DNA was extracted from wheat leaves using the CTAB method and quantified using a Nanodrop micro-spectrophotometer.

[0031] The design of the molecular marker M11098 primer pairs followed these principles and could not be achieved through software design: 1. The front primer was anchored to the superior allelic variant "T" through sequence alignment and correction; 2. The lengths of the front and back primers were adjusted to ensure a GC content of 50%; 3. An artificial mutation was introduced at the 3' end of the front primer, covering all mutation types. The mutations in the front primers were as follows: the 3' end of the original primer SEQ ID NO.3 sequence was mutated from "C" to "A", as shown in SEQ ID NO.1; the 3' end of the original primer SEQ ID NO.3 sequence was mutated from "C" to "G", as shown in SEQ ID NO.4; the 3' end of the original primer SEQ ID NO.3 sequence was mutated from "C" to "T", as shown in SEQ ID NO.5. No mutated bases were introduced in the back primer (SEQ ID NO: 2).

[0032] PCR amplification was performed using genomic DNA from wheat leaves of Anong 8455 and Ningmai 3 as templates:

[0033] The PCR amplification system was a 10 µl system: 1 µl of 10× buffer, 0.5 µl of 25 mM MgCl2, 0.5 µl of 2.5 mM dNTP, 0.5 µl of 10 µM front primer, 0.5 µl of 10 µM back primer (SEQ ID NO.2), 0.2 µl of 5 U / µl Taq polymerase, 200 ng of template DNA, and ddH2O to a final volume of 10 µl; the front primers were one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0034] PCR amplification program: 94˚C for 3 minutes; 94˚C for 15 seconds, 58˚C for 30 seconds, 72˚C for 30 seconds extension, 30 cycles; 72˚C extension for 5 minutes; amplification products were detected by 1.0% agarose gel electrophoresis.

[0035] Amplification results as follows Figure 1As shown, the amplification results of primer pairs SEQ ID NO.3 and SEQ ID NO.2 show that when there is no mutation at the 3rd base of the 3' end of the front primer, the amplified band pattern is the same, and there is non-specific amplification; the amplification results of primer pairs SEQ ID NO.4 and SEQ ID NO.2 show that when the 3rd base of the 3' end of the front primer is mutated from "C" to "G", the amplified band pattern is the same, and there is non-specific amplification; the amplification results of primer pairs SEQ ID NO.5 and SEQ ID NO.2 show that when the 3rd base of the 3' end of the front primer is mutated from "C" to "T", the amplified band pattern is the same; the amplification results of primer pairs SEQ ID NO.1 and SEQ ID NO.2 show that when the 3rd base of the 3' end of the front primer is mutated from "C" to "A", the superior allelic variant "T" sequence amplifies the target band, while the allelic variant "C" sequence does not produce the target band.

[0036] The above results indicate that the superior allelic variant "T" associated with Fusarium head blight can be effectively amplified only when the mutated primer SEQ ID NO.1 is used (i.e., the 3rd base at the 3' end of the original primer SEQ ID NO:3 sequence is mutated from "C" to "A"). The amplification results were detected by 1.0% agarose gel electrophoresis, showing no nonspecific amplification. In conclusion, the molecular marker primer pair SEQ ID NO.1 and SEQ ID NO.2 can be used for the amplification of superior allelic variants associated with Fusarium head blight.

[0037] Example 2: Molecular marker M11098 used for selection in early generations of wheat genetic breeding

[0038] The tested lines are F2 generation wheat lines from the seed selection nursery, and the applicant has assigned the following numbers: B001, B002, B003, B004, B005, B006, B007, B008, B009, B010, B011, B012, B013, B014, B015, B016, B017, B018, B019, B020, B021, B022, B023, B024.

[0039] The above wheat lines were tested using the detection method for molecular marker M11098 established in Example 1, and lines containing excellent allelic variants against Fusarium head blight were selected to enter the next generation.

[0040] Meanwhile, field resistance identification of wheat varieties was conducted according to the agricultural industry standard NY / T2954-2016. The resistance level of the varieties to Fusarium head blight was assessed using the single-flower drip method: 5 × 10⁻⁶ conidial solution of the highly pathogenic wheat Fusarium head blight pathogen F0609 was cultured. 5(1 conidia / ml) The conidial solution was dripped into one floret in the middle of the wheat ear at the early flowering stage, 10 ears per variety. After covering with a plastic bag to maintain moisture for 3 days, spray with water mist 3-4 times a day for about 5 minutes each time to achieve the desired moisturizing effect. The severity of inoculation was investigated 21 days after inoculation, and the average severity was calculated. Wheat varieties with an average severity of less than 2 were judged as "resistant", wheat varieties with an average severity of 2 or greater but less than 3 were judged as "moderately resistant", and wheat varieties with an average severity of 3 or greater were judged as "susceptible".

[0041] Amplification of molecular marker M11098 in F2 generation wheat lines in the seed selection nursery, as follows Figure 2 As shown, the lines containing excellent allelic variations resistant to Fusarium head blight are: B003, B006, B008, B009, B013, B015, B017, and B018. Selecting these lines for the next generation, it can be determined that the above lines are resistant to Fusarium head blight (i.e., "resistant" and "moderately resistant" varieties).

[0042] The results of M11098 marker detection and field resistance identification of F2 generation wheat lines in the seed selection nursery are shown in Table 1. The lines selected with molecular marker assistance all reached "medium resistance" or above in field resistance identification. Molecular marker M11098 can be effectively used as an auxiliary selection for resistance to Fusarium head blight in wheat genetic breeding.

[0043] Table 1. Marker detection results and field resistance identification of M11098 in F2 generation wheat lines from the seed nursery.

[0044] Material Number Label detection (M11098) Average severity Disease resistance level B001 no 3.71 feel B002 no 3.17 feel B003 yes 2.33 China Anti B004 no 3.00 feel B005 no 3.29 feel B006 yes 2.29 China Anti B007 no 3.71 feel B008 yes 1.80 anti- B009 yes 2.00 China Anti B010 no 3.83 feel B011 no 3.60 feel B012 no 4.00 feel B013 yes 2.44 China Anti B014 no 3.75 feel B015 yes 2.50 China Anti B016 no 3.43 feel B017 yes 2.14 China Anti B018 yes 2.67 China Anti B019 no 3.57 feel B020 no 3.86 feel B021 no 4.00 feel B022 no 4.00 feel B023 no 3.50 feel B024 no 3.86 feel

[0045] The above examples verify that the molecular marker M11098 can be applied to the detection of wheat scab, especially to the screening of superior allelic variations in scab resistance in Ningmai 3 and its breeding lines containing Ningmai 3.

Claims

1. A primer pair associated with resistance to wheat scab, characterized in that, The nucleotide sequences of the primer pairs shown are as shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. The application of the primer pair as described in claim 1 in the detection of wheat scab resistance.

3. The application as described in claim 2, characterized in that, The application refers to the following: using wheat genomic DNA as a template, performing PCR amplification with the primer pair shown in SEQ ID NO.1 and SEQ ID NO.2, followed by electrophoresis, if a DNA band of 154 bp appears, it indicates that the wheat material has resistance to Fusarium head blight.

4. The application according to claim 3, characterized in that, The PCR amplification refers to: PCR amplification system: 10× buffer 1µl, 25mM MgCl2 0.5µl, 2.5mM dNTP 0.5µl, 10µM primer SEQ ID NO.1 0.5µl, 10µM primer SEQ ID NO.2 0.5µl, 5U / µl Taq polymerase 0.2µl, template DNA 200 ng, ddH2O to 10µl; PCR amplification program: 94℃ for 3 minutes; 94℃ for 15 seconds, 58℃ for 30 seconds, 72℃ for 30 seconds extension, 30 cycles; 72℃ extension for 5 minutes.

Citation Information

Patent Citations

  • Molecular marker for identifying fusarium head blight resistance of wheat, and application of molecular marker

    CN109371159A

  • A pair of primers for detecting wheat scab resistance and application thereof

    CN109402292A