Application of miR-652-3p in preparation of medicine for promoting neural stem cells to differentiate into neurons

Abstract

The invention discloses application of miR-652-3p in preparation of a medicine for promoting neural stem cells to differentiate into neurons, and belongs to the technical field of neural stem cell differentiation, the nucleotide sequence of the miR-652-3p is SEQ ID NO.1: AAUGGCGCCACUAGGGUUGUG, the miR-652-3p can promote the neural stem cells to differentiate into neurons in vitro, and the miR-652-3p can be used for preparing the medicine for promoting the neural stem cells to differentiate into neurons.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of neural stem cell differentiation, and particularly relates to application of miR-652-3p in preparation of a drug for promoting differentiation of neural stem cells into neurons. BACKGROUND

[0002] Neural stem cells (NSCs) are a kind of pluripotent stem cells, which can differentiate into various types of neural cells, including neurons. In the central nervous system of adult mammals, there are still some NSCs in local areas. Neuron loss is a pathological feature of many neurodegenerative diseases (such as Alzheimer's disease and Parkinson's disease). Since NSCs have the potential to differentiate into neurons, NSC therapy can be a promising treatment option. However, the proportion of NSCs differentiating into neurons in the adult brain is very low, far from enough to completely replace the lost neurons, so it is necessary to find ways to promote the differentiation of NSCs into neurons.

[0003] MicroRNAs (miRNAs) are short non-coding RNAs with a length of about 20-24 nucleotides. Their regulation of target genes is mainly achieved by blocking the translation of target gene mRNA or accelerating its degradation. MiRNAs play an important role in cell proliferation, differentiation and other processes by regulating the expression of their target genes. MiRNAs are abundant in the central nervous system and play a key role in neurogenesis. They can control the expression of many stem cell regulatory factors and play an important role in stem cell fate determination.

[0004] Based on the above background, if miRNAs that can promote the differentiation of neural stem cells into neurons are found, it may provide a new method for preparing drugs that can make neural stem cells differentiate into neurons. SUMMARY

[0005] The technical problem solved by the application is:

[0006] The application solves the problem that the proportion of NSCs differentiating into neurons in the adult brain is very low, far from enough to completely replace the lost neurons, and other problems in the prior art. The application provides application of miR-652-3p in preparation of a drug for promoting differentiation of neural stem cells into neurons. The main purpose of the application is to provide a miRNA, i.e. miR-652-3p, that can promote the differentiation of neural stem cells into neurons, and to provide a new method for preparing a drug that can promote the differentiation of neural stem cells into neurons.

[0007] Technical solution

[0008] The application of miR-652-3p in the preparation of a drug for promoting the differentiation of neural stem cells into neurons, wherein the nucleotide sequence of the miR-652-3p is SEQ ID NO. 1: AAUGGCGCCACUAGGGUUGUG.

[0009] Preferably, the drug comprises miR-652-3p and a pharmaceutically acceptable excipient.

[0010] Preferably, the excipient is one or more of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier, a lubricant.

[0011] Preferably, the drug is an oral or non-oral drug, and the drug is a tablet, a capsule, a powder, a pill, a granule, a solution, a suspension, a syrup, an injection, a suppository, an adsorbent or a spray.

[0012] Original explanation: miR-652-3p is downstream of sodium valproate and can be up-regulated by sodium valproate, and sodium valproate has been proved to promote the differentiation of neural stem cells into neurons, so the application proves that miR-652-3p can promote the differentiation of neural stem cells into neurons.

[0013] Beneficial effects

[0014] 1. The miR-652-3p of the application can promote the differentiation of neural stem cells into neurons in vitro (P<0.05).

[0015] 2. The miR-652-3p of the application can be used for preparing a drug for promoting the differentiation of neural stem cells into neurons. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 The expression graphs of the neuronal marker molecules Neurod1, Syn1, Stmn2 and Map2 were detected by real-time quantitative PCR after the primary neural stem cells of the application were transfected with miR-NC or miR-652-3p analogs (mean ± standard deviation, ***P<0.001);

[0017] Figure 2Detection diagram of the primary neural stem cells of the present application after transfection of miR-NC or miR-652-3p analogues, wherein A is the detection of the expression of Tuj1 by Western blotting and the relative gray value of the band is counted (mean ± standard deviation, ***P<0.001), and β-actin is the internal reference; B is the detection of the expression of the neuronal marker Tuj1 by immunofluorescence, and the proportion of Tuj1 positive cells is counted (mean ± standard deviation, **P<0.01), and the nucleus is stained by Hoechst, and the scale = 100 microns; C is the detection and counting of the proportion of Tuj1 positive cells by flow cytometry (mean ± standard deviation, ***P<0.001). DETAILED DESCRIPTION

[0018] The present application will be described in detail below in conjunction with specific examples. The following examples will help those skilled in the art to further understand the present application, but do not limit the present application in any form. It should be noted that, for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made. These all belong to the protection scope of the present application.

[0019] The in vitro differentiation experiments of the following examples of the present application use primary neural stem cells derived from the hippocampus of E14.5 day embryonic rats.

[0020] The expression of miR-652-3p is up-regulated by using miRNA analogues, and miR-NC is used as a control to observe whether the differentiation of neural stem cells changes.

[0021] The specific embodiments of the present application use various ways to give the object: injection of miR-652-3p analogues, injection of lentivirus carrying miR-652-3p analogues, injection of liposome-coated miR-652-3p analogues, etc.

[0022] Example 1

[0023] The application of a miR-652-3p in the preparation of a drug for promoting the differentiation of neural stem cells into neurons, wherein the nucleotide sequence of the miR-652-3p is SEQ ID NO. 1: AAUGGCGCCACUAGGGUUGUG.

[0024] The isolation, culture and differentiation system of primary neural stem cells, and the specific steps are as follows:

[0025] The first step, the isolation and culture of primary neural stem cells: the hippocampus of E14.5-day-old embryonic SD rats (purchased from Nantong University Experimental Animal Center) was taken, repeatedly blown and centrifuged, resuspended with neural stem cell culture solution (DMEM / F12+B27+EGF+bFGF+double antibody), filtered with a 40-micron filter, and seeded into a culture flask, recorded as P0, and after 5-7 days of growth into neurospheres, passaged, digested with 0.25% trypsin at 37 degrees Celsius for 4-5 minutes, added with 5-7 milliliters of termination solution (DMEM / F12+10% fetal bovine serum+double antibody), repeatedly blown and centrifuged, resuspended with neural stem cell culture solution, seeded into a culture flask, recorded as P1, and after 5-7 days of culture, passaged and subjected to subsequent experiments;

[0026] The second step, the differentiation system: P1 generation of neural stem cells was digested with 0.25% trypsin at 37 degrees Celsius for 4-5 minutes, added with 5-7 milliliters of termination solution (DMEM / F12+10% fetal bovine serum+double antibody), repeatedly blown and centrifuged, resuspended with neural stem cell differentiation solution (DMEM / F12+B27+10% fetal bovine serum+double antibody), filtered with a 40-micron filter, and the cells were seeded;

[0027] The third step, MiRNA analog transfection: MiRNA analogs were from Guangzhou Ribo Company, and cell transfection utilized Lipofectamine RNAiMAX transfection reagent from Invitrogen, and the transfection steps were operated according to the instructions, and the concentration of miRNA analogs was 20 nanomoles;

[0028] The fourth step, differentiation detection: real-time quantitative PCR, Western blot, immunofluorescence, flow cytometry, etc. were used to detect cell differentiation marker molecules, and the specific steps were as follows:

[0029] Step 1, Real-time quantitative PCR detection of cell differentiation marker molecules: 6-well plate cells were extracted with Trizol method 24 hours after miRNA analog transfection, RNA concentration and purity were determined with NanoDrop 2000, reverse transcription into cDNA was performed with a reverse transcription kit (Thermo Corporation), and real-time quantitative PCR detection was performed with SYBR Green Master Mix (Roche Corporation). The primers are as follows: Neuronal differentiation 1 (Neurod1) - forward primer as SEQ ID NO. 2: 5'-CAGGGTTATGAGATCGTCACTATTC-3', Neurod1 - reverse primer as SEQ ID NO. 3: 5'-CCTTCTTGTCTGCCTCGTGTTCC-3'; SynapsinI (Syn1) - forward primer as SEQ ID NO. 4: 5'-CCTCATTCGTGCTGCCTGTGGTA-3', Syn1 - reverse primer as SEQ ID NO. 5: 5'-CTGGGCCTTTGCTTGTTTATTTT-3'; Stathmin2 (Stmn2) - forward primer as SEQ ID NO. 6: 5'-CACTTGGAGACTGTGAGCTGGTT-3', Stmn2 - reverse primer as SEQ ID NO. 7: 5'-ATTGCCCTATGGGAATGAAA-3'; Microtubule-associated protein 2 (Map2) - forward primer as SEQ ID NO. 8: 5'-CTTGATTCTATTGCCCTTGGGTTTA-3', Map2 - reverse primer as SEQ ID NO. 9: 5'-CATCCATCGTTCCGCTAGTGTTG-3'; Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) - forward primer as SEQ ID NO. 10: 5'-CCACGGCAAGTTCAACGGCACAG-3'; Gapdh - reverse primer as SEQ ID NO. 11: 5'-GACGCCAGTAGACTCCACGACAT-3'; wherein Neurod1, Syn1, Stmn2 and Map2 are neuronal marker molecules, and Gapdh is an internal reference;

[0030] As shown in Figure 1 , the miR-652-3p analog can significantly increase the expression of neuronal marker molecules, i.e., can promote the differentiation of neural stem cells into neurons;

[0031] Step 2, Western blotting detection of cell differentiation marker molecules: 100 mm dish cells were lysed with RIPA lysis buffer (plus protease inhibitor PMSF) 24 hours after miRNA mimic transfection, ultrasonicated, centrifuged to take supernatant, and protein concentration was determined. SDS-polyacrylamide gel was prepared, equal amount of protein sample (15 μg) was added to each well, electrophoresis was carried out at 180 volts constant voltage, after the end of gel running, membrane was transferred, 25 volts, 2.5 mA, for 7 minutes. The membrane was washed with TBST for 3 times, 5% skim milk was blocked at room temperature for 2 hours, the first antibody was incubated at 4 degrees overnight. The next day, TBST was washed for 3 times, the horseradish peroxidase-labeled secondary antibody was incubated at room temperature for 2 hours, TBST was washed for 3 times, ECL was developed, and the image was collected by Chemidoc XPS system, and the gray value was analyzed by Quantity One software. The first antibody was as follows: anti-Tuj1 antibody (1:1000, Abeam Company), anti-β-actin antibody (1:1000, Sigma Company). Among them, Tuj1 is a neuronal marker molecule. As shown in Figure 2 As shown in Fig. 2A, the miR-652-3p mimic can significantly increase the expression of neuronal marker molecules, i.e., promote the differentiation of neural stem cells into neurons;

[0032] Step 3, immunofluorescence detection of cell differentiation marker molecules: 24-well plate cells were washed with DPBS for 3 times 4 days after miRNA mimic transfection, fixed with 4% paraformaldehyde for 20 minutes, washed with 0.1% BSA-PBS for 3 times, added with membrane-breaking blocking solution (PBS+goat serum+Triton X-100+BSA), and incubated at room temperature for 2 hours. The first antibody was incubated at 4 degrees overnight. The next day, 0.1% BSA-PBS was washed for 3 times, the fluorescent secondary antibody was incubated at room temperature for 2 hours in the dark, 0.1% BSA-PBS was washed for 3 times, Hoechst (1:1000) was used to stain the nucleus at room temperature for 10 minutes in the dark, 0.1% BSA-PBS was washed for 3 times, and the slice was sealed. Zeiss fluorescence microscope was used for imaging. The first antibody was anti-Tuj1 antibody (1:1000, Abeam Company), and Tuj1 is a neuronal marker molecule. As shown in Figure 2 As shown in Fig. 2B, the miR-652-3p mimic can significantly increase the proportion of Tuj1 positive cells, i.e., promote the differentiation of neural stem cells into neurons;

[0033] Step 4, Flow cytometry detection of cell differentiation marker: 100 mm dish cells were collected on the fourth day after miRNA mimic transfection, washed twice with pre-cooled PBS, fixed in lx Fix / Perm Buffer working solution at 4°C for 50 minutes, washed twice with lx Perm / Wash buffer, 100 μl of lx Perm / Wash buffer was added to the cell sample, and the APC-coupled anti-Tujl antibody (BD Biosciences) was incubated at 4°C for 50 minutes, washed twice with lx Perm / Wash buffer, resuspended with 350 μl of staining buffer, and detected by flow cytometry (BD Biosciences).

[0034] As shown in Figure 2 As shown in FIG. 6C, the miR-652-3p mimic can significantly increase the proportion of Tujl positive cells, i.e., promote the differentiation of neural stem cells into neurons.

Claims

1. Use of miR-652-3p in the preparation of a medicament for promoting differentiation of neural stem cells into neurons, characterized in that: The nucleotide sequence of the miR-652-3p is SEQ ID NO. 1: AAUGGCGCCACUAGGGUUGUG.

2. The use of miR-652-3p according to claim 1 for the preparation of a medicament for promoting the differentiation of neural stem cells into neurons, characterized in that: The medicine comprises miR-652-3p and pharmaceutically acceptable adjuvants.

3. The use of miR-652-3p according to claim 2 for the preparation of a medicament for promoting the differentiation of neural stem cells into neurons, characterized in that: The adjuvant is one or several of diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers, lubricants.

4. The use of miR-652-3p according to claim 2 for the preparation of a medicament for promoting the differentiation of neural stem cells into neurons, characterized in that: The medicine is oral or non-oral.

5. The use of miR-652-3p according to claim 2 for the preparation of a medicament for promoting the differentiation of neural stem cells into neurons, characterized in that: The medicine is tablets, capsules, powders, pills, granules, solutions, suspensions, syrups, injections, suppositories, adsorbents or sprays.

Images