Application of nano-micelle based on functional nucleic acid in targeted protein degradation

Abstract

The invention relates to application of a nano-micelle based on functional nucleic acid in targeted protein degradation. Specifically, the invention provides a nucleic acid aptamer-connexon-lipid nanostructure, constructs editable universal platforms respectively utilizing two degradation systems of lysosome and ubiquitin-proteasome, and is respectively used for degradation of membrane protein and cytoplasm protein. A new thought is provided for avoiding the problems of degradation system overload and safety possibly caused by a single degradation path in traditional targeted protein degradation, and technical support is provided for treatment of diseases such as tumors.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to the application of nanomicelles based on functional nucleic acids in targeted protein degradation. BACKGROUND

[0002] Targeted protein degradation technology based on protein degradation system is an emerging drug discovery and treatment strategy, which can target proteins that are traditionally considered undruggable, greatly expanding the range of protein target drugs. The protein degradation system in cells mainly includes ubiquitin-proteasome system and lysosomal degradation system.

[0003] The first developed targeted protein degradation molecule is Proteolysis Targeting Chimeras (PROTAC) based on ubiquitin-proteasome system. PROTAC is also the fastest developing molecule in the current targeted protein degradation technology, mainly composed of three parts, including ligand binding to the target protein, ligand recruiting E3 ubiquitin ligase and flexible linker. PROTAC forms a ternary complex by binding the target protein and E3 ubiquitin ligase, thereby inducing ubiquitination of the target protein and degrading it through the UPS pathway.

[0004] Other targeted protein degradation technologies using ubiquitin-proteasome system have also been developed, such as molecular glue that promotes the interaction between E3 ubiquitin ligase and target protein, dual mechanism small molecule degraders that combine the advantages of PROTAC and molecular glue, Trim-Away technology that uses ubiquitin ligase TRIM21 to recognize antibody Fc region to degrade antibody binding target protein, etc.

[0005] At the same time, targeted protein degradation technologies using lysosomal degradation system have also emerged, such as lysosome targeting chimeras that mediate the internalization of extracellular proteins or cell membrane proteins through endocytosis and degrade them through the lysosomal pathway, autophagy targeting chimeras, etc.

[0006] Major diseases such as tumors and neurodegenerative diseases have target proteins that are complex, diverse and different in location (membrane proteins, cytoplasmic proteins). In recent years, although targeted protein degradation technology has shown great potential, it still faces some problems, including the large molecular weight of antibody-based targeted protein degradation molecules, high difficulty in synthesis, difficulty in editing, low targeting and delivery efficiency, limitations of E3 ubiquitin ligase, limitations of pre-modification of target proteins, and difficulty in simultaneous degradation of membrane proteins and cytoplasmic proteins. At the same time, due to the lack of molecular tools and the limitations of the understanding of the interaction of different degradation systems in cells, the current targeted protein degradation technology mainly relies on a single protein degradation system to target and degrade membrane proteins or cytoplasmic proteins, which may cause overload of the specific degradation system and related side effects, and affect the application in diseases with abnormal degradation systems (such as aging, neurodegenerative diseases, etc.).

[0007] Aptamer is a kind of oligonucleotide sequence with specificity and high affinity to target such as protein, which is obtained by in vitro screening method of SELEX (Systematic Evolution of Ligands by Exponential Enrichment). Theoretically, the range of target can be expanded to all proteins. Compared with traditional antibodies, aptamer has more flexible structure, small molecular weight, low immunogenicity, easy editing, chemical synthesis in vitro and low cost. Therefore, aptamer has unique advantages in the field of targeted protein degradation, but the stability, affinity and delivery efficiency of aptamer still need to be improved.

[0008] Therefore, there is an urgent need in the art to develop an effective and safe universal method for targeted degradation of membrane proteins and cytoplasmic proteins based on aptamer. SUMMARY

[0009] The purpose of the present application is to provide a universal platform for targeted degradation of membrane proteins or cytoplasmic proteins based on functional nucleic acid such as aptamer.

[0010] In the first aspect of the present application, a functional nucleic acid-lipid nanomicelle is provided, the nanomicelle comprising a plurality of nanomicelle monomers, the nanomicelle monomers comprising: (a) a targeting nucleic acid, (b) a lipid molecule, (c) a linker connecting the nucleic acid and the lipid, and optionally comprising (d) a functional peptide connected to the nucleic acid; the nanomicelle specifically targets and degrades membrane proteins and / or cytoplasmic proteins.

[0011] In another preferred embodiment, the nanomicelle monomer has a structure as shown in Formula I:

[0012] Z n -L-A-P (Formula I)

[0013] In the formula,

[0014] Z is a lipid molecule;

[0015] The subscript n is the number of lipid molecules, n is 1, 2 or 3, preferably, n is 2;

[0016] L is a linker;

[0017] A is a targeting nucleic acid;

[0018] P is nothing or a functional peptide.

[0019] In another preferred embodiment, Z is a straight chain fatty acid chain.

[0020] In another preferred embodiment, Z is a C6-C20 fatty acid chain, preferably a C18 fatty acid chain.

[0021] In another preferred embodiment, A is a nucleic acid aptamer.

[0022] In another preferred embodiment, A is a modified or unmodified nucleic acid aptamer.

[0023] In another preferred embodiment, A is a nucleic acid aptamer with 5' and 3' end extension, each end extended by 1-20 nt, preferably 1-8 nt.

[0024] In another preferred embodiment, the 5' and 3' end sequences of A are complementary to each other, forming a stem structure, the complementarity being complete or substantial.

[0025] In another preferred embodiment, the stem structure is 6-20 bp in length, preferably 7-15 bp, more preferably 8-12 bp.

[0026] In another preferred embodiment, the 3' end of A is linked with a -DBCO group.

[0027] In another preferred embodiment, A targets a protein selected from the group consisting of a membrane protein, a cytoplasmic protein, or a combination thereof.

[0028] In another preferred embodiment, the membrane protein is selected from the group consisting of c-MET, PTK7, EGFR, PD-L1, EpCAM, FGFR2, or a combination thereof.

[0029] In another preferred embodiment, the cytoplasmic protein is selected from the group consisting of Tau, RelA, NCL, AR (androgen receptor), E2F1, or a combination thereof.

[0030] In another preferred embodiment, A targets c-Met, the sequence of A being shown in SEQ ID NO: 2.

[0031] In another preferred embodiment, A targets PTK7, the sequence of A being shown in SEQ ID NO: 3.

[0032] In another preferred embodiment, A targets Tau, the sequence of said A is set forth in SEQ ID NO: 4 or SEQ ID NO: 8.

[0033] In another preferred embodiment, A targets RelA, the sequence of said A is set forth in SEQ ID NO: 6 or SEQ ID NO: 9.

[0034] In another preferred embodiment, L comprises a trunk portion and a branch portion.

[0035] In another preferred embodiment, said trunk portion is covalently linked to the 5' end of the aptamer.

[0036] In another preferred embodiment, each branch of said branch portion is a carbon chain containing an amide bond.

[0037] In another preferred embodiment, each branch of said branch portion contains 4-8 C and one amide bond, preferably, each branch of said branch portion contains 6 C and one amide bond.

[0038] In another preferred embodiment, each end of each branch of said branch portion is linked to said lipid molecule.

[0039] In another preferred embodiment, said L has a chemical formula as set forth in Formula V:

[0040]

[0041] wherein a and b are the sites for linking to said lipid molecule.

[0042] In another preferred embodiment, P is absent when said nanomicelle targets a membrane protein.

[0043] In another preferred embodiment, P is a functional peptide when said nanomicelle targets a cytosolic protein.

[0044] In another preferred embodiment, said functional peptide comprises a targeting peptide and a cell-penetrating peptide.

[0045] In another preferred embodiment, said targeting peptide is a ligand targeting E3 ubiquitin ligase VHL.

[0046] In another preferred embodiment, said cell-penetrating peptide contains 8 arginines.

[0047] In another preferred embodiment, the N-terminus of said functional peptide optionally comprises a GS linker peptide.

[0048] In another preferred embodiment, the sequence of said functional peptide is GSGSALAPYIPRRRRRRRR (SEQ ID NO: 1).

[0049] In another preferred embodiment, the N-terminus of the functional peptide is connected with a -N3 group.

[0050] In another preferred embodiment, the functional peptide is connected to the 3' end of A by reacting the -N3 group of the functional peptide with the -DBCO group of A.

[0051] In another preferred embodiment, the monomers self-assemble to form the nanomicelle.

[0052] In another preferred embodiment, the nanomicelle has a particle size of 10-200 nm, preferably 20-100 nm, and more preferably 30-60 nm.

[0053] In another preferred embodiment, the nanomicelle does not contain a functional peptide, the nanomicelle targets a target membrane protein, and has a function of transporting the target membrane protein into a lysosome for degradation.

[0054] In another preferred embodiment, the nanomicelle contains a functional peptide, the nanomicelle targets a target cytoplasmic protein, and has a function of ubiquitinating and degrading the target cytoplasmic protein through a proteasome.

[0055] In another preferred embodiment, the nanomicelle degrades the target membrane protein or cytoplasmic protein within 6 hours, preferably within 3 hours.

[0056] In a second aspect of the present application, a targeting nucleic acid-functional peptide chimera is provided, the targeting nucleic acid targets a cytoplasmic protein, the functional peptide targets a ubiquitinase, and the targeting nucleic acid and the functional peptide are connected by a linker; the chimera targets and degrades the cytoplasmic protein.

[0057] In another preferred embodiment, the targeting nucleic acid is a nucleic acid aptamer.

[0058] In another preferred embodiment, the targeting nucleic acid is a nucleic acid aptamer targeting Tau or RelA.

[0059] In another preferred embodiment, the functional peptide has a structure as shown in Formula II:

[0060] P1-P2-P3 (Formula II)

[0061] In the formula,

[0062] P1 is a connecting peptide;

[0063] P2 is a ligand targeting a ubiquitinase;

[0064] P3 is a cell-penetrating peptide;

[0065] In another preferred embodiment, the ubiquitinase is E3 ubiquitinase VHL.

[0066] In another preferred embodiment, the connecting peptide is a glycine and serine containing connecting peptide

[0067] In another preferred embodiment, the connecting peptide sequence is GSGS.

[0068] In another preferred embodiment, the transmembrane peptide contains 8 arginines.

[0069] In another preferred embodiment, the sequence of the functional peptide is GSGSALAPYIPRRRRRRRR (SEQ ID NO: 1).

[0070] In a third aspect of the present application, there is provided a method for preparing the functional nucleic acid-lipid nanomicelle as described in the first aspect of the present application, comprising steps of:

[0071] (a) providing a nanomicelle monomer;

[0072] (b) self-assembling the nanomicelle monomer to form the functional nucleic acid-lipid nanomicelle.

[0073] In another preferred embodiment, the method for synthesizing the functional nucleic acid-lipid nanomicelle in step (a) is a solid-phase synthesis one-step method.

[0074] In another preferred embodiment, the nanomicelle monomer is synthesized by the following steps: sequentially connecting the nucleic acid aptamer, the linker and the lipid molecule by using a solid-phase phosphoramidite triester method to obtain the nanomicelle monomer.

[0075] In another preferred embodiment, the nucleic acid aptamer is further connected with a functional peptide having the functions of targeting ubiquitinase and transmembrane.

[0076] In another preferred embodiment, in step (b), the nanomicelle monomer is self-assembled in an aqueous solution to form the nanomicelle.

[0077] In a fourth aspect of the present application, there is provided a use of the functional nucleic acid-lipid nanomicelle as described in the first aspect of the present application for preparing a drug for targeted degradation of a target membrane protein or a target cytoplasmic protein.

[0078] In another preferred embodiment, the target membrane protein is selected from the group consisting of c-MET, PTK7, or a combination thereof.

[0079] In another preferred embodiment, the target cytoplasmic protein is selected from the group consisting of Tau, RelA, or a combination thereof.

[0080] In another preferred embodiment, the nanomicelle does not contain a functional peptide, and the nanomicelle is used for preparing a drug for targeted degradation of a target membrane protein.

[0081] In another preferred embodiment, the nanomicelle contains a functional peptide, and the nanomicelle is used for preparing a drug for targeted degradation of a target cytosolic protein.

[0082] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described hereinafter (e.g., in the examples) can be combined with each other to form a new or preferred technical solution. Due to the limited space, they are not listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0083] Figure 1 The synthesis of the membrane protein-targeting aptamer-L-lipid micelle is shown in (A), the agarose gel electrophoresis analysis is shown in (B), and the dynamic light scattering (DLS) particle size analysis is shown in (C).

[0084] Figure 2 The synthesis of the aptamer-L-VHL ligand short peptide-PROTAC structure is shown in (A), and the non-denaturing polyacrylamide gel electrophoresis analysis is shown in (B).

[0085] Figure 3 The synthesis of the cytosolic protein-targeting aptamer-L-lipid micelle is shown in (A), the agarose gel electrophoresis analysis is shown in (B), and the dynamic light scattering (DLS) particle size analysis is shown in (C).

[0086] Figure 4 The target protein binding ability analysis of the membrane protein-targeting aptamer-L-lipid micelle is shown in (A), the cell entry ability analysis is shown in (B), and the lysosome co-localization analysis is shown in (C).

[0087] Figure 5 The target protein binding ability analysis of the cytosolic protein-targeting aptamer-L-lipid micelle-PROTAC structure is shown in (A), the cell entry ability analysis is shown in (B), and the lysosome co-localization analysis is shown in (C).

[0088] Figure 6 The western analysis of the membrane protein-targeting aptamer-L-lipid micelle on the degradation ability of cell membrane proteins (c-MET or PTK7) is shown in (A) and (B), the immunofluorescence analysis is shown in (C), the target protein signaling pathway analysis and cell activity determination are shown in (D) and (F).

[0089] Figure 7 The western analysis of the cytosolic protein-targeting aptamer-L-lipid micelle without the PROTAC structure, the cytosolic protein-targeting aptamer-L-lipid micelle with the PROTAC structure, and the aptamer-L-VHL ligand short peptide-PROTAC structure on the degradation ability of cytosolic proteins is shown in (A), (B), and (C), the immunofluorescence analysis is shown in (D), the signaling pathway protein analysis and cell activity determination are shown in (E) and (F).

[0090] Figure 8 The mechanism analysis of nucleic acid aptamer-L-lipid micelles degrading membrane proteins (A) and cytoplasmic proteins (B and C) is shown. DETAILED DESCRIPTION

[0091] Through extensive and in-depth research, the inventors have innovatively provided nucleic acid aptamer-lipid nanostructures, which construct an editable universal platform for utilizing two degradation systems of lysosome and ubiquitin-proteasome, respectively, for degrading membrane proteins and cytoplasmic proteins. Specifically, the present application provides a nanomicelle targeting membrane proteins, which is formed by self-assembly of monomers of nucleic acid aptamer and lipid molecules connected by a linker, can specifically target the target membrane proteins, and degrade the target membrane proteins through the lysosome pathway; the present application also provides a nanomicelle targeting cytoplasmic proteins, which connects a functional peptide on the nucleic acid aptamer, and degrades the target cytoplasmic proteins through the ubiquitin-proteasome pathway after specifically binding to the target cytoplasmic proteins. The present application is completed on this basis.

[0092] Monomer of nanomicelle targeting membrane proteins

[0093] In the present application, a monomer of nanomicelle targeting membrane proteins is provided, which is an amphiphilic molecule composed of a hydrophilic functional nucleic acid and a hydrophobic lipid, and the functional nucleic acid and the lipid are connected by a linker containing a branch structure. The functional nucleic acid has the function of specifically targeting membrane proteins.

[0094] In an embodiment of the present application, the targeting functional nucleic acid is a nucleic acid aptamer. Generally, the 5' end and the 3' end of the nucleic acid aptamer can base-pair to form a stem structure. In the present application, the nucleic acid aptamer is modified to extend its 5' end and 3' end to form a longer and more stable stem structure for connecting with the linker and enhancing the stability of the nucleic acid aptamer. Preferably, the length of the stem structure is 6-20 bp, more preferably 7-15 bp.

[0095] In an embodiment of the present application, a nucleic acid aptamer targeting c-Met protein is provided, which extends its two ends by 3 bases each to form a stem structure with a length of 11 bp, and the sequence of the nucleic acid aptamer targeting c-Met protein is shown as SEQ ID NO: 2; the present application also provides a nucleic acid aptamer targeting PTK-7, which extends its 5' end by 2 bases and its 3' end by 3 bases to form a stem structure with a length of 8 bp, and the sequence of the nucleic acid aptamer targeting PTK-7 protein is shown as SEQ ID NO: 3.

[0096] Sequence of nucleic acid aptamer targeting c-Met in micelles (SEQ ID NO: 2):

[0097] 5'-AGAATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT TCT-3'

[0098] The nucleic acid aptamer sequence targeting PTK7-stem in the micelle (SEQ ID NO: 3):

[0099] 5'-AG ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT TCT-3'

[0100] In which, the bold part is stem structure, and the underlined part is the structure of the nucleic acid aptamer before elongation.

[0101] In the present application, the nucleic acid aptamer is connected with a lipid molecule. The lipid molecule used in the present application is a straight-chain fatty acid chain, preferably a C6-C20 fatty acid chain. In one embodiment of the present application, two C18 fatty acid chains are used to connect with one nucleic acid aptamer.

[0102] The nucleic acid aptamer and the lipid molecule of the present application are connected through a linker with a branched structure. One end of the trunk of the linker is covalently connected with the 5' end of the nucleic acid aptamer, and the two branches of the linker are each connected with a C18 chain. In one embodiment of the present application, the chemical structure of the linker is shown in the following formula V, in which the right side is two branched structures, each being a carbon chain containing an amide bond, and the a and b sites are the sites for connecting the lipid molecules; the left side is the trunk structure.

[0103]

[0104] The present application also provides a method for preparing the nanomicelle monomer of the present application. After introducing the linker with two branched structures at the end of the nucleic acid aptamer, each of which is connected with a C18 fatty acid chain, the nanomicelle monomer of the present application can be synthesized by using the solid-phase phosphoramidite method in one step, and the synthesis method is simple and easy to operate.

[0105] Nanomicelle targeting membrane protein

[0106] As used herein, the terms "nanomicelle targeting membrane protein", "nucleic acid aptamer-L-lipid micelle targeting membrane protein" can be used interchangeably, and all refer to the nanomicelle formed by self-assembly of the nanomicelle monomer targeting membrane protein of the present application. The particle size of the nanomicelle of the present application is 10-200 nm, preferably 20-100 nm, and more preferably 30-60 nm.

[0107] The nucleic acid aptamer in the nanomicelle of the present application has the function of specifically targeting a specific membrane protein. When the nanomicelle of the present application specifically binds to the target membrane protein, endocytosis occurs on the cell membrane, and the nanomicelle and the target membrane protein are wrapped together to form an endosome, which is then degraded by lysosomes.

[0108] In one embodiment of the present application, a nanomicelle targeting c-Met protein is provided. The c-Met protein, also known as hepatocyte growth factor receptor (HGFR), is a membrane-bound tyrosine kinase receptor. It is encoded by the proto-oncogene c-met and plays an important role in many biological processes, including cell proliferation, differentiation, migration, and morphogenesis. Its main ligand is hepatocyte growth factor (HGF), which activates the tyrosine kinase activity of c-Met when it binds to c-Met, triggering a series of signal transduction pathways. The c-Met protein is found to be overexpressed or mutated in many types of cancer, which is often closely related to tumor occurrence, development, invasion, and metastasis. The c-Met-targeting nanomicelle of the present application can specifically degrade the c-Met protein on the membrane protein, significantly reducing the phosphorylation level of the Met protein, thereby inhibiting the activity of tumor cells.

[0109] In one embodiment of the present application, a nanomicelle targeting PTK-7 protein is provided. PTK-7 (Protein Tyrosine Kinase 7) is a membrane-bound tyrosine kinase receptor belonging to the tyrosine kinase receptor family and plays a role in various biological processes. It is involved in the regulation of neural cell growth, differentiation, migration, and synaptic formation and function. Current research has found that PTK-7 is abnormally expressed in some types of cancer and is related to tumor occurrence, development, and metastasis. The PTK-7-targeting nanomicelle of the present application can specifically degrade the PTK-7 protein on the membrane protein.

[0110] The membrane protein-targeting nanomicelle of the present application can rapidly degrade the target membrane protein. Experiments have shown that the nanomicelle of the present application can degrade the membrane protein within 3 hours, with high degradation efficiency and a significant concentration gradient. The membrane protein-targeting nanomicelle of the present application can be used for the development of drugs for membrane protein-related diseases.

[0111] Targeting nucleic acid-functional peptide chimera of the present application

[0112] In the present application, a targeting nucleic acid-functional peptide chimera, i.e., a PROTAC chimera targeting cytoplasmic proteins, is also provided, which is connected by a nucleic acid aptamer and a functional peptide. The functional peptide includes a connecting portion, a targeting portion, and a membrane-penetrating portion. The connecting portion is a GS-containing connecting peptide, the targeting portion is a ligand targeting ubiquitinase, and the membrane-penetrating portion is an 8-arginine-containing membrane-penetrating peptide. Experiments have shown that the chimera of the present application can effectively target the target cytoplasmic protein and degrade the target protein through the ubiquitin-proteasome pathway.

[0113] In an embodiment of the present application, a chimeric body targeting Tau protein is prepared, wherein the sequence of the aptamer part is shown as SEQ ID NO: 4. In an embodiment of the present application, a chimeric body targeting RelA protein is prepared, wherein the sequence of the aptamer part is shown as SEQ ID NO: 6.

[0114] Aptamer sequence targeting Tau in PROTAC (SEQ ID NO: 4):

[0115] 5'-CTA ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT TAG-DBCO-3'

[0116] Aptamer sequence targeting RelA in PROTAC (SEQ ID NO: 6):

[0117] 5'-AGTCA ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT CTGACT-DBCO-3'

[0118] wherein the bold part is the stem structure, and the underlined part is the structure of the aptamer before elongation.

[0119] In an embodiment of the present application, the sequence of the functional peptide is GSGSALAPYIPRRRRRRRR (SEQ ID NO: 1), wherein the 1st to 4th are the connecting part, the 5th to 11th are the ligand short peptide targeting E3 ubiquitinase VHL, and the 12th to 19th are the cell-penetrating part. The structural diagram of an exemplary chimeric body is shown as Figure 2 A. The 3' end of the aptamer is connected with a -DBCO group; the N end of the functional peptide is connected with a -N3 azido group, and the aptamer and the functional peptide are connected through a click chemistry reaction.

[0120] Nanomicelle monomer targeting cytoplasmic protein

[0121] On the basis of the PROTAC chimeric body targeting cytoplasmic protein, a linker with a branched structure is used to connect the chimeric body with a lipid molecule, to obtain the nanomicelle monomer targeting cytoplasmic protein of the present application. The structure of the linker and the lipid molecule is the same as that in the nanomicelle monomer targeting membrane protein. Compared with the PROTAC chimeric body, the nanomicelle and its monomer have further improved abilities of cell entry, target protein binding and degradation.

[0122] In one embodiment of the present application, a nanomicelle monomer targeting Tau protein is provided, wherein the nucleic acid aptamer sequence is shown as SEQ ID NO: 8, both ends of which are elongated, and the 3' end of the nucleic acid aptamer is further elongated by 2 non-complementary bases, and the 3' end is connected with a -DBCO group; forming a stem structure of (12bp+2nt) long. In one embodiment of the present application, a nanomicelle monomer targeting RelA protein is provided, wherein the nucleic acid aptamer sequence is shown as SEQ ID NO: 9, both ends of which are elongated, forming a stem structure of (11bp+2nt) long.

[0123] Tau-stem in micelle (SEQ ID NO: 8):

[0124] 5'-AGACTA ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT TAGTCTTT-DBCO-3'

[0125] RelA-stem in micelle (SEQ ID NO: 9):

[0126] 5'-AGAAGTCA ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT CTGACTTCTTT-DBCO-3'

[0127] wherein the bold part is the stem structure, and the underlined part is the structure of the nucleic acid aptamer before elongation.

[0128] The nanomicelle monomer targeting cytosolic protein of the present application is synthesized by introducing a linker with two branches at the end of the nucleic acid aptamer with functional peptide using solid-phase phosphoramidite triester method, and connecting one C18 lipid chain to each branch of the linker, using one-step method.

[0129] Nanomicelle targeting cytosolic protein

[0130] As used herein, the terms "nanomicelle targeting cytosolic protein" and "nucleic acid aptamer-L-lipid micelle targeting cytosolic protein" can be used interchangeably, and both refer to the nanomicelle formed by self-assembly of the nanomicelle monomer targeting cytosolic protein of the present application.

[0131] The nucleic acid aptamer in the nanomicelle targeting cytosolic protein of the present application has the function of specifically targeting a specific membrane protein, wherein the functional peptide can pass through the cell membrane and target E3 ubiquitinase. When the nanomicelle of the present application specifically binds to the target cytosolic protein, the target cytosolic protein is labeled with ubiquitin, and then degraded by proteasome.

[0132] In one embodiment of the present application, a nanomicelle targeting Tau protein is provided. Tau protein is a microtubule-associated protein (MAP) mainly expressed in neuronal axons, which binds to microtubules and is involved in maintaining the stability of microtubules and promoting axon formation and material transport. Tau protein has multiple phosphorylation sites, and its phosphorylation state affects its binding ability to microtubules. Abnormal Tau protein phosphorylation is associated with various neurological diseases, such as Alzheimer's disease and frontotemporal dementia. In these diseases, abnormally phosphorylated Tau protein aggregates to form fibrous structures, leading to nerve cell dysfunction and death. The nanomicelle targeting Tau protein of the present application can significantly reduce the phosphorylation level of Tau protein and improve the activity of cells with overexpression of Tau.

[0133] In one embodiment of the present application, a nanomicelle targeting RelA protein is provided. RelA protein, also known as NF-κB p65, is an important member of the Nuclear Factor-κB (NF-κB) family. NF-κB is a transcription factor that plays a role in regulating gene expression in cells, and is involved in various biological processes, such as immune response, inflammatory response, cell proliferation and apoptosis, etc. Under normal circumstances, the NF-κB complex is inhibited by IκB protein and remains in the cytoplasm. When the cell is stimulated (such as infection, inflammation, oxidative stress, etc.), IκB protein is phosphorylated and degraded, releasing the NF-κB complex into the nucleus, regulating the expression of related genes. NF-κB is highly expressed in some tumor cells. The nanomicelle targeting RelA protein of the present application can significantly reduce the level of RelA protein and inhibit the activity of tumor cells.

[0134] The nanomicelle targeting cytoplasmic protein of the present application can rapidly degrade the target cytoplasmic protein. Experiments have shown that the nanomicelle of the present application can degrade cytoplasmic protein within 3 hours, with high degradation efficiency and a significant concentration gradient. The nanomicelle targeting membrane protein of the present application can be used for the development of drugs for cytoplasmic protein-related diseases.

[0135] The main advantages of the present application include:

[0136] (1) The nucleic acid aptamer-L-lipid micelle of the present application can serve as a universal platform, and by selecting appropriate nucleic acid aptamers, it can target a variety of membrane proteins or cytoplasmic proteins, and is suitable for targeted degradation of a variety of target proteins.

[0137] (2) The nucleic acid aptamer-L-lipid micelle targeting membrane protein of the present application has the function of specifically targeting lysosomes, and effectively degrades membrane proteins through the lysosomal pathway.

[0138] (3) The nucleic acid aptamer-L-lipid micelles of the present application targeting cytoplasmic proteins do not enter lysosomes, can directly enter the cytoplasm, thereby binding to target proteins in the cytoplasm, and then degrading cytoplasmic proteins through the ubiquitin-proteasome pathway.

[0139] (4) The nucleic acid aptamer-L-VHL ligand short peptide PROTAC structure of the present application has good cell entry ability and cytoplasmic protein degradation ability; the nucleic acid aptamer-L-lipid micelles formed after adding a lipid chain can further enhance the protein degradation ability and cell entry ability of the corresponding PROTAC structure.

[0140] (5) The nucleic acid aptamer-L-lipid micelles of the present application can specifically degrade target proteins and are very rapid (within 6 hours).

[0141] (6) The amphiphilic molecules developed based on functional nucleic acid structures and lipids can be produced on a large scale and stored for a long time, can realize precise editing and modification, have better targeting, cell entry ability and degradation ability, and have small immunogenicity and good tissue permeability.

[0142] (7) The nucleic acid aptamer-L-lipid universal platform in the present application accelerates the drug development of drugs targeting specific proteins and can be used for physiological regulation and disease treatment.

[0143] (8) The method for preparing nucleic acid aptamer-L-lipid micelles of the present application has simple preparation conditions and steps, is easy to operate and artificially modify, and has the prospect of industrial synthesis.

[0144] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and are not used to limit the scope of the present application. The experimental methods in the following examples, if not specified, are generally carried out according to conventional conditions, for example, the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and fractions are weight percentages and weight fractions.

[0145] Example 1: Synthesis and identification of nucleic acid aptamer-L-lipid micelles targeting membrane proteins

[0146] The following elements were connected by solid-phase phosphoramidite triester method: nucleic acid aptamer targeting membrane protein c-Met or PTK7, linker and 2 C18 lipid chains to obtain membrane protein targeting nucleic acid aptamer-L-lipid micelle monomers.

[0147] The synthesized nucleic acid aptamer-L-lipid amphiphilic molecules self-assemble into micelle structures in aqueous solution by gun head blowing, and the structural schematic diagram is as followsFigure 1 A. Among them, the nucleic acid aptamer-L-lipid micelles targeting c-Met are named Met-aptamer-Micelle (Met-apt-Mic for short); the nucleic acid aptamer-L-lipid micelles targeting PTK7 are named PTK7-aptamer-Micelle (PTK7-apt-Mic for short).

[0148] The formation of nucleic acid aptamer-L-lipid micelles was determined by agarose gel electrophoresis analysis, and the results are shown in Figure 1 B. The results show that the two kinds of nano-micelles Met-apt-Mic and PTK7-apt-Mic are successfully synthesized.

[0149] The particle size of the nano-micelles was analyzed by DLS, and the results are shown in Figure 1 C. The size of Met-apt-Mic is 42.09 nm, and the size of PTK7-apt-Mic is 38.59 nm.

[0150] Example 2: Synthesis and identification of PROTAC targeting cytoplasmic proteins

[0151] In order to make the nano-micelles have the ability to target cytoplasmic proteins, the 3' end of the nucleic acid aptamer targeting Tau or RelA protein was modified with a DBCO group, and was connected with a functional peptide targeting VHL (SEQ ID NO: 1) through click chemistry reaction, forming a nucleic acid aptamer-L-peptide PROTAC chimeric molecule targeting cytoplasmic proteins (schematic diagram as shown in Figure 2 A).

[0152] Among them, the nucleic acid aptamer targeting Tau is named LA aptamer, and the PROTAC chimeric molecule targeting Tau is named LA-Peptide (LAP); the mutant of LA aptamer not binding Tau is named LS aptamer (SEQ ID NO: 5), and the synthesized PROTAC molecule is named LS-Peptide (LSP). The nucleic acid aptamer targeting RelA is named RA aptamer, and the PROTAC chimeric molecule targeting RelA is named RA-Peptide (RAP); the mutant of RA aptamer not binding RelA is named RM aptamer (SEQ ID NO: 7), and the synthesized PROTAC molecule is named RM-Peptide (RMP).

[0153] The formation of the chimeric molecule was determined by non-denaturing polyacrylamide gel electrophoresis, and the results are shown in Figure 2 B. The results show that the nucleic acid aptamer-L-peptide PROTAC chimeric molecule is successfully synthesized.

[0154] Example 3: Synthesis and identification of nucleic acid aptamer-L-lipid micelles targeting cytoplasmic proteins

[0155] The micelle structure targeting cytoplasmic proteins was synthesized in the manner as in Example 1, and the nucleic acid aptamer targeting cytoplasmic proteins Tau or RelA, the linker and two C18 lipid chains were connected by the solid-phase phosphoramidite triester method.

[0156] The synthesized nucleic acid aptamer-L-lipid amphiphilic molecules self-assembled into micelle structures by gun head blowing in aqueous solution. Among them, the nucleic acid aptamer-L-lipid micelles targeting Tau were named LA-Micelle (LA-Mic), and the nucleic acid aptamer-L-lipid micelles targeting RelA were named RA-Micelle (RA-Mic).

[0157] During the solid-phase synthesis process, two unpaired bases were added to the 3' end of the nucleic acid aptamer, and the end was modified with a DBCO group. The short peptide targeting VHL (SEQ ID NO: 1) was connected by click chemistry reaction to form a nucleic acid-L-lipid micelle structure with a PROTAC chimera, and its schematic diagram is shown in Figure 3 A. Among them, the micelles with PROTAC chimera targeting Tau were named LA-Peptide-Micelle (LAP-Mic for short), and the micelles with PROTAC chimera targeting RelA were named RA-Peptide-Micelle (RAP-Mic for short).

[0158] The formation of micelles was determined by agarose gel electrophoresis analysis, and the results are shown in Figure 3 B. The results show that LAP-Mic and RAP-Mic micelles are successfully synthesized.

[0159] The micelle particle size was analyzed by DLS, and the results are shown in Figure 3 C. The size of LAP-Mic is 36.48 nm, and the size of RAP-Mic is 32.84 nm.

[0160] Example 4: Analysis of the binding ability of nucleic acid aptamer-L-lipid micelles targeting membrane proteins to target proteins, the ability to enter cells, and the lysosome co-localization situation

[0161] To detect the binding ability of the membrane protein targeting aptamer-L-lipid micelles to the cells expressing the target protein, 100 nM of the c-Met targeting aptamer-L-lipid micelles (Met-apt-Mic) or the PTK7 targeting aptamer-L-lipid micelles (PTK7-apt-Mic) were incubated with HeLa cells on ice for 30 min, and the binding ability was analyzed by cell flow cytometry. After 100 nM of the micelles were incubated with HeLa cells at 37°C for 4 h, the cell entry ability was analyzed by confocal experiment. After the micelles were incubated with HeLa cells at 37°C for 3 h, the lysosomes were stained for 30 min, and then the co-localization with the lysosomes was analyzed by laser confocal experiment.

[0162] The results of the detection of the binding ability are shown in Figure 4 As shown in FIG. A, the membrane protein targeting aptamer-L-lipid micelles have a significantly improved binding ability compared with the aptamer itself, and the improvement is about 2 orders of magnitude.

[0163] The results of the detection of the cell entry ability are shown in Figure 4 B. The micelles of the application have a significantly improved cell entry ability compared with the aptamer itself.

[0164] The results of the detection of the co-localization with the lysosomes are shown in Figure 4 C. The micelles of the application have a strong co-localization with the lysosomes after entering the cells.

[0165] The above results show that the membrane protein targeting aptamer-L-lipid micelles of the application have better target binding ability and cell entry ability than the aptamer itself, and can rapidly target and enter the lysosomes after entering the cells.

[0166] Example 5: Analysis of the binding ability of the PROTAC chimera of the cytoplasmic protein targeting aptamer-L-lipid micelles to the target protein, the cell entry ability, and the co-localization with the lysosomes

[0167] To detect the binding ability of the PROTAC chimera in the cytoplasmic protein targeting aptamer-L-lipid micelles to the target protein, the Tau targeting PROTAC chimera was incubated with the 293T cell lysate overexpressing Tau, or the RelA targeting PROTAC chimera was incubated with the A549 cell lysate, and the binding ability to the target protein was detected by Pull down and Western blot experiment.

[0168] LAP or LAP-Mic were incubated with SH-SY5Y cells at 37℃ for 6h, and RAP or RAP-Mic were incubated with A549 cells at 37℃ for 6h, and the cell entry ability was detected by cell flow cytometry. LAP-Mic were incubated with SH-SY5Y cells, or RAP-Mic were incubated with A549 cells at 37℃ for 3h, then stained with lysosome for 30min, and the co-localization with lysosome was detected by laser confocal microscopy.

[0169] The cell entry ability detection results are shown in FIG. Figure 5 As shown in FIG. A, the chimeric body of the present application can effectively bind to the target protein, and form a ternary complex with the Tau or RelA target protein, VHL.

[0170] The cell entry ability detection results are shown in FIG. Figure 5 As shown in FIG. B and Table 1, the micelles (LAP-mic or RAP-mic) with the structure of PROTAC chimeric body of the present application have significantly improved cell entry ability compared with the PROTAC chimeric body (LAP or RAP), and the fluorescence intensity is improved by an order of magnitude.

[0171] Table 1: Cell entry ability detection results

[0172] Type Fluorescence intensity (mean) Type Fluorescence intensity (mean) Cells only 28.93 Cells only 232.7 LA 3423 RA 41322 LAP 4373 RAP 57435 LA-mic 19081 RA-mic 432667 LAP-mic 26744 RAP-mic 794667

[0173] The lysosome co-localization experiment results are shown in FIG. Figure 5 As shown in FIG. C, the micelles targeting cytoplasmic proteins of the present application do not co-localize with lysosomes.

[0174] The above results show that the PROTAC chimeric body of the present application has good targeting ability for cytoplasmic proteins. In addition, unexpectedly, the micelles of the PROTAC chimeric body of the present application have further significantly improved cell entry ability. And the micelles targeting cytoplasmic proteins of the present application do not co-localize with lysosomes, indicating that the micelles targeting cytoplasmic proteins do not degrade cytoplasmic proteins through the lysosome pathway.

[0175] Example 6: Analysis of membrane protein targeting degradation ability of aptamer-L-lipid micelles targeting membrane proteins

[0176] In order to detect the ability of aptamer-L-lipid micelles targeting membrane proteins to target and degrade membrane proteins, different concentrations of aptamer-L-lipid micelles targeting c-Met membrane proteins (Met-apt-Mic) or aptamer-L-lipid micelles targeting PTK7 membrane proteins (PTK-apt-Mic) were incubated with HeLa cells for 24h, and Western Blot experiment found that compared with the control group without treatment (0nM), the micelles could significantly degrade the target membrane protein at 300nM, and had a concentration gradient effect Figure 6 A).

[0177] The nucleic acid aptamer-L-lipid micelles (Met-apt-Mic) targeting c-Met membrane protein or nucleic acid aptamer-L-lipid micelles (PTK-apt-Mic) targeting PTK7 membrane protein were incubated with HeLa cells for different time. Western Blot experiment showed that the micelles could rapidly degrade the target membrane protein (within 3 hours) and had time gradient effect compared with the control group without treatment (0h) Figure 6 B). After the micelles treated HeLa cells were fixed and antibody stained, it was found that the level of c-Met protein or PTK7 protein on the cell membrane was significantly reduced Figure 6 C).

[0178] These results showed that the nucleic acid aptamer-L-lipid micelles targeting membrane protein could significantly reduce the level of membrane protein, and had concentration gradient and time gradient effect.

[0179] Hepatocyte growth factor (HGF) can activate and promote c-Met protein phosphorylation. After 300nM micelles Met-apt-Mic treated HeLa cells, 40ng / mL HGF was added to activate c-Met, it was found that the micelles significantly reduced the level of Met protein phosphorylation (P-Met). At the same time, after 300nM Met-apt-Mic or PTK-apt-Mic treated HeLa cells, the activity level of tumor cells was significantly reduced Figure 6 D, F).

[0180] Example 7: Analysis of the ability of nucleic acid aptamer-L-lipid micelles targeting cytoplasmic protein to degrade cytoplasmic protein

[0181] In order to detect the necessity of VHL ligand short peptide in the nucleic acid aptamer-L-lipid micelles targeting degradation of cytoplasmic protein, the inventors incubated 600nM LA-Mic and LAP-Mic with SH-SY5Y cells for 24h. Western Blot experiment showed that compared with the control group without treatment (Control), LA-Mic had no effect on the level of intracellular Tau protein, while LAP-Mic significantly reduced the level of intracellular Tau protein, indicating that the nucleic acid aptamer-L-lipid micelles targeting degradation of cytoplasmic protein need to add VHL ligand short peptide in synthesis Figure 7 A).

[0182] To analyze the degradation ability of the nucleic acid aptamer-L-VHL ligand short peptide PROTAC chimera and the micelle containing the PROTAC chimera structure on the target cytoplasmic protein, the inventors incubated different concentrations of LAP and LAP-Mic, RAP and RAP-Mic with SH-SY5Y cells and A549 cells for 24 h, and found that these materials significantly reduced the level of the target cytoplasmic protein by Western Blot experiment, and had a certain concentration gradient effect; at the same time, the results showed that the level of the target protein in the cells treated with micelles was lower than that in the cells treated with LAP and LAP-Mic, RAP and RAP-Mic at the same concentration Figure 7 B).

[0183] Subsequently, 600 nM of LAP and 300 nM of LAP-Mic, 600 nM of RAP and 300 nM of RAP-Mic were used to treat SH-SY5Y cells and A549 cells for different time, and the Western Blot results showed that these materials had a certain time gradient effect in reducing the level of the target cytoplasmic protein in cells Figure 7 C).

[0184] After fixing and antibody staining of the micelle-treated cells, it was found that the level of Tau protein or RelA protein in the cells treated with micelles was significantly reduced Figure 7 D).

[0185] The above results show that the nucleic acid aptamer-L-lipid micelle containing the PROTAC chimera structure further enhances the ability of the PROTAC chimera to degrade cytoplasmic proteins, and has a concentration gradient and time gradient effect.

[0186] To further study the effect of the micelle structure on the function of cells, the inventors constructed a Tau protein over-phosphorylated cell model using okadaic acid (OA), and found that LAP-Mic could significantly reduce the phosphorylation level of Tau protein in cells treated with okadaic acid, and improve the activity of OA-treated cells Figure 7 E). Similarly, the activity of A549 cells treated with RAP-Mic decreased significantly Figure 7 F). The results show that the micelle targeting cytoplasmic protein of the present application can effectively degrade Tau protein or RelA protein in cells.

[0187] Example 8: Mechanism analysis of nucleic acid aptamer-L-lipid micelles degrading membrane proteins and cytoplasmic proteins

[0188] To further analyze the mechanism by which nucleic acid aptamer-L-lipid micelles degrade membrane and cytoplasmic proteins, cells were pretreated with 20 μM lysosomal inhibitor (CQ) and 4 μM proteasome inhibitor (MG132) for 2 h, respectively. Then, HeLa cells, SH-SY5Y cells, and A549 cells were incubated with 300 nM membrane protein-targeting nucleic acid aptamer-L-lipid micelles (Met-apt-Mic or PTK7-apt-Mic) and cytoplasmic protein-targeting nucleic acid aptamer-L-lipid micelles containing a PROTAC structure (LAP-Mic or RAP-Mic), respectively, for 24 h. Western blot results showed that, compared with the untreated control group, the lysosomal inhibitors significantly inhibited the degradation of c-Met or PTK7 proteins on the cell membrane by Met-apt-Mic or PTK7-apt-Mic. Figure 8 A), while proteasome inhibitors can significantly inhibit the ability of LAP-Mic or RAP-Mic to degrade Tau or RelA proteins in the cytoplasm (A). Figure 8 B) indicates that micelles targeting membrane proteins degrade membrane proteins via the lysosomal pathway, while micelles targeting cytoplasmic proteins degrade cytoplasmic proteins via the proteasome pathway.

[0189] K48 ubiquitination of proteins is characterized by the formation of a chain-like structure through multiple ubiquitin molecules linked to the Lys48 site of the target protein. The main function of K48 ubiquitination is to promote the degradation of the target protein. To investigate the effect of cytoplasmic protein-targeting micelles on the ubiquitin levels of the target protein, the inventors incubated 300 nM LAP-Mic or RAP-Mic with 293T cells or A549 cells overexpressing Tau protein for 5 h, respectively. Ubiquitination levels were then analyzed by pull-down and Western blotting. The results showed that the K48 ubiquitin levels of Tau or RelA proteins were significantly increased in the micelle-treated groups. Figure 8 C).

[0190] The above results demonstrate that the nucleic acid aptamer-L-lipid micelles of the present invention can serve as a universal platform for editing based on the intracellular localization of target proteins, thereby enabling targeted degradation of membrane proteins and cytoplasmic proteins using two protein degradation systems (lysosomal degradation system and ubiquitin-proteasome degradation system). The inventors discovered that after treatment of cells with micelles targeting cytoplasmic proteins, Tau and RelA proteins were modified by the K48 ubiquitin chain.

[0191] sequence

[0192] Functional peptide (SEQ ID NO:1)

[0193] GSGSALAPYIPRRRRRRRR

[0194] c-MET-stem in micelles (SEQ ID NO: 2):

[0195] 5’-AGAATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATTCT-3’

[0196] PTK7-stem in micelles (SEQ ID NO: 3):

[0197] 5’-AGATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATCT-3’

[0198] Tau aptamer (LA aptamer) in PROTAC (SEQ ID NO: 4):

[0199] 5’-CTACTGAATAAGGACTGCTTAGGATTGCGATGATTCAGTAG-DBCO-3’

[0200] Tau mut aptamer (LS aptamer) in PROTAC (SEQ ID NO: 5):

[0201] 5’-TTACGGAGTACGGATGTCAGTGGTATAGTAATCCGTACTAA-DBCO-3’

[0202] RelA aptamer (RA aptamer) in PROTAC (SEQ ID NO: 6):

[0203] 5’-AGTCAGCGGGACAGGAGAAACACGGCATGTCAGCGCTGACT-DBCO-3’

[0204] RelA mutant aptamer (RM aptamer) in PROTAC (SEQ ID NO: 7):

[0205] 5’-AGTCAGCGTGACATTTTTTTTTTTTTTTGTCTTCGCTGACT-DBCO-3’

[0206] Tau-stem in micelles (SEQ ID NO: 8):

[0207] 5’-AGACTACTGAATAAGGACTGCTTAGGATTGCGATGATTCAGTAGTCTTT-DBCO-3’

[0208] RelA-stem in micelles (SEQ ID NO: 9):

[0209] 5'-AGAAGTCAGCGGGACAGGAGAAACACGGCATGTCAGCGCTGACTTCTTT-DBCO-3'

[0210] All documents referred to in the present application are incorporated herein by reference as if each individual document were incorporated by reference. In addition, it is to be understood that the application can be carried out by specifically different embodiments and that each disclosed embodiment can be implemented with or without the corresponding use of the other embodiments. Other embodiments will occur to those skilled in the art upon consideration of the specification and may be had and practiced without departing from the spirit of the application. Therefore, the present application is not intended to be limited to the foregoing aspects, but rather only by the following claims.

Claims

1. A functional nucleic acid-lipid nanomicelle, characterized in that, The nanomicelles comprise a plurality of nanomicelle monomers, each nanomicelle monomer comprising: (a) a targeting nucleic acid, (b) a lipid molecule, (c) a linker connecting the nucleic acid and the lipid, and optionally (d) a functional peptide linked to the nucleic acid; the nanomicelles specifically target and degrade membrane proteins and / or cytoplasmic proteins.

2. The functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, The nanomicelle monomer has the structure described in Formula I: Z n -L-A-P (Formula I) In the formula, Z represents a lipid molecule; The subscript n represents the number of lipid molecules, where n is 1, 2, or 3; L stands for Linker; A represents the targeted nucleic acid; P represents a non-functional or non-functional peptide.

3. The functional nucleic acid-lipid nanomicelles as described in claim 2, characterized in that, The A target is selected from proteins from the group consisting of membrane proteins, cytoplasmic proteins, or combinations thereof.

4. A targeted nucleic acid-functional peptide chimera, characterized in that, The targeted nucleic acid targets cytoplasmic proteins, the functional peptide targets ubiquitinase, and the targeted nucleic acid and the functional peptide are connected by a linker; the chimera targets and degrades cytoplasmic proteins.

5. The chimera as described in claim 4, characterized in that, The functional peptide has the structure described in Formula II: P1-P2-P3 (Equation II) In the formula, P1 is a linker peptide; P2 is a ligand that targets ubiquitinase; P3 is a cell-penetrating peptide.

6. A method for preparing the functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, Including the following steps: (a) Providing nanomicelle monomers; (b) The nanomicelle monomers self-assemble to form the functional nucleic acid-lipid nanomicelles.

7. The method as described in claim 6, characterized in that, The nanomicelle monomer is synthesized by the following steps: using a solid-phase phosphoramidite triester method, a targeted nucleic acid, a linker, and a lipid molecule are sequentially linked to obtain the nanomicelle monomer.

8. The use of the functional nucleic acid-lipid nanomicelles as described in claim 1, characterized in that, Drugs used to prepare drugs that target and degrade target membrane proteins or target cytoplasmic proteins.

9. The use as described in claim 8, characterized in that, The nanomicelles do not contain functional peptides and are used to prepare drugs that target and degrade specific membrane proteins.

10. The use as described in claim 9, characterized in that, The nanomicelles contain functional peptides and are used to prepare drugs that target and degrade specific cytoplasmic proteins.

Images