Trichoderma reesei engineering bacterium capable of producing beta-glucosidase at high yield as well as construction method and application of trichoderma reesei engineering bacterium

Abstract

The invention provides a Trichoderma reesei engineering bacterium for high yield of beta-glucosidase, which is characterized in that a Trichoderma reesei SN1 strain is used as a starting strain, and an expression cassette for knocking out a cre1 gene, a constitutive expression cassette of an aspergillus niger source bglA gene expressed by a promoter cbh1 and a constitutive expression cassette of a 130442 gene expressed by the promoter cbh1 are constructed in a genome of the Trichoderma reesei SN1 strain. Through the knockout of the cre1 gene, the overexpression of the aspergillus niger source bglA gene and the overexpression of the 130442 gene, the yield of the beta-glucosidase in the trichoderma reesei is improved synergistically. Glucose is taken as a raw material, a transglycosylation reaction can be catalyzed by directly utilizing a crude enzyme solution of trichoderma reesei engineering bacteria with high yield of beta-glucosidase to prepare beta-disaccharide, and the beta-disaccharide can be taken as an inducer for cellulase production; a crude enzyme liquid with higher cellulase activity and beta-glucosidase activity is obtained by supplementing an inducer and carrying out fed-batch fermentation.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a Trichoderma reesei engineered strain that produces high levels of β-glucosidase, its construction method, and its application. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] With the increasing severity of the energy crisis and environmental pollution, the bioconversion of lignocellulosic renewable resources, represented by straw, has become an important option for producing biofuels and bio-based chemicals to reduce dependence on petroleum. Currently, the efficiency of lignocellulosic bioconversion needs improvement, with the high production cost of cellulase being one of the major bottlenecks to its industrialization.

[0004] Microorganisms that secrete cellulase are widespread in nature, such as *Trichoderma reesei*. Trichoderma reesei *Trichoderma reesei* is one of the most potent cellulase-producing bacteria known to date, possessing the strongest extracellular protein secretion capacity. Its cellulase system mainly includes exocellulase, endocellulase, and β-glucosidase. Exocellulase primarily acts on the ends of cellulose linear molecules to produce cellobiose; endocellulase acts on the non-crystalline portion of cellulose, randomly hydrolyzing β-1,4-glycosidic bonds to reduce the degree of cellulose polymerization and generate new cellulose ends, thus assisting exocellulase in hydrolyzing cellulose more quickly. The cellobiose produced by exocellulase inhibits both exocellulase and endocellulase activity; when cellobiose reaches a certain concentration, the activity of both is inhibited, affecting the hydrolytic efficiency. β-glucosidase hydrolyzes cellobiose to glucose, thus relieving this inhibition and allowing both exo and endoenzymes to continue their continuous action, achieving highly efficient cellulose hydrolysis to produce glucose. In the *Trichoderma reesei* cellulase system, exonucleases account for 60-80% of the total extracellular protein, endocellases comprise 20-36%, and β-glucosidases account for 1%. Therefore, β-glucosidase is the rate-limiting enzyme in the cellulose degradation process of *Trichoderma reesei* cellulase. Consequently, overexpression of the β-glucosidase gene in *Trichoderma reesei* has become the preferred strategy for improving the saccharification efficiency of cellulase.

[0005] In addition, cellulase is a kind of induced enzyme, and the expression of cellulase is essential for the inducer. In addition to having hydrolytic activity, beta-glucosidase can also catalyze transglycosylation reaction under high glucose concentration to synthesize beta-disaccharides such as cellobiose, sophorose and gentiobiose, among which sophorose is the most effective cellulase inducer identified in Trichoderma reesei so far. However, the commercial beta-glucosidase required in the transglycosylation reaction is costly, and direct use of crude beta-glucosidase produced in situ is expected to reduce the cost of inducer preparation. SUMMARY

[0006] In order to overcome the above problems, the present application provides a Trichoderma reesei engineering strain with high yield of beta-glucosidase and a construction method and application thereof.

[0007] To achieve the above technical purposes, the present application adopts the following technical solutions: In a first aspect, the present application provides a Trichoderma reesei engineering strain with high yield of beta-glucosidase, which takes Trichoderma reesei SN1 strain as a starting strain, and constructs an expression cassette for knocking out cre1 gene, a constitutive expression cassette of Aspergillus niger-derived bglA gene expressed by promoter cbh1 and a constitutive expression cassette of 130442 gene expressed by promoter cbh1 in the genome thereof. The sequence of the expression cassette for knocking out cre1 gene is shown in SEQ ID NO. 1. The constitutive expression cassette of Aspergillus niger-derived bglA gene expressed by promoter cbh1 is shown in SEQ ID NO. 2. The constitutive expression cassette of Aspergillus niger-derived 130442 gene expressed by promoter cbh1 is shown in SEQ ID NO. 3.

[0008] In a second aspect, the present application provides a construction method of the Trichoderma reesei engineering strain with high yield of beta-glucosidase according to the first aspect, which comprises the following steps: In a second aspect, the present application provides a construction method of the Trichoderma reesei engineering strain with high yield of beta-glucosidase according to the first aspect, which comprises the following steps: The sequence of the expression cassette for knocking out cre1 gene is shown in SEQ ID NO. 1. The sequence of the constitutive expression cassette of Aspergillus niger-derived bglA gene expressed by promoter cbh1 is shown in SEQ ID NO. 2. The sequence of the constitutive expression cassette of Aspergillus niger-derived 130442 gene expressed by promoter cbh1 is shown in SEQ ID NO. 3.

[0009] In one or more embodiments, the method for constructing the expression cassette for knocking out the cre1 gene comprises: amplifying the upstream homologous arm of the cre1 gene using primer pair cre1-UF / cre1-UR; amplifying the downstream homologous arm of the cre1 gene using primer pair cre1-DF / cre1-DR; sequentially fusing the upstream homologous arm, the screening marker gene PyrG with the DR repeat sequence, and the downstream homologous arm to obtain the expression cassette for knocking out the cre1 gene.

[0010] Preferably, the sequence of cre1-UF is shown in SEQ ID NO. 4; Preferably, the sequence of cre1-UR is shown in SEQ ID NO. 5; Preferably, the sequence of cre1-DF is shown in SEQ ID NO. 6; Preferably, the sequence of cre1-DR is shown in SEQ ID NO. 7.

[0011] In one or more embodiments, the method for constructing the constitutive expression cassette of the bglA gene of Aspergillus niger expressed by the promoter cbh1 comprises: amplifying the promoter of the cbh1 gene using primer pair Pcbh1-F / Pcbh1-R with the Trichoderma reesei genome as the template; amplifying the coding region and terminator of the bglA gene using primer pair bglA-F / bglA-R with the Aspergillus niger genome as the template; then fusing the promoter of the cbh1 gene, the coding region and terminator of the bglA gene to obtain the constitutive expression cassette of the bglA gene of Aspergillus niger expressed by the promoter cbh1.

[0012] Preferably, the sequence of Pcbh1-F is shown in SEQ ID NO. 8; Preferably, the sequence of Pcbh1-R is shown in SEQ ID NO. 9; Preferably, the sequence of bglA-F is shown in SEQ ID NO. 10; Preferably, the sequence of bglA-R is shown in SEQ ID NO. 11.

[0013] In one or more embodiments, the method for constructing the constitutive expression cassette of the 130442 gene expressed by the promoter cbh1 comprises: amplifying the promoter of the cbh1 gene using primer pair Pcbh1-F / Pcbh1-R with the Trichoderma reesei genome as the template; The coding region and terminator of the actin-related protein 130442 gene are amplified from the Trichoderma reesei genome using primer pair 130442-F / 130442-R. The coding region and terminator of the 130442 gene are then fused with the cbh1 gene promoter to obtain a constitutive expression cassette of the 130442 gene expressed by the cbh1 promoter.

[0014] Preferably, the sequence of 130442-F is shown in SEQ ID NO. 12. Preferably, the sequence of 130442-R is shown in SEQ ID NO. 13.

[0015] In a third aspect, the application provides the use of a mixed solution prepared by catalyzing a glucosidation reaction of glucose using the crude enzyme solution obtained after fermentation of the Trichoderma reesei engineering strain with high β-glucosidase production as an inducer of cellulase.

[0016] In one or more embodiments, the fermentation method of the crude enzyme solution obtained after fermentation of the Trichoderma reesei engineering strain with high β-glucosidase production comprises: The Trichoderma reesei engineering strain with high β-glucosidase production is inoculated into a seed culture medium to obtain a seed culture. The seed culture is transferred to a fermentation culture medium, and after cultivation, the crude enzyme solution is collected by centrifugation.

[0017] Preferably, the seed culture medium comprises 10.0 g / L of glucose, 2.0 g / L of peptone, 5.0 g / L of (NH4)2SO4, 5.0 g / L of KH2PO4, 0.6 g / L of MgSO4·7H2O, 0.6 g / L of CaCl2·2H2O, 0.005 g / L of FeSO4·7H2O, 0.002 g / L of CoCl2·6H2O, 0.0017 g / L of MnSO4·H2O, and 0.0014 g / L of ZnSO4·7H2O.

[0018] Preferably, the fermentation culture medium comprises 20.0 g / L of microcrystalline cellulose, 20.0 g / L of corn syrup, 5.0 g / L of (NH4)2SO4, 5.0 g / L of KH2PO4, 0.6 g / L of MgSO4·7H2O, 0.6 g / L of CaCl2·2H2O, 0.005 g / L of FeSO4·7H2O, 0.002 g / L of CoCl2·6H2O, 0.0017 g / L of MnSO4·H2O, and 0.0014 g / L of ZnSO4·7H2O.

[0019] Preferably, the conditions for culturing in the seed medium are: 200 rpm, 30 o C for 24 h.

[0020] Preferably, the conditions for culturing in the fermentation medium are: 30 o C for 7 d.

[0021] In one or more embodiments, the method for preparing a mixed solution by catalyzing a transglycosylation reaction of glucose by a crude enzyme solution comprises: A mixed solution is prepared by catalyzing a transglycosylation reaction of glucose by a crude enzyme solution of a high-yield β-glucosidase Trichoderma reesei engineering strain.

[0022] Preferably, the conditions for the transglycosylation reaction comprise: The amount of the crude enzyme solution of the high-yield β-glucosidase Trichoderma reesei engineering strain is 20-25 IU / g of glucose in terms of β-glucosidase, preferably 20 IU / g of glucose; the catalysis temperature is 60-70 ℃, preferably 65 ℃; the catalysis pH is 4.5-5, preferably 4.8; and the reaction time is 24-36 h, preferably 24 h.

[0023] In a fourth aspect of the present application, the high-yield β-glucosidase Trichoderma reesei engineering strain of the first aspect or the high-yield β-glucosidase Trichoderma reesei engineering strain constructed by the construction method of the second aspect is applied to fermentation production of cellulase.

[0024] The present application has the following beneficial effects: The present application provides a high-yield β-glucosidase Trichoderma reesei engineering strain, which takes Trichoderma reesei SN1 strain as a starting strain, constructs an expression cassette for knocking out cre1 gene, a constitutive expression cassette for expressing bglA gene from Aspergillus niger under the control of promoter cbh1, and a constitutive expression cassette for expressing 130442 gene under the control of promoter cbh1 in the genome. Experimental results show that the knocking out of cre1 gene, overexpression of bglA gene from Aspergillus niger, and overexpression of 130442 gene synergistically improve the yield of β-glucosidase in Trichoderma reesei. With glucose as a raw material, a crude enzyme solution of the high-yield β-glucosidase Trichoderma reesei engineering strain can be directly used to catalyze a transglycosylation reaction to obtain β-disaccharide, which can be used as an inducer for cellulase production; a crude enzyme solution with higher cellulase activity and β-glucosidase activity is obtained by batch feeding fermentation with an inducer; in addition, a recyclable inducer preparation and cellulase production system is successfully established by recycling a small amount of crude enzyme solution. The crude enzyme solution with higher cellulase activity and β-glucosidase activity obtained by batch feeding fermentation can realize high solid saccharification of alkali pretreated corn stalks. BRIEF DESCRIPTION OF DRAWINGS

[0025] The accompanying drawings, which form a part of this specification, are included to provide a further understanding of the application and are incorporated herein by reference. The illustrations are of exemplary embodiments of the application and explain the principles of the application, but do not limit the application.

[0026] Figure 1 The construction process of the expression cassette for knocking out the cre1 gene, the constitutive expression cassette of the bglA gene from Aspergillus niger under the promoter cbh1 expression, and the constitutive expression cassette of the 130442 gene under the promoter cbh1 expression, wherein A is the expression cassette for knocking out the cre1 gene, B is the constitutive expression cassette of the bglA gene from Aspergillus niger under the promoter cbh1 expression, and C is the constitutive expression cassette of the 130442 gene under the promoter cbh1 expression; Figure 2 The β-glucosidase activity plate analysis of the Trichoderma reesei engineering strain SBC81, wherein A is the β-glucosidase activity plate detection diagram of the Trichoderma reesei engineering strain SBC81, and B is the β-glucosidase activity determination result of the Trichoderma reesei SBC81 engineering strain under the shake flask batch culture condition; Figure 3 The experimental results of the crude cellulase liquid of the Trichoderma reesei SBC81 engineering strain for the transglycosylation reaction to synthesize β-disaccharide; wherein A is the β-disaccharide yield under different doses of the crude cellulase liquid, and B is the β-disaccharide yield under different catalytic times with the enzyme dose of 20 IU / g glucose; Figure 4 The cellulase activity determination result of the Trichoderma reesei SBC81 engineering strain; Figure 5 The β-glucosidase activity determination result of the Trichoderma reesei SBC81 engineering strain; Figure 6 The schematic diagram of the recyclable system of the β-disaccharide inducer synthesis and cellulase production; Figure 7 The glucose yield from the corn straw hydrolysis of the cellulase liquid of the Trichoderma reesei engineering strain SBC81 and the cellulase liquid of the Trichoderma reesei strain RUT-C30. DETAILED DESCRIPTION

[0027] It should be noted that the following detailed description is exemplary in nature and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0028] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, steps, operations, elements, components, and / or groups thereof, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof.

[0029] In order for those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in conjunction with specific examples.

[0030] In the following examples, the cellulase activity determination method is as follows: Fold 1x6 cm (50±1 mg) filter paper into the bottom of a test tube, add 1.5 mL pH 4.8 citric acid buffer and 0.5 mL of appropriately diluted crude enzyme solution, mix well; after 60 min in a 50 ℃ water bath, add 3 mL DNS, vortex and mix well, then boil for 10 min, add distilled water to 25 mL, shake well, and measure OD at 540 nm; the blank control is to add DNS first and then add enzyme solution. Enzyme activity definition: the amount of enzyme required to produce 1 µmoL of glucose per minute under the conditions of 50 ℃ and pH 4.8 is defined as one unit of enzyme activity.

[0031] β-glucosidase activity (pNPGase) determination method: Take 100 μL of appropriately diluted enzyme solution, add 50 μL of 10 mmol / L p-nitrophenyl-β-D-glucopyranoside (pNPG) citric acid buffer solution (pH 4.8), mix well; after 30 min in a 50 ℃ water bath, add 150 μL of 10% Na2CO3 to terminate the reaction; measure OD at 405 nm; at the same time, use the tube without enzyme solution as a blank control. Enzyme activity definition: the number of micromoles of p-nitrophenol (pNP) produced per minute per milliliter of enzyme solution under the conditions of 50 ℃ and pH 4.8.

[0032] The composition of escin culture medium is as follows: CMC-Na 10 g / L, escin 3 g / L, ferric citrate 0.5 g / L, (NH4)2SO4 2 g / L, MgSO4·7H2O 0.5 g / L, K2HPO4 1 g / L, yeast extract 1 g / L, 2% agar powder, sterilized at 115 °C for 30 min.

[0033] Seed culture medium was composed of glucose 10.0 g / L, peptone 2.0 g / L, (NH4)2SO4 5.0 g / L, KH2PO4 5.0 g / L, MgSO4·7H2O 0.6 g / L, CaCl2·2H2O 0.6 g / L, FeSO4·7H2O 0.005 g / L, CoCl2·6H2O 0.002 g / L, MnSO4·H2O 0.0017 g / L and ZnSO4·7H2O 0.0014 g / L.

[0034] Fermentation medium was composed of microcrystalline cellulose 20.0 g / L, corn syrup 20.0 g / L, (NH4)2SO4 5.0 g / L, KH2PO4 5.0 g / L, MgSO4·7H2O 0.6 g / L, CaCl2·2H2O 0.6 g / L, FeSO4·7H2O 0.005 g / L, CoCl2·6H2O 0.002 g / L, MnSO4·H2O 0.0017 g / L and ZnSO4·7H2O 0.0014 g / L.

[0035] Example 1 Construction of high β-glucosidase-producing Trichoderma reesei engineering bacteria: (1) Construction of expression cassette for knocking out cre1 gene: The upstream homologous arm of the cre1 gene was amplified by using primer pair cre1-UF / cre1-UR; the downstream homologous arm of the cre1 gene was amplified by using primer pair cre1-DF / cre1-DR; the upstream homologous arm, the screening marker gene PyrG with DR repeat sequence and the downstream homologous arm were sequentially fused to obtain the expression cassette for knocking out the cre1 gene (as shown in FIG. A). Figure 1

[0036] The sequence of cre1-UF (SEQ ID NO. 4) is CCTTCAATGGGGAGGTGG; The sequence of cre1-UR (SEQ ID NO. 5) is TGGTGGGTGAGATAGACA; The sequence of cre1-DF (SEQ ID NO. 6) is CAGCACAATACGACTCCG; The sequence of cre1-DR (SEQ ID NO. 7) is TGCCGAATACCCTGAAAA.

[0037] (2) Construction of constitutive expression cassette of Aspergillus niger-derived bglA gene for expressing cbh1 promoter: ​The cbh1 gene promoter was amplified from the Trichoderma reesei genome using primer pair Pcbhl-F / Pcbhl-R; the coding region and terminator of the bglA gene were amplified from the Aspergillus niger genome using primer pair bglA-F / bglA-R; and then the cbh1 gene promoter, the coding region and terminator of the bglA gene were fused to obtain a constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1 (as shown in formula (I) of Figure 1 b).

[0038] The sequence of Pcbhl-F (SEQ ID NO. 8) is CCTTTGGCGTTTCCCTGATTC; The sequence of Pcbhl-R (SEQ ID NO. 9) is GATGCGCAGTCCGCGGTT; The sequence of bglA-F (SEQ ID NO. 10) is ATGAGGTTCACTTTGATCGAGGC; The sequence of bglA-R (SEQ ID NO. 11) is GTGGGTGGAGGGTGCTGGA.

[0039] (3) Construction of a constitutive expression cassette of the 130442 gene expressed by the promoter cbh1: The cbh1 gene promoter was amplified from the Trichoderma reesei genome using primer pair Pcbhl-F / Pcbhl-R; the coding region and terminator of the 130442 gene were amplified from the Trichoderma reesei genome using primer pair 130442-F / 130442-R; and then the cbh1 gene promoter and the coding region and terminator of the 130442 gene were fused to obtain a constitutive expression cassette of the 130442 gene expressed by the promoter cbh1 (as shown in formula (II) of Figure 1 c).

[0040] The sequence of 130442-F (SEQ ID NO. 12) is ATGGTCGGCAAAGTCTCCG; The sequence of 130442-R (SEQ ID NO. 13) is CTACCACGCCCAGAGCAC.

[0041] (4) The genetic transformation of Trichoderma reesei SN1 was performed by using a PEG / CaCl2-mediated protoplast transformation method, and 10 μg of the constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1 was transformed into 200 μL of the Trichoderma reesei SN1 strain protoplast (the concentration was greater than 10 8), and the transformants were screened on MM plates without uracil. The genomic DNA of the transformants was extracted as a template, and the primer pair Y-cbh1-F / Y-bglA-R was used to verify the transformants in which the bglA gene from A. niger was successfully overexpressed. The correct transformants were the first intermediate strain SNB16.

[0042] Then, 10 μg of the expression cassette for knocking out the cre1 gene was transformed into 200 μL of protoplasts of the first intermediate strain (the concentration was greater than 10 8 ), and the transformants were screened on MM plates. The genomic DNA of the transformants was extracted as a template, and the primer pair Y-cre1-F / Y-cre1-R was used to verify the transformants in which the cre1 gene was successfully knocked out. The correct transformants were the second intermediate strain SNC19.

[0043] Then, 10 μg of the expression cassette for knocking out the cre1 gene was transformed into 200 μL of protoplasts of the first intermediate strain (the concentration was greater than 10 8 ), and the transformants were screened on MM plates. The genomic DNA of the transformants was extracted as a template, and the primer pair Y-cre1-F / Y-cre1-R was used to verify the transformants in which the cre1 gene was successfully knocked out. The correct transformants were the second intermediate strain SNC19.

[0044] The nucleotide sequences of the verification primers are as follows: Y-cre1-F: GATGCTTGAGCGGACAGTG; Y-cre1-R: GTGTAGGGGTCCATCCAAGC; Y-cbh1-F: AGCCAGGGATGCTTGAGTGT; Y-bglA-R: GCCAGATTCTTGTCCCAGGT; Y-130442-R: ACCAGCTCCTTGGAGTTGG.

[0045] Example 2 Plate analysis of β-glucosidase activity of the Trichoderma reesei engineering strain SBC81 The β-glucosidase activity was detected by using an esculin medium plate detection method. Specifically, about 0.5 cm 3 of equal amounts of mycelium were inoculated on an esculin plate, and after 2 days of culture at 30 °C, the size of the black halo around the colonies was observed.

[0046] The β-glucosidase activity of the first intermediate strain SNB16, the second intermediate strain SNC19, the high-yield β-glucosidase Trichoderma reesei engineering strain SBC81 and the parent strain SN1 in the shake flask batch culture condition was determined. The results are shown in Table 1. Figure 2 As shown in Table 1, the β-glucosidase activity of the first intermediate strain SNB16 randomly overexpressing the bgIA gene reached 75.0 IU / mL, which was 32.6 times higher than that of the parent strain SN1. The β-glucosidase activity of the second intermediate strain SNC19 further knocking out the cre1 gene based on the first intermediate strain SNB16 reached 94.2 IU / mL, which was 25.6% higher than that of the engineering strain SNB16. The β-glucosidase activity of the engineering strain SBC81 further overexpressing the 130442 gene based on the second intermediate strain SNC19 reached 119.3 IU / mL, which was 26.6% higher than that of the second intermediate strain SNC19. The results showed that the knockout of the cre1 gene, the overexpression of the Aspergillus niger-derived bgIA gene and the overexpression of the 130442 gene synergistically improved the yield of β-glucosidase in Trichoderma reesei.

[0047] Example 3 The fermentation method of the crude enzyme solution of the high-yield β-glucosidase Trichoderma reesei engineering strain after fermentation includes: Fresh spores of Trichoderma reesei SBC81 were inoculated into 0.3 L of seed culture medium at a concentration of 1×10 5 o C for 24 h to obtain a seed culture; then 0.3 L of the seed culture was transferred into 2.7 L of fermentation culture medium, and cultured at 30 o C for 7 d, and the crude enzyme solution was collected by centrifugation.

[0048] The crude cellulase enzyme solution with high β-glucosidase activity from the Trichoderma reesei engineering strain SBC81 was directly used to catalyze the transglycosylation reaction to prepare the β-disaccharide inducer required for cellulase production. The transglycosylation reaction used 600 g / L of glucose as the raw material, and the reaction conditions were 65 ℃, pH 4.8, and the reaction time was 72 h. By determining the β-disaccharide yield after 72 h of transglycosylation reaction under different β-glucosidase dosages (5, 10, 15, 20, 25, 50 and 100 IU / g of glucose), the optimal enzyme dosage was determined. Then, by determining the β-disaccharide yield at different time points (6, 12, 24, 36, 48, 60 and 72 h) in the transglycosylation reaction process with a β-glucosidase dosage of 20 IU / g of glucose, the optimal catalytic time was determined.

[0049] As shown in Table 2, the optimal enzyme dosage was 20 IU / g of glucose, and the optimal catalytic time was 72 h. Figure 3 ​As shown in Table A, the glucose conversion rate increased significantly as the β-glucosidase enzyme loading increased from 5 IU / g glucose to 20 IU / g glucose. However, when the enzyme loading was further increased from 20 IU / g glucose to 100 IU / g glucose, the glucose conversion rate did not increase further, with the highest conversion rate being 19.9%. As shown in Table B, the β-disaccharide yield reached a maximum after 24 h of transglycosylation reaction, and the β-disaccharide yield did not increase further when the catalysis time was extended to 72 h. Therefore, it was demonstrated that the crude cellulase solution with high β-glucosidase activity of the Trichoderma reesei engineering strain SBC81 could be directly used to prepare the β-disaccharide inducer required for cellulase production. Moreover, through optimization of the transglycosylation reaction, the optimal enzyme loading was determined to be 20 IU / g glucose, and the optimal catalysis time was determined to be 24 h. Figure 3 As shown in Table B, the β-disaccharide yield reached a maximum after 24 h of transglycosylation reaction, and the β-disaccharide yield did not increase further when the catalysis time was extended to 72 h. Therefore, it was demonstrated that the crude cellulase solution with high β-glucosidase activity of the Trichoderma reesei engineering strain SBC81 could be directly used to prepare the β-disaccharide inducer required for cellulase production. Moreover, through optimization of the transglycosylation reaction, the optimal enzyme loading was determined to be 20 IU / g glucose, and the optimal catalysis time was determined to be 24 h.

[0050] The sugar solution mixture in this example was analyzed by HPLC to include 80% glucose and 20% β-disaccharides, wherein the β-disaccharides included sophorose, cellobiose, and gentiobiose.

[0051] Example 4 Batch-fed fermentation of the Trichoderma reesei engineering strain SBC81 for cellulase production Fresh spores of the Trichoderma reesei SBC81 were inoculated into 0.3 L of seed medium at a concentration of 1 x 10 5 spores / mL, and the seed culture was obtained by incubation at 200 rpm, 30 o C for 24 h in a shaker. Then, 0.3 L of the seed culture was transferred into 2.7 L of fermentation medium, and the β-disaccharide inducer prepared in Example 3 was added at an initial feeding rate of 3.0 g / L / h when the glucose was depleted (<0.1 g / L), which was estimated according to the glucose consumption rate of the Trichoderma reesei engineering strain SBC81. Subsequently, the feeding rate was adjusted by 3 h sampling to maintain the glucose concentration at 0.05-0.30 g / L, and the temperature and pH were maintained at 30 C and 4.5, respectively; the dissolved oxygen (DO) level was controlled at 20% by automatically adjusting the agitation speed of the fermenter (at 200-950 rpm); and the cellulase activity and β-glucosidase activity of the fermentation broth were determined every 12 h. As shown in Table C, the cellulase activity of the Trichoderma reesei engineering strain SBC81 reached a maximum value of 61.8 IU / mL at 168 h. As shown in Table D, the β-glucosidase activity of the Trichoderma reesei engineering strain SBC81 also reached a maximum value of 2169 IU / mL at 168 h. Figure 4 As shown in Table C, the cellulase activity of the Trichoderma reesei engineering strain SBC81 reached a maximum value of 61.8 IU / mL at 168 h. As shown in Table D, the β-glucosidase activity of the Trichoderma reesei engineering strain SBC81 also reached a maximum value of 2169 IU / mL at 168 h. Figure 5 As shown in Table C, the cellulase activity of the Trichoderma reesei engineering strain SBC81 reached a maximum value of 61.8 IU / mL at 168 h. As shown in Table D, the β-glucosidase activity of the Trichoderma reesei engineering strain SBC81 also reached a maximum value of 2169 IU / mL at 168 h.

[0052] Example 5 Establishment of a recyclable inducer preparation and cellulase production system The crude cellulase broth of the engineered Trichoderma reesei strain SBC81 obtained in Example 4 has very high β-glucosidase activity, which means that even a low dose of the crude cellulase broth can be sufficient to meet the demand for inducer synthesis. Therefore, by recycling the crude cellulase produced by Trichoderma reesei SBC81, a recyclable inducer preparation and cellulase production system was developed. Figure 6 A schematic diagram of the recyclable system is shown, in which the material balance is calculated based on the fed-batch fermentation experiment in Example 4. First, initial cellulase production was carried out by batch fermentation of Trichoderma reesei SBC81 in a shake flask, and a crude cellulase broth with a β-glucosidase activity of 119.3 IU / mL was obtained. Subsequently, 153 mL of the crude cellulase broth was transferred to a bioreactor for the first round of inducer preparation by transglycosylation reaction. Then, 1325 mL of the inducer was fed to the fed-batch fermentation system of Trichoderma reesei SBC81 for the first round of cellulase production, and finally 3450 mL of the crude cellulase broth with a β-glucosidase activity of 2169 IU / mL was obtained. Finally, only 7.3 mL of the crude cellulase broth, which accounted for 2.1‰ of the total output of the first round of cellulase production, was recycled for use in the second round of inducer preparation and the second round of cellulase production. Thus, a recyclable inducer preparation and cellulase production system was obtained. The system has undergone more than 3 rounds of recycling, and the cellulase activity, β-glucosidase activity, inducer feed amount, cellulase yield, crude cellulase recycling amount, and β-disaccharide yield in the inducer preparation process have remained stable in each round of recycling.

[0053] Example 6 High-solids saccharification of alkali pretreated corn stover was carried out using the crude cellulase broth produced by batch fed-batch fermentation of the engineered Trichoderma reesei strain SBC81 in Example 4. The cellulase broth of the commonly used Trichoderma reesei strain RUT-C30 in industry was selected as a control.

[0054] First, a high-solids saccharification reaction system with a solid loading of 35% was configured by a substrate fed-batch strategy, in which 20% of the solid loading of substrate was initially added, and then 5% of the solid loading of substrate was added every 6 h for a total of three times until the solid loading of the reaction system reached 35%. In addition, 1% of Tween 80 was added to the reaction system, and the pH of the reaction system was maintained at 4.8 using a citric acid buffer. According to the cellulase dosage of 5 FPU / g DM, two kinds of cellulase broth were added to the reaction system, and the reaction was carried out at 50°C, 200 rpm for 72 h. The results are shown in Table 2. Figure 7As shown, the glucose yield of the cellulase liquid of the Trichoderma reesei engineering strain SBC81 hydrolyzed from corn stalks was 103.9 g / L, which was 2.5 times of the industrial strain RUT-C30, and the glucose yield of the industrial strain RUT-C30 was only 40.8 g / L.

[0055] The preferred embodiments of the present application have been described above with the preferred embodiments, but the present application is not limited to the above examples, and various modifications and changes can be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A Trichoderma reesei engineered strain producing high level of β-glucosidase, characterized in that, The expression cassette for knocking out the cre1 gene, the constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1, and the constitutive expression cassette of the 130442 gene expressed by the promoter cbh1 are constructed in the genome of the Trichoderma reesei SN1 strain as the starting strain; The sequence of the expression cassette for knocking out the cre1 gene is shown in SEQ ID NO. 1; The constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1 is shown in SEQ ID NO. 2; The constitutive expression cassette of the 130442 gene from Aspergillus niger expressed by the promoter cbh1 is shown in SEQ ID NO.

3.

2. The method for constructing an engineered strain of Trichoderma reesei producing high levels of β-glucosidase according to claim 1, characterized in that, The method comprises the following steps: The expression cassette for knocking out the cre1 gene, the constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1, and the constitutive expression cassette of the 130442 gene expressed by the promoter cbh1 are constructed in the genome of the Trichoderma reesei SN1 strain as the starting strain; The sequence of the expression cassette for knocking out the cre1 gene is shown in SEQ ID NO. 1; The sequence of the constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1 is shown in SEQ ID NO. 2; The sequence of the constitutive expression cassette of the 130442 gene from Aspergillus niger expressed by the promoter cbh1 is shown in SEQ ID NO.

3.

3. The construction method of claim 2, wherein, The method for constructing the expression cassette for knocking out the cre1 gene comprises: The upstream homologous arm of the cre1 gene is amplified by using the primer pair cre1-UF / cre1-UR; The downstream homologous arm of the cre1 gene is amplified by using the primer pair cre1-DF / cre1-DR; The upstream homologous arm, the screening marker gene PyrG with the DR repeated sequence, and the downstream homologous arm are sequentially fused to obtain the expression cassette for knocking out the cre1 gene.

4. The construction method of claim 3, wherein, The sequence of cre1-UF is shown in SEQ ID NO. 4; Or, the sequence of cre1-UR is shown in SEQ ID NO. 5; Or, the sequence of cre1-DF is shown in SEQ ID NO. 6; Or, the sequence of cre1-DR is shown in SEQ ID NO.

7.

5. The construction method of claim 2, wherein, The method for constructing the constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1 comprises: The cbh1 gene promoter is amplified by using the primer pair Pcbh1-F / Pcbh1-R with the Trichoderma reesei genome as the template; The coding region and terminator of the bglA gene are amplified by using the primer pair bglA-F / bglA-R with the Aspergillus niger genome as the template; Then, the cbh1 gene promoter, the coding region and terminator of the bglA gene are fused to obtain the constitutive expression cassette of the bglA gene from Aspergillus niger expressed by the promoter cbh1; Preferably, the sequence of Pcbh1-F is shown in SEQ ID NO. 8; Preferably, the sequence of Pcbh1-R is shown in SEQ ID NO. 9; Preferably, the sequence of bglA-F is shown in SEQ ID NO. 10; Preferably, the sequence of bglA-R is shown in SEQ ID NO.

11. Preferably, the sequence of bglA-R is shown as SEQ ID NO.

11.

6. The construction method of claim 2, wherein, The method for constructing the constitutive expression cassette of 130442 gene expressed by the promoter cbh1 comprises the following steps: The cbh1 gene promoter is amplified from the Trichoderma reesei genome by using the primer pair Pcbh1-F / Pcbh1-R; The coding region and terminator of the actin-related protein 130442 gene are amplified from the Trichoderma reesei genome by using the primer pair 130442-F / 130442-R; Then, the cbh1 gene promoter and the coding region and terminator of the 130442 gene are fused to obtain the constitutive expression cassette of 130442 gene expressed by the promoter cbh1; Preferably, the sequence of 130442-F is shown as SEQ ID NO. 12; Preferably, the sequence of 130442-R is shown as SEQ ID NO.

13.

7. Application of the mixed solution prepared by the crude enzyme solution of the high β-glucosidase-producing Trichoderma reesei engineering strain after fermentation in catalyzing the transglycosylation reaction of glucose as an inducer of cellulase.

8. Use according to claim 7, wherein the compound is ###0002### The fermentation method of the crude enzyme solution of the high β-glucosidase-producing Trichoderma reesei engineering strain after fermentation comprises the following steps: The high β-glucosidase-producing Trichoderma reesei engineering strain is inoculated into a seed culture medium to obtain a seed culture; The seed culture is transferred into a fermentation culture medium, and after cultivation, the crude enzyme solution is collected by centrifugation; Preferably, the seed culture medium comprises 10.0 g / L of glucose, 2.0 g / L of proteose peptone, 5.0 g / L of (NH4)2SO4, 15.0 g / L of KH2PO4, 0.6 g / L of MgSO4·7H2O, 0.6 g / L of CaCl2·2H2O, 0.005 g / L of FeSO4·7H2O, 0.002 g / L of CoCl2·6H2O, 0.0017 g / L of MnSO4·H2O, and 0.0014 g / L of ZnSO4·7H2O; Preferably, the fermentation culture medium comprises 20.0 g / L of microcrystalline cellulose, 20.0 g / L of corn syrup, 5.0 g / L of (NH4)2SO4, 5.0 g / L of KH2PO4, 0.6 g / L of MgSO4·7H2O, 0.6 g / L of CaCl2·2H2O, 0.005 g / L of FeSO4·7H2O, 0.002 g / L of CoCl2·6H2O, 0.0017 g / L of MnSO4·H2O, and 0.0014 g / L of ZnSO4·7H2O; Preferably, the conditions for culturing in the seed medium are: 200 rpm, 30 o C for 24 h; Preferably, the conditions for culturing in the fermentation medium are: 30 o C for 7 d.

9. Use according to claim 8, wherein the compound is ###0008### The method for preparing the mixed solution by the crude enzyme solution of the high β-glucosidase-producing Trichoderma reesei engineering strain after fermentation in catalyzing the transglycosylation reaction of glucose comprises the following steps: The mixed solution is prepared by the crude enzyme solution of the high β-glucosidase-producing Trichoderma reesei engineering strain after fermentation in catalyzing the transglycosylation reaction of glucose; Preferably, the conditions of the transglycosylation reaction comprise the following steps: Preferably, the conditions of the transglycosylation reaction comprise the following steps: The dosage of the high-yield β-glucosidase Trichoderma reesei engineering bacteria crude enzyme solution is 20-25 IU / g glucose in terms of β-glucosidase, preferably 20 IU / g glucose; the catalytic temperature is 60-70 ℃, preferably 65 ℃; the catalytic pH is 4.5-5, preferably 4.8; and the reaction time is 24-36 h, preferably 24 h.

10. The high-yield β-glucosidase Trichoderma reesei engineering bacteria of claim 1 or the high-yield β-glucosidase Trichoderma reesei engineering bacteria constructed by the construction method of any one of claims 2-6 are applied to fermentation production of cellulase.

Images