Modified gRNA and method for producing heat-resistant dairy cow through gene editing

Abstract

The invention discloses a modified gRNA and a method for producing heat-resistant dairy cows through gene editing, and belongs to the technical field of gene engineering. The gRNA is formed by connecting the 3'end of an sgRNA sequence with a scaffold sequence; the modification comprises adding reverse deoxythymidine at the 3'end of the sgRNA sequence and introducing a thiophosphate bond at the 5 'end, and further comprises a PNA sequence. The gene editing rate of the modified gRNA sequence is as high as 56.02%, the gene editing efficiency reaches 88.60% by combining with a specific PNA sequence after modification, the PRLR gene can be efficiently and accurately edited, and the prepared RPLR- / -somatic cell nuclear transfer embryo carrying chr20: 39099191-3909926777bpdel mutation and having the amino acid sequence subjected to p.Ala464 * truncated mutation powerfully improves the production success rate of gene edited cattle.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a modified gRNA and a method for producing heat-resistant dairy cows through gene editing. BACKGROUND

[0002] Cattle are sensitive to high temperature and high humidity environment, and are prone to induce heat stress, which has negative effects on their growth, lactation, reproduction, health and other traits. It is estimated that the economic loss caused by heat stress to the livestock industry is up to 2.5 billion US dollars per year. Due to global warming, the harm of heat stress to livestock is likely to be exacerbated, leading to a shortage of animal food supply and threatening food security. How to deal with the problem of heat stress caused by high temperature and high humidity environment is still a worldwide problem.

[0003] From the perspective of genetic improvement, breeding or creating heat-resistant cattle germplasm is an important way to ultimately solve the problem of the industry. The Senepol, a local cattle breed from the Americas, has short and sparse hair, smooth hair and other characteristics, and its heat resistance is better than that of other breeds. By crossing with these breeds, the ability of cattle to regulate body temperature in high temperature environment can be improved, and new heat-resistant germplasm can be bred. However, in order to stabilize the excellent traits of the original germplasm, decades of cultivation of multiple generations are needed.

[0004] Littlejohn et al. found that the functional mutation of Senepol cattle short hair trait is located in the 11th exon of the prolactin receptor (RPLR) gene, i.e., chr20: 39136558 GC>G (Genome data version Bos taurus UMD3.1) leading to a premature termination (p.Leu462*) (Littlejohn MD, Henty KM, Tiplady K, et al. Functionally reciprocal mutations of the prolactin signalling pathway define hairy and slick cattle. Nat Commun. 2014. 18;5:5861). It was reported that dairy cows carrying this natural mutation by crossing with Senepol cattle have good heat tolerance, and their production is not affected by high temperature in summer (Dikmen S, Khan FA, Huson HJ, et al. The SLICK hair locus derived from Senepol cattle confers thermotolerance to intensively managed lactating Holstein cows. J Dairy Sci. 2014. 97(9):5508-20), providing a new strategy for breeding heat-resistant germplasm. At the same time, the discovery of the functional mutation of heat tolerance performance also provides an important gene resource for creating heat-resistant gene editing cattle germplasm. The U.S. Food and Drug Administration (FDA) has given a low safety risk evaluation for PRLR gene editing cattle related products, so this gene editing cattle has broad industrial application prospects.

[0005] PRLR-mediated prolactin signaling pathway has physiological functions of promoting mammary gland development and growth, stimulating and maintaining lactation, and regulating hair growth. The PRLR protein has multiple tyrosine phosphorylation modification sites in the domain distribution in the cell, which is responsible for transmitting the signal of prolactin binding. The p.Leu462* truncation mutation of Senepol cattle is located between p.Y407, p.Y427, p.Y431, p.Y433, p.Y512 and p.Y543, which retains the tyrosine phosphorylation modification sites upstream, so that the signaling pathway can still partially function (Porto-Neto LR, Bickhart DM, Landaeta-Hernandez AJ, et al. Convergent Evolution of Slick Coat in Cattle through Truncation Mutations in the Prolactin Receptor. Front Genet. 2018. 23;9:57). Therefore, only the precise editing of the site can achieve the purpose of constructing heat-resistant gene editing germplasm under the premise of retaining the important physiological functions of PRLR, which is the difficulty in the current production of gene edited cattle. SUMMARY

[0006] The purpose of the present application is to provide a modified gRNA which can precisely edit the site of the PRLR gene, and then be used to produce heat-resistant dairy cattle with the same effect as the natural mutation of p.Leu462* truncation of PRLR gene, and cultivate new heat-resistant germplasm.

[0007] The technical scheme of the present application is described as follows: In a first aspect, the present application provides a modified gRNA, which is composed of the 3' end of sgRNA sequence shown in SEQ ID NO: 1 connected with the scaffold sequence shown in SEQ ID NO: 2. The modification includes adding 3' Inverted Deoxythymidine (3' idT) to the 3' end of the sgRNA sequence and introducing 5' Phosphorothioate (PS) Linkages between the 3 bases at the 5' end; and further including the PNA sequence shown in SEQ ID NO: 3. The PNA sequence is a complementary sequence designed for the sequence upstream of the PAM region of the sgRNA sequence.

[0008] SEQ ID NO: 1: TCCTTCCCTGCCAGTTTCAA; SEQ ID NO: 2: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0009] SEQ ID NO: 3: aaactggcagggaagga.

[0010] The gRNA (guide RNA) is composed of two parts: an sgRNA (single guide RNA) sequence and a scaffold sequence. The sgRNA is responsible for recognizing and guiding the Cas9 protein to cut the target DNA sequence, and the scaffold is used to bind with the Cas9 protein and improve the editing efficiency. The 3' end of the sgRNA is connected with the Scaffold sequence to form the gRNA.

[0011] Optionally or preferably, the modified gRNA described above also adds 2'-O-methyl to the seed sequence cagttta of the sgRNA.

[0012] In a second aspect, the application provides the use of the modified gRNA described above in the production of PRLR gene mutation heat-resistant dairy cows.

[0013] In a third aspect, the application provides a method for producing heat-resistant dairy cows by gene editing, comprising the following steps: (1) introducing the modified gRNA, Cas9 protein and reporter gene vector described above into bovine BFF cells by RNP electroporation, and obtaining positive clone cells by reporter gene expression screening; (2) extracting DNA from the positive clone cells for sequencing to screen PRLR - / - gene editing BFF cells, PRLR gene is based on the bovine ARS-UCD2.0 version; (3) injecting the PRLR - / - gene editing BFF cells into the perivitelline space under the zona pellucida of the enucleated mature donor oocyte to obtain a reconstructed embryo, 5-10 reconstructed embryos are used as a group for embryo fusion and activation, and then cultured in vitro, and the non-cleavage embryos are removed during the culture process to obtain PRLR - / - somatic cell nuclear transfer embryos; (4) transplanting the PRLR - / - somatic cell nuclear transfer embryos into the uterus of a recipient cow in estrus by non-surgical method, and the calf produced is a PRLR gene site mutation heat-resistant dairy cow.

[0014] Optionally or preferably, in the above method, the dairy cow is a Holstein cow.

[0015] In a fourth aspect, the present application provides another method for producing heat-tolerant dairy cows by gene editing, comprising the following steps: (1) introducing the modified gRNA, Cas9 protein, reporter gene and donor DNA fragment vector with chr20:39099191-39099267_77bp_del mutation of claim 1 or 2 into bovine BFF cells by RNP electroporation, and obtaining PRLR with chr20:39099191-39099267_77bp_del mutation by reporter gene expression screening - / - Gene editing BFF cells; The nucleotide sequence of the donor DNA fragment is shown in SEQ ID NO: 4; (2) injecting the PRLR - / - Gene edited BFF cells into the perivitelline space of the zona pellucida of the enucleated mature donor oocyte to obtain a reconstructed embryo, 5-10 reconstructed embryos are used as a group for embryo fusion and activation, and then cultured in vitro, and the non-cleavage embryos are removed during the culture process to obtain PRLR - / - Somatic cell nuclear transfer embryos; (3) PRLR - / - The somatic cell nuclear transfer embryos are transplanted into the uterus of a recipient cow in estrus by a non-surgical method, and the calf produced is a PRLR gene site mutation heat-tolerant dairy cow.

[0016] The donor DNA fragment deletes 77 bases of chr20:39099191-39099267, and the purpose is to efficiently and accurately obtain BFF cells with chr20:39099191-39099267_77bp_del mutation by HDR.

[0017] Compared with the prior art, the present application has the following beneficial effects: The gene editing (insertion and deletion) efficiency of the gRNA sequence provided by the present application is as high as 56.02%, and after modification, combined with the PNA sequence provided by the present application, the gene editing efficiency reaches 88.60%, which can efficiently and accurately edit the PRLR gene, thereby retaining the upstream modification sites p.Y407, p.Y427, p.Y431 and p.Y433 of the PRLR gene, and deleting the downstream modification sites p.Y512 and p.Y543 of the PRLR gene. The cleavage proportion and blastocyst development rate of the obtained mutant cells are higher than those of wild-type embryo cells, thereby effectively improving the production success rate of gene edited cows.

[0018] In addition, the donor DNA fragment provided by the present application can directly introduce the chr20:39099191-39099267_77bp_del mutation site into the PRLR gene of Holstein cows through homology-mediated repair, thereby further improving the success rate of gene editing of cows.

[0019] The PRLR gene site mutation heat-resistant cow produced by the method has the same phenotype as the p.Leu462* truncation mutation (natural mutation) of Senepol cows, does not affect the tyrosine phosphorylation signal pathway, has a short hair characteristic, and has good heat adaptability. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 It is an agarose gel electrophoresis diagram of the PCR product of the mixed sample cells in Example 1. Note: 1-3: gRNA1 group; 4-6: gRNA2 group; 7-9: gRNA3 group; 10: water, negative control group.

[0021] Figure 2 It is a statistical result diagram of the gene editing efficiency of the three groups of gRNA in Example 1.

[0022] Figure 3 It is a statistical result diagram of the Indel efficiency of the gRNA added with different modifications in Example 2.

[0023] Figure 4 It is a sequencing peak diagram of the 10# homozygous monoclonal cells in Example 3.

[0024] Figure 5 It is a culture photo of the 10# homozygous monoclonal cells in Example 3.

[0025] Figure 6 It is a comparison of the amino acid sequences of different PRLR genotypes in Example 3.

[0026] Figure 7 It is a photo of the construction and development process of the PRLR gene edited embryo in Example 4, wherein A is the micro-operation process of constructing the PRLR gene edited somatic cell nuclear transfer embryo; B is the PRLR gene edited embryo developed to the blastocyst stage.

[0027] Figure 8 It is a photo of the appearance characteristics of the PRLR - / - and PRLR + / + somatic cell nuclear transfer calf. DETAILED DESCRIPTION

[0028] For those skilled in the art to better understand the present application, the present application will be described clearly and completely in conjunction with the embodiments and drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor should fall within the scope of protection of the present application. The instruments and reagents used in the embodiments are from commercial channels, unless otherwise specified.

[0029] Example 1 Screening of high-efficiency gRNA near bovine PRLR gene chr20: 39099213 GC>G 1.1 Precise positioning of bovine PRLR gene chr20: 39136558 GC>G It has been previously reported that, based on the Bos taurus UMD3.1 (GCA_000003055.5) genome data, the mutation site of the PRLR gene related to the short hair trait of cattle is chr20: 39136558 GC>G; based on NM_001039726.2, the mutation site in the CDS region is c.1381 GC>G; and based on NP_001034815, the amino acid mutation type is p.A461V and p.L462*, which causes a truncation mutation.

[0030] In the present application, based on the ARS-UCD2.0 version of the genome data of cattle, the site chr20: 39136558 GC>G is repositioned to chr20: 39099213 GC>G; based on NM_001039726.2, the mutation site in the CDS region is c.1381 GC>G; and based on NP_001034815, the amino acid mutation type is p.Ala461Val and p.Leu462* truncation mutation. Hereinafter, the mutation of the short hair trait of cattle is indicated by the site chr20: 39099213 GC>G.

[0031] 1.2 gRNA design near the site chr20: 39099213 GC>G of the PRLR gene In the present application, gene targeting is carried out by RNP electroporation, and the main components are Cas9 protein and gRNA sequence, wherein the gRNA includes sgRNA sequence and scaffold sequence.

[0032] First, the sgRNAs around the mutation site within 200bp upstream and downstream were predicted using the CHOPCHOP website, and finally three sgRNAs were selected for targeting experiments. The sequences of the sgRNAs are shown in Table 1. The 3' end of the sgRNA was connected to the Scafflod sequence to form a gRNA. The gRNAs were named gRNA1, gRNA2 and gRNA3. The gRNA sequence was sent to the Bioengineering Co., Ltd. for synthesis.

[0033] Table 1 sgRNA design of PRLR gene 1.3 Screening of efficient gRNA 1.3.1 Preparation before electroporation The ribonucleoprotein (RNP) electroporation technology was used to introduce Cas9 protein and gRNA into Bovine Fetal Fibroblast (BFF) cells to evaluate the editing efficiency of gRNA. First, primary BFF cells were isolated and cultured by tissue block method, and BFF cells were inoculated in 6-well cell culture plates. When the cells grew to 80% confluence, they were used for subsequent electroporation experiments. The BFF cell culture medium was 90% DMEM (No. 11995073, Thermo), 10% FBS (No. 10091148, Thermo) and 1x Penicillin-Streptomycin (No. 15140122, Thermo). The electroporator (Nucleofector TM 2b, Lonza) and the electroporation kit (VPI-1002, Lonza) were used for electroporation, and the electroporation program was U-023. Cas9 protein was TrueCut HiFi Cas9 protein (A50574, Thermo).

[0034] 1.3.2 Electroporation and flow sorting The electroporator was turned on before RNP electroporation and set to U-023 program.

[0035] The electroporation work mainly consists of five steps: The first step is to prepare the VPI working solution. Add the Supplement solution to the Primary Cell Nucleofector™ Solution to prepare the Complete Primary Cell Nucleofector™ Solution (referred to as "Solution solution").

[0036] Second step, assemble RNP complex, resuspend to 1 μg / μl with RNase-free water, mix 3 μg Cas9 protein with 5 μg gRNA (each gRNA is separately electroporated), the final volume should not exceed 10 μl. Mix gently, incubate at room temperature for 10-20 min. Then add 0.5 μg pmax-GFP plasmid (which can express green fluorescent protein), mix gently.

[0037] Third step, prepare single cell suspension, digest into single cells with 0.25% trypsin (No. 15050065, GIBCO), take 1 × 10 6

[0038] Fourth step, electroporation, gently mix 100 μl cell suspension with the pre-assembled RNP complex in a 1.5 mL centrifuge tube, the total volume should not exceed 110 μl, transfer the cell-RNP mixture into an electroporation cup, cover the lid to avoid air bubbles, place the electroporation cup into the cup slot of the electroporator, make sure the metal surface is in good contact (three repeats for each gRNA).

[0039] Fifth step, collect and culture cells, after electroporation, the cells are plated into a 6-well plate and 3 ml of culture medium is added for culture for 24-48 h, then digested into single cells, and the cells with green fluorescent protein (GFP) are screened by flow cytometry.

[0040] 1.3.3 Detection of targeting efficiency Extract genomic DNA from the above flow-sorted GFP-positive cells, and detect the targeting efficiency of the mixed sample. Design primers upstream and downstream of the target site, perform PCR amplification product sequencing, and the primer sequences are shown in Table 2.

[0041] Table 2 PRLR gene editing identification primers The mix for PCR amplification is 2 × Taq Master Mix (P112, Novozyme), and the amplification system is: 2 × Taq MasterMix: 25 μl, PRLR-TF (10 μM): 2 μl, PRLR-TR: 2 μl, Template DNA: 0.1-1 μg, add ddH2O to a final volume of 50 μl. PCR amplification program: pre-denaturation: 95℃ 3 min; 35 cycles of amplification: 95℃ 15 s, 55℃ 15 s; 72℃ 53 s; extension: 72℃ 5 min; 4℃ storage.

[0042] ​PCR products were detected by agarose gel electrophoresis, see Figure 1 , and it was found that the amplified band was single and the size was between 800-1000 bp, which was consistent with the expectation.

[0043] The PCR products were subjected to Sanger sequencing, and the sequencing results were uploaded to the Decodr website (https: / / decodr.org / ) for gene editing efficiency statistics. The results are shown in Figure 2 , and the statistics showed that the indel efficiency of gRNA1, gRNA2 and gRNA3 was 36.35%, 41.17% and 56.02% respectively. It is shown that the three sgRNAs all have targeting efficiency of cutting DNA, and the efficiency of gRNA3 is significantly higher than that of gRNA1 and gRNA2.

[0044] Example 2 Effect of different modification types of gRNA on gRNA targeting efficiency 2.1 Design and synthesis of gRNA with different modification types On the basis of screening the optimal gRNA, three modifications were added to gRNA3 in the present application: The first one is gRNA3-3'idT-5'PS, that is, 3' idT is added to the first three bases at the 3' end of the gRNA3 nucleotide sequence, and a phosphorothioate bond (PS) is introduced between the first three nucleotides at the 5' end. Marked as group B.

[0045] The second one is gRNA3-3'idT-5' PS-2'-OMe, which is based on the first modification, that is, 3'idT + 5'PS is added, and then 2'-OMe is added to the seed sequence "cagtttca" of sgRNA. Marked as group C.

[0046] The third one is to design a complementary PNA (18nt) sequence upstream of the PAM region of the sgRNA sequence of gRNA3, which is aaactggcagggaagga. The third modification is superimposed on the first and second modifications, respectively. The first modification is based on the addition of PNA sequence to group B, which is marked as group D. The second modification is based on the addition of PNA sequence to group C, which is marked as group E.

[0047] The above gRNAs with modifications and PNA sequences were synthesized by Sheng Wu Biotechnology Co., Ltd.

[0048] 2.2 Comparison of targeting efficiency of gRNAs with different modification types The gRNAs with modifications, Cas9 protein and PNA were introduced into bovine BFF cells by RNP electroporation, and the high-efficiency gRNA modification was screened by identifying the targeting efficiency in the mixed sample cells. The electroporation scheme is shown in Table 3, which is divided into groups A, B, C, D and E.

[0049] Table 3. Electroporation protocol Note: pmax-GFP is a commonly used reporter gene vector in CRISPR / Cas9 gene editing system.

[0050] The preparation and specific steps of electroporation are shown in 1.3.1 and 1.3.2. When assembling the RNP complex, add 3 μg of gRNA and 5 μg of Cas9 protein in groups A-C. After the RNP complex is assembled, add 0.5 μg of pmax-GFP, and then mix with the cell suspension to perform electroporation. In addition, the RNP complex assembly steps of groups D and E are the same as those of groups A-C. After the RNP complex is assembled, add 10 μM PNA and 0.5 μg of pmax-GFP, and then mix with the cell suspension to perform electroporation. Each group of electroporation is repeated 3 times.

[0051] After each group of cells is electroporated, they are plated into 6-well cell culture plates for further culture. After 6 h, the medium is changed, and after 24-48 h of culture, the GFP-positive cells are sorted by flow cytometry. The genomic DNA is extracted, and the mixed sample is identified for targeting efficiency. PCR amplification is performed by PRLR-TF and PRLR-TR primers in Table 2. The PCR products are subjected to Sanger sequencing, and the sequencing results are uploaded to the Decodr website (https: / / decodr.org / ) for gene editing efficiency statistics.

[0052] Statistical analysis shows that the indel efficiency of groups B, C, D, and E is significantly higher than that of the control group A, indicating that the modification of gRNA can significantly improve the targeting efficiency. Groups D and E are significantly higher than groups B and C (P<0.05), indicating that the addition of PNA can significantly improve the targeting efficiency of gRNA. The indel efficiency of group E is significantly higher than that of group D (P<0.05), indicating that the 2'-OMe modification of gRNA 3 seed sequence and the addition of PNA have better effects on improving the targeting efficiency of gRNA (see Table 4). Figure 3

[0053] Table 4. Indel efficiency statistics of gRNA with different modifications Note: The indel efficiency of each group is the average value of 3 repeats.

[0054] The above results show that for the RNP experiment of bovine fetal fibroblasts, group E with 3' idT + 5' PS + seed sequence 2'-OMe + PNA is the best modification type.

[0055] Example 3. Screening of effective targeting monoclonal cells​ Low passage Holstein BFF cells were electroporated with D and E group transfection conditions. Cell amount was 5x10 7 After 48h transfection, cells were digested into single cells, then BFP positive cells were enriched by flow cytometry sorting. After 24h culture in 96-well cell culture plates, the sorted cells were digested into single cell suspension, and the mixed sample single cell suspension was cultured by limiting dilution method, 200 cells were plated in each 10cm dish, 30 dishes for each group, 15ml medium was added to each dish, and the single cell clones at the bottom of the dish were observed after 7 days of culture. It was found that the cell clone spot density was appropriate, the clone spot was single, the edge was clear, and the cell growth was good. The single and larger clone spots were circled and covered with a cloning ring, and then trypsinized and transferred to 96-well plates for 2-3 days of culture. The full wells were digested and passaged, 1 / 3 of the cells in each well were used for genomic DNA extraction and PCR amplification and sequencing, and 2 / 3 of the cells were cultured in 96-well cell culture plates. See Table 5 for details.

[0056] Table 5 Screening of pure mutant monoclonal cells After extracting the DNA of the monoclonal cells, the gene editing was analyzed by PCR product Sanger sequencing method, in which the primers were PRLR-TF and PRLR-TR of Table 2, and the amplification system was the same as that in step 1.3.3.

[0057] Table 6 Mutation site and amino acid truncation type of pure mutant monoclonal cells The PCR sequencing results were uploaded to the Decodr website, and the analysis results showed that 16 strains of good condition homozygous mutations were obtained in groups D and E, in which 10#, 29#, 79#, 120# and 145# positive clones had a deletion of 77 bases in the region chr20:39099191-39099267, marked as chr20:39099191-39099267_77bp_del, and the amino acid sequence truncation type was p.A464*. Taking the 10# monoclonal as an example, the sequencing peak chart is shown in Figure 4 , and the cell state is shown in Figure 5 .

[0058] By comparing the PRLR protein amino acid sequences of WT (wild type), chr20: 39099213GC>C and chr20:39099191-39099267_77bp_del, the results are shown in Figure 6The amino acid mutation at position 464 of the chr20:39099191-39099267_77bp del mutation type is a stop codon (p.A464*) compared with the WT, which results in a truncation mutation. The mutation retains the p.Y407, p.Y427, p.Y431, and p.Y433 tyrosine phosphorylation modification sites upstream of the PRLR gene, deletes the p.Y512 and p.Y543 modification sites, and does not add new tyrosine modification sites. Therefore, the p.A464* mutation site is closer to the natural mutation p.L462* site, and therefore the 10#, 29#, 79#, 120#, and 145# positive monoclonal cells are transferred to a 48-well plate for culture, cryopreservation, and direct use in subsequent somatic cell nuclear transfer.

[0059] Example 4: Efficient and precise acquisition of BFF cells with chr20:39099191-39099267_77bp del homozygous mutation by HDR 4.1 Design of donor double-stranded DNA fragment and synthesis Through Example 3, we obtained BFF cells with chr20:39099191-39099267_77bp del. Therefore, we developed a method for introducing the chr20:39099191-39099267_77bp del mutation site into the PRLR gene of Holstein cows by homology directed repair (HDR).

[0060] The 1000 bp upstream and downstream of the chr20:39099191-39099267_77bp del mutation site of the bovine PRLR gene was selected as the left and right homologous arms, and the genotype of the donor DNA fragment was chr20:39099191-39099267_77bp del, as shown in SEQ ID NO: 4. PacI (TTAATTAA) and AscI (CGCGCC) restriction enzyme sites were added at the 5' and 3' ends, respectively, and the sequence after connecting the restriction enzyme sites at both ends is shown in SEQ ID NO: 9, labeled as bPRLR-Donor. The bPRLR-Donor sequence was sent to a company for synthesis, and the synthesized plasmid was added to the pUC57 cloning plasmid. The bPRLR-Donor sequence was cut off by PacI (R0547, NEB) and AscI (R0558, NEB) double enzyme digestion, and after purification by a gel recovery purification kit, the concentration was measured and stored at -20°C for RNP transfection experiments.

[0061] bPRLR-Donor (SEQ ID NO: 9): TTAATTAACGCGCC, the underlined part is the sequence of enzyme cutting site.

[0062] 4.2 Screening of gRNA modification for efficient integration of HDR On the basis of the electroporation scheme in Table 3, the bPRLR-Donor was added by RNP electroporation to precisely delete 77bp of chr20:39099191-39099267 by HDR repair. In order to compare the effects of different modified gRNAs on the HDR integration efficiency of bPRLR-Donor, five combinations were designed. On the basis of groups A, B, C, D and E, the bPRLR-Donor was added respectively, named A+, B+, C+, D+ and E+, and the specific electroporation scheme is shown in Table 7. The specific electroporation steps are shown in 1.3.1 and 1.3.2, in which 3 μg of PRLR-Donor was added to each group.

[0063] Table 7 HDR-based RNP electroporation scheme After electroporation, the GFP-positive cells were sorted by flow cytometry after 24-48h of culture. After sorting, the cells were plated into cell culture plates and cultured for another 24-48h, after which the cells were collected and genomic DNA was extracted. PCR amplification was performed by PRLR-TF and PRLR-TR primers. The PCR products were subjected to Sanger sequencing, and the sequencing results were uploaded to the Decodr website (https: / / decodr.org / ) for statistical analysis of the HDR integration efficiency, and the results are shown in Table 8.

[0064] Table 8 Statistical analysis of the HDR integration efficiency of bPRLR-Donor with different modified gRNAs Note: The indel efficiency of each group is the average of 3 replicates.

[0065] Statistical analysis found that the proportion of chr20:39099191-39099267_77bp_del mutation type was higher in the mixed cells of groups D+ and E+, i.e. the HDR integration efficiency was higher, which was 43.16% and 49.02% respectively (see Table 8). This method can be used to screen PRLR - / - Gene editing BFF cells screening.

[0066] Example 5 Obtaining chr20:39099191-39099267_77bp_del embryos by somatic cell nuclear transfer 5.1 Preparation of gene editing donor cells The PRLR - / -(chr20:39099191-39099267_77bp_del) gene edited BFF cells (i.e. donor cells, which can be obtained using the screening of Example 3 or using the homologous recombination of Example 4, both PRLR - / - edited sequence) and PRLR + / + After thawing, the BFF cells (wild type) were plated in 60 mm cell culture dishes. The gene edited donor cells and wild type cells were cultured until confluence. Before transplantation, the culture medium was removed and the cells were washed with PBS (Gibco, 10010-023), then digested with 1 mL TrypLE digestion solution (Thermo Fisher, 12604013) for 5 minutes, and collected by blowing with 2 mL Hepes operation solution. After centrifugation (250 x g, 5 min) and resuspension in 200 μL HEPES operation solution, the cells were ready for use. The formula of the Hepes operation solution is 114 mM NaCl, 3.2 mM KCl, 2 mM CaCl2, 0.5 mM MgCl2, 0.1 mM Sodium pyruvate, 2 mM NaHCO3, 10 mM HEPES, 17 mM Sodium lactate, 1% volume ratio of 100 x MEM non-essential amino acids (Gibco, 11140050), 1% volume ratio of 100 x penicillin-streptomycin (Gibco, 15140148), 3 mg / mL BSA (Sigma, A1933), pH 7.3-7.4.

[0067] 5.2 Micro-operation needle preparation The holding needle, enucleation needle and transplantation needle were all made of borosilicate glass capillary. The needle embryo was processed using a needle pulling instrument (Sutter, P-1000), a needle calcining instrument (Narishige, MF-830) and a needle grinding instrument (Narishige, EG-401) to make a holding needle with an inner diameter of about 30 μm, an enucleation needle with an inner diameter of 15-18 μm and a sharp spike, and a transplantation needle with an inner diameter of 20-35 μm. The glass debris was removed by 70% ethanol flushing.

[0068] 5.3 Oocyte maturation Oocytes were derived from slaughterhouse ovaries, and cumulus-oocyte complexes were collected by aspiration of 2-8 mm follicular fluid with an 18G needle. Oocytes were matured in vitro for 20-22 h at 38.5°C in 5% CO2 and saturated humidity using oocyte maturation medium. The oocyte maturation medium formula: the base medium was Medium 199 (Sigma, M5017), supplemented with 10% volume fetal bovine serum (Gibco, 10099141), 0.01 U / ml FSH (Solarbio, F8470), 0.01 U / ml FSH (Solarbio, L8040), 1 μg / mL estradiol (Sigma, E8875), 22 μg / mL sodium pyruvate (Sigma, P5280), 1% volume 100 x penicillin-streptomycin (Gibco, 15140148).

[0069] 5.4 Oocyte enucleation After in vitro maturation of oocytes, cumulus cells were removed with 1 mg / mL hyaluronidase (Sigma, H3506), and oocytes with the first polar body were selected and placed in Hepes manipulation medium containing 5 μg / mL Hoechst 33342 (Sigma, B2261), 5 μg / mL cytochalasin B (Sigma, C6762). Under ultraviolet fluorescence microscopy, polar bodies and chromosomes were sucked out to obtain enucleated oocytes.

[0070] 5.5 Somatic cell nuclear transfer 10 μL of the above-mentioned gene editing donor cell resuspension was dropped into the Hepes manipulation medium, and small and smooth cells were sucked up using a transfer needle and injected into the perivitelline space of the enucleated oocyte. After injection, the reconstructed embryo was transferred into KSOM medium (Millipore, MR-101-D) for standby.

[0071] 5.6 Embryo fusion and activation 5-10 reconstructed embryos per group were transferred into the electric fusion solution, and a single direct current pulse was applied using an electric fusion instrument (BTX2001) with an intensity of 2 kV / cm and a duration of 15 μs. The electric fusion solution formula: 250 mM sorbitol (Sigma, S1876), 0.5 mM MgOAc (Sigma, M5661), 1 mg / mL BSA (Sigma, A2153), pH 7.2.

[0072] The complex was arranged between electrodes, and a single direct current pulse (2 kV / cm, 15 μs) was given, and then transferred into KSOM medium. 2-4 h after electrofusion, chemical activation was performed, i.e., the reconstructed embryo was placed in Hepes operation solution containing 5 μM ionomycin (Sigma, I0634) for 4 min, and then transferred into KSOM medium containing 2 mM 6-DMAP (Sigma, D2629) for 4 h.

[0073] 5.7 Embryo culture After chemical activation, the embryos were washed 3 times in KSOM medium (Millipore, MR-101-D) and then cultured in vitro under the conditions of 38.5°C, 5% CO2, 5% O2, and 90% N2. The cleavage rate was recorded 48 h after in vitro culture, and the non-cleaved embryos were removed. FBS was added to the culture medium at a volume ratio of 5% at 72 h of in vitro culture. The number of blastocysts was recorded on the 7th day of in vitro culture.

[0074] 5.8 Embryo transfer The constructed PRLR - / - and PRLR + / + The somatic cell nuclear transfer embryos were transplanted into the uterus of a recipient cow in estrus by a non-surgical method. Each recipient cow was transplanted with 2 embryos. According to the luteal status of the ovary, the transplantation side of the embryo in the uterus was determined. PRLR - / - and PRLR + / + The number of transplanted somatic cell nuclear transfer embryos was 20 and 22, respectively.

[0075] 5.9 Experimental results The PRLR - / - (chr20:39099191-39099267_77bp_del) gene edited BFF cell was used to construct somatic cell nuclear transfer embryos, of which 22 developed to the blastocyst stage, and the blastocyst development rate was 41.5%; the PRLR + / + Wild-type cells were used to construct 311 embryos, of which 84 developed to the blastocyst stage, and the blastocyst development rate was 27.0%. According to the Yates method, the chi-square statistical test analysis showed that the development ability of the PRLR - / - gene edited cell constructed somatic cell nuclear transfer embryos was significantly higher than that of the wild-type cell constructed somatic cell nuclear transfer embryos (P<0.05) (Table 6). Figure 7

[0076] Table 6 Development ability detection results of different somatic cell nuclear transfer embryos Note: Different letters represent significant differences (P<0.05). ​

[0077] Referring to Figure 8 , transplanted PRLR - / - One of the 10 recipient cows of somatic cell nuclear transfer embryos gave birth to a live calf. The PRLR - / - The somatic cell nuclear transfer calf showed a distinct feature of short hair. The PRLR + / + Two of the 11 recipient cows of somatic cell nuclear transfer embryos gave birth to live calves, which had longer hair and were not significantly different from ordinary cattle.

[0078] The specific examples are applied in the detailed description of the inventive concept, and the above examples are only used to help understand the core idea of the present application. It should be pointed out that any obvious modification, equivalent replacement or other improvement made by those skilled in the art without departing from the inventive concept should be included in the protection scope of the present application.

Claims

1. A modified gRNA, characterized in that, The gRNA is composed of the sgRNA sequence shown in SEQ ID NO:1 connected to the scafflod sequence shown in SEQ ID NO:2 at the 3' end; The modification includes adding reverse deoxythymidine to the 3' end of the sgRNA sequence, introducing a phosphate thioester bond between the 3' end bases, and also includes the PNA sequence shown in SEQ ID NO:

3.

2. The modified gRNA according to claim 1, characterized in that, A 2'-O-methyl group was also added to the seed sequence catttta of the sgRNA.

3. The application of the modified gRNA as described in claim 1 or 2 in the production of heat-resistant dairy cows with PRLR gene mutations.

4. A method for producing heat-resistant dairy cows through gene editing, characterized in that: Includes the following steps: (1) The modified gRNA, Cas9 protein and reporter gene vector described in claim 1 or 2 are introduced into bovine BFF cells by RNP electrotransfection, and positive cells are obtained by reporter gene expression screening; (2) DNA was extracted from positive clones and sequenced. PRLR clones were screened to obtain PRLR clones that retained the upstream modification sites p.Y407, p.Y427, p.Y431, and p.Y433 of the PRLR gene and deleted the downstream modification sites p.Y512 and p.Y543 of the PRLR gene. - / - Gene-edited BFF cells, with the PRLR gene based on bovine ARS-UCD 2.0 version; (3) PRLR - / - Gene-edited BFF cells are injected into the periplasmic space below the zona pellucida of an enucleated mature donor oocyte to obtain reconstructed embryos. Five to ten reconstructed embryos are grouped together for embryo fusion and activation, followed by in vitro culture. During culture, embryos without cleavage are discarded to obtain PRLR. - / - Somatic cell nuclear transfer embryos; (4)PRLR - / - Somatic cell nuclear transfer embryos are implanted into the uterus of a recipient cow during estrus using a non-surgical method, and the resulting calves are heat-resistant dairy cows with a site-directed mutation in the PRLR gene.

5. A method for producing heat-resistant dairy cows through gene editing, characterized in that: Includes the following steps: (1) By RNP electrotransfection, the modified gRNA, Cas9 protein, reporter gene and donor DNA fragment vector with the chr20:39099191-39099267_77bp_del mutation described in claim 1 or 2 were introduced into bovine BFF cells, and PRLR was obtained by reporter gene expression screening. - / - Gene-edited BFF cells; The nucleotide sequence of the donor DNA fragment is shown in SEQ ID NO:4; (2) PRLR - / - Gene-edited BFF cells are injected into the periplasmic space below the zona pellucida of an enucleated mature donor oocyte to obtain reconstructed embryos. Five to ten reconstructed embryos are grouped together for embryo fusion and activation, followed by in vitro culture. During culture, embryos without cleavage are discarded to obtain PRLR. - / - Somatic cell nuclear transfer embryos; (3)PRLR - / - Somatic cell nuclear transfer embryos are implanted into the uterus of a recipient cow during estrus using a non-surgical method, and the resulting calves are heat-resistant dairy cows with a site-directed mutation in the PRLR gene.

Images