PaNCED5, a functional gene regulating apricot fruit ripening, and its application

Abstract

This invention discloses a functional gene, PaNCED5, that regulates apricot fruit ripening. The nucleotide sequence of the PaNCED5 gene is shown in SEQ ID NO.1. This PaNCED5 gene can be used to regulate apricot fruit ripening by increasing its expression level to promote ripening or by inhibiting its expression to delay ripening. This functional gene, PaNCED5, can also be used to promote tomato fruit ripening or to regulate the content of abscisic acid (ABA) in plant tissues. This invention verifies that the PaNCED5 gene regulates apricot fruit ripening by controlling the ABA content in apricots; therefore, the PaNCED5 gene can be used in apricot breeding.

Description

Technical Field

[0001] This invention relates to the field of apricot fruit ripening regulation technology. Specifically, it relates to a functional gene PaNCED5 that regulates apricot fruit ripening and its applications. Background Technology

[0002] Apricots, an important economic forest tree species in northern regions, are not only delicious and brightly colored with a pleasant aroma, but also contain various organic components and essential vitamins and minerals, making them a highly nutritious fruit. With the continuous improvement of living standards and technological levels, people's demand for this nutritious and flavorful high-quality fruit is increasing. However, due to its relatively concentrated ripening time, with most fruits ripening in June and July, the supply period is only about 20-40 days. Observations have revealed that the main varieties cultivated in major planting areas, such as "Camel Yellow," "Yangshao Yellow Apricot," "Xiaobai Apricot," "Pearl Oil Apricot," and "Liguang Apricot," have a product supply period of only about 20 days. This long shelf-life significantly reduces the commercial value of apricots, severely disrupts the market supply and demand balance, and also hinders the healthy development of the apricot industry.

[0003] Therefore, breeding apricot varieties with different maturity periods is key to meeting the market demand for apricots in my country. However, selecting suitable early, mid, and late-maturing varieties has significant commercial value and research significance for extending the fruit supply period. The expression pattern and functional role of the PaNCED5 gene in apricot fruits are still unclear, and its effect on changes in fruit maturity caused by regulating ABA content is rarely reported. Summary of the Invention

[0004] Therefore, the technical problem to be solved by this invention is to provide a functional gene PaNCED5 that regulates the ripening of apricot fruits, and to verify that the PaNCED5 gene regulates the ripening of apricot fruits by regulating the content of ABA in apricots. Therefore, the PaNCED5 gene can be used in apricot breeding to promote the ripening of apricot fruits.

[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0006] A functional gene, PaNCED5, that regulates apricot fruit ripening is described in SEQ ID NO.1.

[0007] CDS sequence of the PaNCED5 gene (SEQ ID NO.1):

[0008]

[0009] The above-mentioned functional gene PaNCED5, which regulates apricot fruit ripening, has an amino acid sequence of the protein encoded by the PaNCED5 gene as shown in SEQ ID NO.2.

[0010] The amino acid sequence of the protein encoded by the PaNCED5 gene (SEQ ID NO.2):

[0011] *

[0012] An application of the functional gene PaNCED5 that regulates apricot fruit ripening: The aforementioned functional gene PaNCED5 that regulates apricot fruit ripening is used to regulate apricot fruit ripening. Apricot fruit ripening is promoted by increasing the expression level of the PaNCED5 gene, or fruit ripening is delayed by inhibiting the expression of the PaNCED5 gene.

[0013] The above-mentioned functional gene PaNCED5, which regulates apricot fruit ripening, was applied to the breeding of early-maturing apricots.

[0014] The application of the aforementioned functional gene PaNCED5, which regulates apricot fruit ripening, involves introducing the recombinant overexpression vector of PaNCED5 into apricot fruits via Agrobacterium tumefaciens, thereby increasing the expression level of the PaNCED5 gene in apricot fruits and promoting apricot fruit ripening.

[0015] In the application of the functional gene PaNCED5 that regulates apricot fruit ripening, when constructing the recombinant overexpression vector, PCR amplification was performed using primers shown in SEQ ID NO.3 and SEQ ID NO.4; the original vector used was the PHG plasmid, and the CDS sequence of the PaNCED5 gene was located between the BamHI and PstI restriction sites of the PHG plasmid; the primers used for quantitative PCR of the PaNCED5 gene were shown in SEQ ID NO.5 and SEQ ID NO.6.

[0016] The nucleotide sequence of SEQ ID NO.3:

[0017] The nucleotide sequence of CTCTCTCTCAAGCTTGGATCCATGGCTGCTCTTCCAAAAGCACCCSEQ ID NO.4:

[0018] ACGGGTCATGAGCTCCTGCAGTGCCTGATTTGCCAAGTCCTTTG

[0019] The nucleotide sequence of SEQ ID NO.5 is: AACTCGGTTCGCATACCTCG

[0020] The nucleotide sequence of SEQ ID NO.6 is: GTCGTCTTCCGATGAACCCA

[0021] An application of the functional gene PaNCED5 that regulates apricot fruit ripening: The aforementioned functional gene PaNCED5 that regulates apricot fruit ripening is used to promote tomato fruit ripening.

[0022] The above-mentioned functional gene PaNCED5, which regulates apricot fruit ripening, was applied by using a recombinant overexpression vector of PaNCED5 to genetically transform 'Micro-Tom' tomatoes via Agrobacterium tumefaciens, thereby promoting the ripening of 'Micro-Tom' tomatoes.

[0023] In the application of the functional gene PaNCED5 that regulates apricot fruit ripening, when constructing the recombinant overexpression vector, the primers shown in SEQ ID NO.3 and SEQ ID NO.4 were used for PCR amplification. The original vector used was the PHG plasmid, and the CDS sequence of the PaNCED5 gene was located between the BamHI and PstI restriction sites of the PHG plasmid. The primers used for quantitative PCR of the PaNCED5 gene are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0024] An application of the functional gene PaNCED5 that regulates apricot fruit ripening: The aforementioned functional gene PaNCED5 that regulates apricot fruit ripening is used to regulate the content of abscisic acid in plant tissues.

[0025] The technical solution of the present invention achieves the following beneficial technical effects:

[0026] This invention verifies the function of the PaNCED5 gene in apricot and discovers for the first time that the PaNCED5 gene promotes fruit ripening by increasing the content of abscisic acid (ABA) in apricot fruit. Therefore, the PaNCED5 gene can be used in the breeding of early-maturing apricots to shorten the ripening period of apricot fruit and promote ripening. Attached Figure Description

[0027] Figure 1 PHG plasmid maps used in the embodiments of this invention;

[0028] Figure 2 The PTRV2 plasmid map used in the embodiments of this invention;

[0029] Figure 3 Phenotypic comparison of 'Kate' apricot fruits before and after injection of empty PHG bacterial permeate and PHG-PaNCED5 bacterial permeate in this embodiment of the invention;

[0030] Figure 4 In this embodiment of the invention, a comparison chart of the changes in ABA content in 'Kate' apricot fruit after injection of PHG-PaNCED5 bacterial solution and control PHG empty bacterial solution permeate growth medium;

[0031] Figure 5 In this embodiment of the invention, the gene expression in the ABA metabolic pathway of the fruit after injection of bacterial permeate containing PHG-PaNCED5 and control PHG empty vector into 'Kate' apricot fruit was shown (p<0.001).

[0032] Figure 6 In this embodiment of the invention, a bacterial permeate growth medium containing PTRV1+PTRV2-PaNCED5 and a control PTRV1+PTRV2 empty vector was injected with the phenotype of 'Kate' apricot fruit;

[0033] Figure 7 In this embodiment of the invention, a comparison of the changes in ABA content in 'Kate' apricot fruit after injection of bacterial permeate growth medium containing PTRV1+PTRV2-PaNCED5 and control PTRV1+PTRV2 empty vector;

[0034] Figure 8 In this embodiment of the invention, the gene expression in the ABA metabolic pathway of the fruit after injection of PTRV1+PTRV2-PaNCED5 and control PTRV1+PTRV2 empty bacterial permeate growth solution into 'Kate' apricot fruit was shown (p<0.001).

[0035] Figure 9 The fruit development cycle of tomato overexpressing the PaNCED5 gene in this embodiment of the invention (the first row is the fruit development cycle of WT wild-type tomato lines, and the second to fourth rows are the fruit development cycles of tomato lines OE-7, OE-19, and OE-22 overexpressing the PaNCED5 gene).

[0036] Figure 10 A comparison of ABA content changes during fruit ripening in WT tomatoes with overexpression of the PaNCED5 gene (OE-7, OE-19, OE-22) in this invention.

[0037] Figure 11 This invention describes the expression of overexpressed PaNCED5 genes (OE-7, OE-19, OE-22) and genes related to the ABA metabolic pathway during the ripening period of WT tomato fruit. Detailed Implementation

[0038] 1. Materials and Methods

[0039] 1.1 Total RNA and Quality Detection of Samples

[0040] In this embodiment, the pulp of apricot germplasm 'XYZS' was flash-frozen in liquid nitrogen and ground into powder. Buffer SPL was first added for sample lysis, and then the filtrate was added to a genomic DNA adsorption column to remove gDNA (genomic DNA). Anhydrous ethanol was then added to the filtrate to adjust the column loading environment. The entire mixture was transferred to an RNA adsorption column, impurities were washed away, and finally, RNA was eluted. 1.00 μL of RNA was then analyzed for RNA purity using a Thermo Fisher Scientific NanoDrop ONEC analyzer.

[0041] (OD260 / 280 and OD260 / 230 ratios); 1.00 μg of RNA was subjected to gel electrophoresis to check for integrity and whether RNA degradation was present.

[0042] The breeding method of apricot germplasm 'XYZS' in this embodiment is as follows: A new apricot variety was bred using a selection method with the breeding objectives of early maturity, sweet flesh, strong aroma, and stable yield. Superior apricot trees were selected from apricot germplasm resource sites in Luoyang City, Henan Province, with trees aged 10 years. Mother trees with minimal alternate bearing, high yield, and strong early maturity were selected.

[0043] The specific cultivation process is as follows: initial selection of superior trees → secondary selection of superior trees (the final selected superior trees are early-maturing plants) → grafting and propagation of the selected superior trees → grafted seedlings (the rootstock is the PT47 variety) → establishment of clonal testing forests → observation and measurement of growth habits, phenology, yield, etc. → evaluation of variety stability and ecological adaptability → determination of suitable cultivation areas and cultivation techniques. Grafted seedlings were planted in Mengzhou City, Henan Province in 2011. From 2019 to 2024, observational experiments were conducted on the economic traits of the fruit, early maturity, and resistance of the grafted seedlings of the new variety for five consecutive years. The yield and varietal traits were stable. The apricot germplasm is now preserved in the National Forest Tree Germplasm Resource Bank of Major Economic Tree Species in Northern China and has been named 'XYZS'.

[0044] 1.2 RNA reverse transcription to synthesize cDNA

[0045] Prepare the reaction system by adding Enzyme Mix, 5×All-in-one qRT Super Mix, template RNA, and RNase-free ddH2O; prepare the reverse transcription negative control reaction by adding No RT Control Mix 5×All-in-one qRT Super Mix 5μL, template RNA (1ng), and RNase-free ddH2O (total 20μL) to test whether there is residual genomic DNA in the RNA template. The PCR reaction system is 50℃ for 15 min and 85℃ for 5 sec.

[0046] The PCR reaction system for reverse transcription to synthesize first-strand cDNA is shown in Table 1.

[0047] Table 1. PCR reaction system for reverse transcription to synthesize first-strand cDNA

[0048]

[0049] 1.3 Construction of overexpression vectors

[0050] The overexpression vector PHG was double-digested with BamHI and PstI restriction enzymes and incubated at 37°C for 1 hour. The PHG digestion system is shown in Table 2.

[0051] Table 2 PHG enzyme digestion system

[0052]

[0053] 1.4 Construction of virus-mediated PTRV2 vector

[0054] The virus-mediated PTRV2 silencing vector was double-digested with BamHI and EcoRI restriction enzymes and incubated at 37°C for 1 hour. The PTRV2 digestion system is shown in Table 3.

[0055] Table 3 PTRV2 enzyme digestion system

[0056]

[0057] Cloning of the 1.5PaNCED5 gene

[0058] Using the 'XYZS' cDNA synthesized via reverse transcription as a template, PCR amplification of the candidate gene was performed using Phanta Flash Super-Fidelity DNA Polymerase (Vazyme). The reaction system and standard amplification procedure are shown in Tables 4 and 5, and the primers are shown in Table 6. In Table 6, GFP-FCX is a primer segment on the PHG sequence, used to determine whether the target sequence has been constructed in the vector.

[0059] Table 4 PCR reaction system

[0060]

[0061] Table 5 Standard PCR Amplification Procedure

[0062]

[0063] Table 6 Primer List

[0064]

[0065]

[0066] After PCR amplification, the sample was spotted onto a 0.8 wt% agarose gel and placed in 1×TAE buffer. Electrophoresis was performed at 160 V, 360 A, and 25 min. The correctly amplified target band was extracted and recovered using the Omega Gel Extraction Kit (D2500). First, the desired target fragment was excised from the agarose gel and placed in a 1.5 mL centrifuge tube for weighing. Then, the corresponding weight of dissolving buffer was added to completely dissolve the gel. All liquid was then transferred to a binding column, washed, dried, and finally eluted to obtain the extracted gel product.

[0067] The linearized PHG overexpression vector and Ptrv2 virus silencing vector were mixed with the corresponding PaNCED5 fragment with the vector adapter, and 2×EasyGeno Assembly Mix (Tiangen Biotech) was added for recombination. The mixture was then incubated in a water bath at 50°C for 30 min.

[0068] The 10 μL recombination system is as follows: 5 μL of 2×EasyGeno Assembly Mix, 2.5 μL of enzyme-digested vector DNA, and 2.5 μL of fragment DNA.

[0069] The reaction system was added to a 250 μL EP tube, placed in a 50°C water bath for 30 min, and then transformed into E. coli and plated. After incubating at 37°C for 16 hours, bacteria were picked and sent for sequencing. The plasmid with correct sequencing was transformed into Agrobacterium tumefaciens GV3101 for subsequent transient expression of apricot and genetic transformation of tomato.

[0070] 2. Transient expression of the PaNCED5 gene in apricot fruit

[0071] 2.1 Buffer Preparation

[0072] Preparation and storage of 25 mg / mL acetylsylgenone (-20℃): Dissolve 0.5 g of powdered acetylsylgenone in DMSO, bring the volume up to 20 mL, and then aliquot and freeze.

[0073] Preparation of 4.74 mg / mL MS (prepare immediately): Dissolve 4.74 g MS powder in sterile water and bring the volume to 1 L.

[0074] The final buffer configuration ratios are shown in Table 7.

[0075] Table 7 Buffer Preparation System

[0076]

[0077]

[0078] 2.2 Instantaneous injection of apricot fruit

[0079] 20 μL of Agrobacterium tumefaciens bacterial suspension containing the overexpression vector PHG-PaNCED5 and the PHG control vector was added to 5 mL of liquid LB medium containing Kan, and incubated at 28°C and 220 rpm for approximately 6 hours. Then, 1 mL of the bacterial suspension was added to 50 mL of liquid LB medium containing Kan, and incubated overnight at 28°C and 220 rpm until the OD600 reached approximately 0.6-1.0. The suspension was then centrifuged at 6000 rpm for 10 min at room temperature to precipitate the bacterial cells. The supernatant was discarded, and the cells were resuspended in 50 mL of prepared buffer to achieve the desired OD600. 600The concentration should be between 0.6 and 1.0. Incubate the prepared bacterial buffer solution at room temperature for 4 hours. Select healthy, disease-free fruits for the injection experiment. Inject the buffer solution at 3-5 different locations on each fruit and mark the injection sites with a marker. Observe the fruit phenotype after 7 days, and cut off the phenotyped portions of apricot fruits for quick-freezing in liquid nitrogen for subsequent experiments.

[0080] 3. Genetic transformation of tomatoes and identification of transformation phenotypes

[0081] 3.1 Obtaining sterile vaccines

[0082] Select plump, uniformly sized, and fresh 'Micro-Tom' tomato seeds. Rinse them repeatedly with sterile water and clean water several times. Then, disinfect the tomato seeds with 70% alcohol (v / v) for 30 seconds, rinse them three times with sterile water, and then disinfect them with 10wt% sodium hypochlorite solution for 10 minutes. Rinse them four to five times with sterile water, blot them dry with sterile filter paper, and then inoculate them into seed germination medium. After dark culture until most seeds have germinated and shown white sprouts, place them in a culture environment with 16 hours of light per day, a light intensity of 1600-1800 lx, and a temperature of (24±2)℃.

[0083] 3.2 Agrobacterium tumefaciens culture

[0084] The overexpression vector constructed above was used to transform *Agrobacterium tumefaciens*. Labeled *Agrobacterium tumefaciens* monoclonal cells were picked up with a sterile pipette tip and inoculated into 5 mL of LB broth containing the appropriate antibiotic (using 50 mL blue cap centrifuge tubes). The cells were cultured at 28°C and 200 rpm for 24 hours with shaking, followed by centrifugation at 20°C and 4000 rpm for 15 min to collect the cells. The cells were then resuspended in transformation buffer to OD0.05. 600 = Around 0.5.

[0085] 3.3 Explant preparation, inoculation, and co-culture

[0086] True leaves, cotyledons, and hypocotyls were selected as explants for transformation. The tips and petioles of the true leaves and cotyledons were removed, and the remaining parts were cut into leaf pieces measuring 0.5cm × 0.5cm. Hypocotyls were cut into segments approximately 0.5-0.6mm in length and placed horizontally on pre-culture medium, 15-20 segments per dish. Culture conditions were the same as above, with pre-culture for 1 day.

[0087] Remove the explants from the pre-culture medium and place them in a container of transformation buffer diluted to OD. 600 Transform the explants in a culture dish containing approximately 0.5% Agrobacterium tumefaciens for 30 minutes. Remove the explants, blot them dry on sterile paper, and then place them back into the pre-culture medium. Culture for a total of 1-2 days.

[0088] 3.4 Selection, hardening-off, and transplanting culture

[0089] The co-cultured explants were transferred to a selection medium for selective culture. After a few days of selection culture, the cotyledons began to thicken, and the hypocotyls began to thicken. The transformed explants will form callus and adventitious buds on the selection medium, and subcultured every two weeks. The callus with bud primordia was cut into small pieces and transferred to a stem elongation medium for subculture, and transferred every two weeks. If necessary, subcultured in a shorter time. When the adventitious buds grew to about 1 cm, healthy regenerated buds were selected, and the basal callus and medium were completely removed. The buds were then transferred to a rooting medium to form complete plants. After the seedlings developed lateral roots, the bottle cap was removed, and a small amount of sterile water was poured into the culture bottle (covering the medium by 3-5 mm). The culture bottle was placed in a cool, ventilated place for hardening off. After 3 days, the medium was washed off the roots, and the seedlings were transferred to soil. For the first 7 days, the seedlings were covered with a transparent plastic film and cultured under low light to allow the regenerated seedlings to adapt to the change from the medium to the nutrient substrate.

[0090] 4. Transient expression of apricot and phenotypic determination of tomato overexpression positive plants and analysis by real-time quantitative PCR (qRT-PCR).

[0091] 4.1 Validation of Genes by Real-Time Quantitative PCR

[0092] The primers used for transient expression of apricot and phenotypic determination of tomato overexpression positive plants and real-time quantitative PCR (qRT-PCR) analysis are shown in Table 8.

[0093] Table 8 Primers used for PCR and qRT-PCR

[0094]

[0095]

[0096] The ChamQ Universal SYBR qPCR Master MiX (Vazyme) real-time PCR kit was used for this experiment. The qRT-PCR reaction system and procedure are shown in Tables 9 and 10.

[0097] Table 9

[0098]

[0099] Table 10

[0100]

[0101] In this embodiment, PaUBQ was used as the internal reference gene for the relative expression analysis of apricot genes (primers are shown in Table 8), and SlACT was used as the internal reference gene for tomato (primers are shown in Table 8). The HYR gene was used to detect whether the tomato overexpression lines were positive. All qRT-PCR experiments were repeated four times, and the relative expression level of each gene was calculated using the 2^-ΔΔCt method. Finally, the results were presented in graph form using GraphPad Prism 8.0.2.

[0102] 4.2 Determination of ABA content

[0103] 4.2.1 Solid Samples

[0104] (1) Take out the apricot fruits and overexpressed tomato fruits that were cryopreserved and injected at ultra-low temperature (no special requirements, the default is fresh samples), and grind them in liquid nitrogen with a grinder (30Hz, 1min) until they are powdery.

[0105] (2) Weigh 50 mg of the ground sample in liquid nitrogen, add 10 μL of internal standard mixed solution with a concentration of 100 ng / mL and 1 mL of methanol / water / formic acid (15:4:1, v / v / v) extractant, and mix well;

[0106] (3) Vortex for 10 min, centrifuge at 4℃ and 12000 r / min for 5 min, and take the supernatant into a new centrifuge tube for concentration;

[0107] (4) After concentration, redissolve in 100 mL of 80% methanol / water solution, filter through a 0.22 μm filter membrane, place in a sample vial, and use for LC-MS / MS analysis.

[0108] 4.2.2 Chromatography-Mass Spectrometry Acquisition Conditions

[0109] The data acquisition instrument system mainly includes ultra-high performance liquid chromatography (UPLC) (ExionLCT AD, https: / / sciex.com.cn / ) and tandem mass spectrometry (MS / MS) (ExionLCT AD, https: / / sciex.com.cn / ). 6500+, https: / / sciex.com.cn / ).

[0110] Liquid phase conditions mainly include:

[0111] 1) Chromatographic column: Waters ACQUITY UPLC HSS T3 C18 column (1.8μm, 100mm x 2.1mm i.d.);

[0112] 2) Mobile phase: Phase A, ultrapure water (with 0.04% acetic acid added); Phase B, acetonitrile (with 0.04% acetic acid added);

[0113] 3) Gradient elution program: 0 min A / B is 95:5 (V / V), 1.0 min A / B is 95:5 (VN), 8.0 min is 5:95 (V / ), 9.0 min is 5:95 (V / ), 9.1 min is 95:5 (V / ), 12.0 min is 95:5 (VV);

[0114] 4) Flow rate 0.35 mL / min; column temperature 40℃; injection volume 2 μL.

[0115] Mass spectrometry conditions mainly include:

[0116] Electrospray ionization (ESI) was performed at a temperature of 550°C, with a mass spectrometry voltage of 5500V in positive ion mode and -4500V in negative ion mode. Curtain gas (CUR) was supplied at 35 psi. In the Q-Trap 6500+, each ion pair was scanned and detected based on optimized declustering potential (DP) and collision energy (CE).

[0117] 5 Results Analysis

[0118] 5.1 Construction of PaNCED5 gene overexpression vector and transient expression in apricot kernels

[0119] To determine the function of the PaNCED5 gene in ABA synthesis and fruit ripening, the CDS sequence of the cloned PaNCED5 gene was constructed into the overexpression vector PHG using a double enzyme digestion method for subsequent gene validation experiments. The prepared bacterial permeate containing PHG-PaNCED5 and the empty PHG vector was injected into 'Kate' apricot fruits in their slow growth phase, and the fruits were labeled. The transient expression phenotype of the PaNCED5 gene in apricots was observed 5-7 days later.

[0120] according to Figure 3 ( Figure 3In the diagram, "PHG" represents apricot fruits injected with an empty PHG bacterial solution; "PHG-NCED" represents apricot fruits injected with a PHG-PaNCED5 bacterial solution. It can be visually observed that apricot fruits injected with the PHG-PaNCED5 bacterial solution mature earlier than those injected with the empty PHG bacterial solution. Conversely, the remaining parts of apricot fruits injected with the PHG-PaNCED5 bacterial solution showed no signs of color change. Therefore, it can be concluded that the PaNCED5 gene can promote earlier ripening of apricot fruits.

[0121] Based on the phenotypic results, samples were taken to determine ABA content and the expression of ABA metabolic pathway genes (see...). Figure 3 and Figure 4 Two ABA substances (abscisic acid ABA and abscisic acid aldehyde) were detected. The ABA content in apricot fruits injected with PHG-PaNCED5 bacterial solution was 597.80 ng / g, significantly higher than the control group's 251.17 ng / g. However, the abscisic acid aldehyde (ABA-ald) content showed no significant difference between the two groups, at 37.90 ng / g and 39.20 ng / g, respectively. This result indicates that the PaNCED5 gene can promote ABA accumulation but has no significant promoting effect on abscisic acid aldehyde. Simultaneously, qRT-PCR was used to detect the expression of genes in the abscisic acid metabolism pathway in apricot fruits after transient injection. The expression of the PaNCED5 gene in fruits injected with PHG-PaNCED5 bacterial solution was significantly higher than that in the control group, approximately five times higher. Furthermore, the expression of other genes related to the abscisic acid metabolism pathway, PaCtrz, PaSPL5, PaPY707A, and PaACO, was lower than or not significantly different from the control group after injection with PHG-PaNCED5 bacterial solution. All of the above results demonstrate that the PaNCED5 gene promotes apricot fruit ripening by increasing and accumulating ABA content in the fruit.

[0122] 5.2 Construction of the PaNCED5 gene VIGS vector and transient expression in apricot kernels

[0123] To further determine the function of the PaNCED5 gene in ABA synthesis and fruit ripening, this embodiment cloned the non-conserved CDS sequence of the PaNCED5 gene and constructed it into the virus-mediated gene silencing vector PTRV2 using a double enzyme digestion method for subsequent gene verification experiments. The prepared bacterial permeate containing PTRV2-PaNCED5 and the empty PTRV2 vector was mixed with the empty PTRV1 vector at a 1:1 ratio and cultured at 28℃ and 90 rpm for 4 h. The mixture was then injected into 'XYZS' apricot fruits in their slow growth phase and labeled. The phenotype of transient VIGS silencing of the PaNCED5 gene in apricots was observed 5-7 days later.

[0124] Depend on Figure 6 It was observed that apricot fruits injected with a mixed empty bacterial suspension of PTRV1+PTRV2 showed normal color change and ripening; while apricot fruits injected with a mixed bacterial suspension of PTRV1+PTRV2-PaNCED5 showed inhibited color change and delayed ripening. The abscisic acid (ABA) content in the fruits was also measured (see...). Figure 7 The study found that the ABA content in apricot pulp after VIGS silencing was 373.79 ng / g, and the ABA-GE (abscisic acid glucoester) content was 342.10 ng / g, while the ABA content in the control group was 454.63 ng / g and the ABA-GE content was 795.28 ng / g. This result indicates that silencing the PaNCED5 gene inhibits ABA synthesis, leading to ACC accumulation and delaying fruit ripening. Subsequently, we used qRT-PCR to determine the expression of genes in the abscisic acid and ethylene metabolic pathways in apricot pulp after transient injection. The results showed (see...) Figure 8 Apricot fruits injected with a mixed bacterial solution of PTRV1+PTRV2-PaNCED5 showed a 9-fold difference in PaNCED5 gene expression compared to the control group, indicating significant inhibition. Simultaneously, the PaACO gene was inhibited, while PaSPL5 and PaPY707A genes were promoted, and PaCtrz showed no significant change. This further demonstrates that the PaNCED5 gene plays a positive role in promoting ABA synthesis and fruit ripening.

[0125] 5.3PaNCED5 gene tomato genetic transformation

[0126] (1) Genetic transformation lines of tomato overexpressing the PaNCED5 gene

[0127] To further enhance the credibility of the validation results that the PaNCED5 gene can promote ABA synthesis and fruit ripening, we stably genetically transformed the constructed PHG-PaNCED5 overexpression vector into the tomato variety 'Micro-Tom' using Agrobacterium tumefaciens-mediated transformation.

[0128] A. The results of tomato fruit ripening phenotype analysis with overexpression of the PaNCED5 gene are as follows:

[0129] The fruit growth and development cycle of tomato lines overexpressing the PaNCED5 gene and WT lines was observed and statistically analyzed (see...). Figure 9 The study found that the overall fruit development cycle of tomatoes overexpressing the PaNCED5 gene was shorter than that of WT tomato lines. The WT tomato lines took 60 days from flowering to fruit maturity, while the PaNCED5-overexpressing tomato lines took 52 days.

[0130] B. Determination of ABA content in tomato fruits overexpressing the PaNCED5 gene and expression analysis of genes related to the ABA metabolic pathway

[0131] Based on the maturity phenotypes of the fruit growth and development cycle of tomato lines (OE-7, OE-19, OE-22) and WT lines overexpressing the PaNCED5 gene, tomato fruits at the final maturity stage were used as experimental materials. LC-MS / MS and qRT-PCR were used to obtain ABA content and the expression of related genes in the ABA metabolic pathway (see...). Figure 10 and Figure 11 The results showed that the PaNCED5 gene was overexpressed in tomato lines (OE-7, OE-19, and OE-22), with significantly higher expression levels than the control group (WT). Other genes related to ABA metabolism, SlCtrz, SlSPL5, and SlPY707A, showed lower expression levels in PaNCED5-overexpressing tomato fruits compared to WT, while SlACO1 showed no significant difference. The ABA content was 92.96 ng / g in WT, 212.07 ng / g in OE-7, 203.78 ng / g in OE-19, and 607.69 ng / g in OE-22. This demonstrates that overexpression of the PaNCED5 gene can increase ABA content in fruits and promote fruit ripening.

[0132] CDS sequence of the PaNCED5 gene (SEQ ID NO.1):

[0133]

[0134] Amino acid sequence of the protein encoded by the PaNCED5 gene (SEQ ID NO.2):

[0135] MAALPKAPNSNTWATSTAQMPHTLLSSSSSSLVDPMGFPKRSIFLRKTHPKAATRRTTSIHCALQSPSVLHFPNQPYNQPIITKEATSPKPNNSTHHHHQPPQWNLLQKAAAMAIDMVEGALVSRERQNPLPKTSDPRVQIAGNYAPVPEQPVRHSLPITGTIPECINGVYVRNGANPLFEPVAGHHLFDGDGMVHAVTIDSGSASYACRFTETQRLVQEREFGRPVFPKAIGELHGHSGIARLLLFYARGVLGLVDKNHGTGVANAGLVYHNGRLLAMSEDDLPYQVRVTKSGDLETVGRYDFNSQLGSTMIAHPKVDPESGSLFALSYDVVQKPYLKYFQVSPDGAKSPDVEIPLAGPTMMHDFAITENYVVIPDQQVVFKLQEMITGGSPVIYDKDKMSRFGILKKNAKNADDLVWVDSPDTFCFHLWNAWEEPESDEVVVIGSCMTPPDSIFNECDESLKSVLSEIRLNLKTGQSTRRAILSESEHVNLEAGMVNRNRLGRKTRFAYLAIAEPWPKVSGFAKVDVSTGEVKKFIYGDKKYGGEPFFVPNTELGSSEDDGYIMAFVHDEKTWKSELQIVNAVNLKLEATVKLPSRVPYGFHGTFIESKDLANQA*。

Claims

1. A functional gene regulating apricot fruit ripening PaNCED5 The application, characterized in that, Functional genes for regulating apricot fruit ripening PaNCED5 For regulating apricot fruit ripening, by increasing PaNCED5 the expression of a gene to promote apricot fruit ripening, or by inhibiting PaNCED5 the expression of a gene to delay apricot fruit ripening, PaNCED5 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The functional gene regulating apricot fruit ripening according to claim 1 PaNCED5 The application, characterized in that, Overexpression of functional genes regulating apricot fruit ripening in apricot fruits PaNCED5 Early maturing apricot cultivars are bred.

3. The functional gene regulating apricot fruit ripening as described in claim 2 PaNCED5 The application, characterized in that, By controlling the functional genes that regulate apricot fruit ripening PaNCED5 The recombinant overexpression vector was transferred into apricot fruits via Agrobacterium tumefaciens-mediated transformation to enhance the expression of apricot fruits. PaNCED5 The level of gene expression promotes the ripening of apricot fruits.

4. The functional gene regulating apricot fruit ripening as described in claim 3 PaNCED5 The application, characterized in that, When constructing the recombinant overexpression vector, PCR amplification was performed using primers shown in SEQ ID NO.3 and SEQ ID NO.4; the original vector used was the PHG plasmid. PaNCED5 The CDS sequence of the gene is located between the BamHI and PstI restriction sites in the PHG plasmid. PaNCED5 The primers used for quantitative PCR of the gene are shown in SEQ ID NO.5 and SEQ ID NO.

6.

5. A functional gene regulating apricot fruit ripening PaNCED5 The application, characterized in that, Overexpression of functional genes regulating apricot fruit ripening in tomatoes PaNCED5 Promotes the ripening of tomato fruits; PaNCED5 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. The functional gene regulating apricot fruit ripening as described in claim 5 PaNCED5 The application, characterized in that, Utilizing functional genes that regulate apricot fruit ripening PaNCED5 The recombinant overexpression vector was genetically transformed into 'Micro-Tom' tomatoes via Agrobacterium tumefaciens-mediated transformation, promoting the ripening of 'Micro-Tom' tomato fruits.

7. The functional gene regulating apricot fruit ripening according to claim 6 PaNCED5 The application, characterized in that, When constructing the recombinant overexpression vector, PCR amplification was performed using primers shown in SEQ ID NO.3 and SEQ ID NO.4, and the original vector used was the PHG plasmid. PaNCED5 The CDS sequence of the gene is located between the BamHI and PstI restriction sites in the PHG plasmid. PaNCED5 The primers used for quantitative PCR of the gene are shown in SEQ ID NO.5 and SEQ ID NO.6.

Images