Fluorescent quantitative detection kit for bifidobacteria in intestinal microorganisms and application of fluorescent quantitative detection kit

Abstract

The invention discloses a fluorescent quantitative detection kit for bifidobacteria in intestinal microorganisms and application of the fluorescent quantitative detection kit. The invention provides a complete set of single-stranded DNA for detecting a bifidobacterium strain. The complete set of single-stranded DNA is composed of a primer pair and a single-stranded DNA probe, the primer pair is composed of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2; the nucleotide sequence of the single-stranded DNA probe is as shown in SEQ ID No. 3. The method is simple and fast in period; the probe method real-time fluorescent quantitative PCR detection is high in targeting property, and the number of bifidobacteria in a sample can be reduced to a greater extent; the primer and the probe group have high specificity, bifidobacterium can be identified in complex intestinal microorganisms, and various strains under the bifidobacterium can be effectively amplified; the qualitative and quantitative detection of bacteria genus can be simultaneously realized, and the quantification is more accurate; according to the detection result, guiding significance is provided for probiotic supplement of the detected person.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a quantitative fluorescence detection kit for Bifidobacterium spp. in intestinal microorganisms and its application. Background Technology

[0002] A growing body of scientific research has demonstrated the diversity and complexity of the gut microbiota. These microbes form a micro-ecosystem within the gut, participating in and regulating local and systemic processes such as host immunity, metabolism, neurology, and endocrine function through mechanisms including their own composition and the translocation of pathogenic commensal bacteria. This influences the risk of infectious diseases, allergic diseases, chronic inflammatory bowel diseases, metabolic diseases, autoimmune diseases, and cancer. The detection and quantification of dominant gut microbiota are of significant auxiliary value for clinical diagnosis and treatment.

[0003] Among them, probiotics, represented by Bifidobacteria, can prevent diarrhea and food allergies, regulate immune function, and contribute to the maturation of the digestive and immune systems, playing an irreplaceable role in promoting the growth and development of infants and young children. Especially during the vulnerable period when an infant's own defenses are immature, Bifidobacteria can participate in the defense against pathogens by adhering to intestinal epithelial cells. Bifidobacteria promote the proliferation of B lymphocytes in the intestinal mucosa and the secretion of immunoglobulins, thereby promoting the development of the infant's immune system. They have a good promoting and regulating effect on humoral immunity in infants and can effectively maintain the stability of the infant's intestines. Infant Bifidobacteria can also activate mononuclear phagocytes, increase the body's non-specific immune strength, and enhance the phagocytic function of granulocytes and monocytes. At the same time, Bifidobacteria also have an activating effect on T lymphocytes and NK cells.

[0004] Previous methods for quantifying gut microbiota, both domestically and internationally, primarily relied on viable bacterial counts in gut specimens. This method is time-consuming and laborious, and cannot effectively and rapidly quantify gut microbiota accurately. Furthermore, the density of human gut microbiota can reach 102. 11 The CFU / mL count ranges from 100 to 1000 species, and more than 99% of them are strictly anaerobic bacteria, making them difficult to isolate and culture using traditional microbiological detection techniques, thus making effective quantitative detection impossible.

[0005] In recent years, the detection of human gut microbiota has relied mainly on 16S rRNA sequencing technology with the development of next-generation sequencing (NGS, also known as high-throughput sequencing technology). This technology can analyze the types and abundance of gut microbiota in a short time, but due to methodological limitations, it cannot effectively quantify the dominant bacterial groups.

[0006] Therefore, it is essential to establish a stable method for rapidly and accurately quantifying dominant gut microbiota from the complex human gut microbiota to explore the interactions between the gut microbiota and the host. In recent years, with the rapid development of molecular biology, rapid quantification of dominant gut microbiota has become possible. Summary of the Invention

[0007] The purpose of this invention is to provide a fluorescence quantitative detection kit for Bifidobacterium spp. in intestinal microorganisms and its application.

[0008] In a first aspect, the present invention claims protection for a complete set of single-stranded DNA used for detecting Bifidobacterium strains.

[0009] The present invention claims a complete set of single-stranded DNA for detecting Bifidobacterium strains, consisting of primer pairs and single-stranded DNA probes;

[0010] The primer pair consists of the upstream primer shown in SEQ ID No. 1 and the downstream primer shown in SEQ ID No. 2;

[0011] The nucleotide sequence of the single-stranded DNA probe is shown in SEQ ID No. 3.

[0012] Furthermore, the single-stranded DNA probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

[0013] In a specific embodiment of the present invention, the fluorescent reporter group is ROX; the fluorescent quencher group is BHQ2. Of course, the fluorescent reporter group can also be FAM, TET, VIC, JOE, etc.; the fluorescent quencher group can also be TAMRA, etc.

[0014] Secondly, the present invention claims protection for primer pairs used to detect Bifidobacterium strains.

[0015] The primer pair claimed in this invention for detecting Bifidobacterium strains may be the primer pair described in the first aspect above.

[0016] Thirdly, the present invention claims protection for reagents or kits used to detect strains of Bifidobacterium.

[0017] The reagents or kits for detecting Bifidobacterium strains claimed in this invention may, in addition to containing the complete set of single-stranded DNA described in the first aspect above or the primers described in the second aspect above, also contain all or part of the following:

[0018] (A1) TaqMan Real-Time Quantitative PCR Amplification Buffer;

[0019] (A2) Positive standard plasmid (used for plotting a standard curve); the positive standard plasmid is a plasmid containing the DNA fragment shown in SEQ ID No. 4;

[0020] (A3) Positive control; the positive control is Bifidobacterium animalis ATCC25527;

[0021] (A4) Negative control; the negative control is nuclease-free water.

[0022] Fourthly, the present invention claims a method for detecting whether a sample to be tested contains a strain of Bifidobacterium.

[0023] The method for detecting whether a sample contains Bifidobacterium strains, as claimed in this invention, may include the following steps: extracting total DNA from the sample and using it as a template to perform quantitative real-time PCR amplification of the single-stranded DNA array described in the first aspect above; then determining whether the sample contains Bifidobacterium strains as follows: if the Ct value is ≤36 and the amplification curve is S-shaped, the sample contains or is a candidate for containing Bifidobacterium strains; if the Ct value is >36 or the amplification curve is not S-shaped, the sample does not contain or is a candidate for not containing Bifidobacterium strains.

[0024] Fifthly, the present invention claims a method for detecting the genomic DNA content of Bifidobacterium strains in a sample to be tested.

[0025] The method for detecting the genomic DNA content of Bifidobacterium strains in a test sample, as claimed in this invention, may include the following steps:

[0026] (B1) Prepare a series of positive standard plasmids of known concentrations from the reagents or kits described in the third aspect above, and use them as templates to perform real-time PCR amplification with the complete set of single-stranded DNA described in the first aspect above, and plot the real-time PCR standard curve (the horizontal axis is the content of genomic DNA of Bifidobacterium strains, and the vertical axis is the Ct value).

[0027] (B2) Extract total DNA from the sample to be tested and use it as a template to perform real-time PCR amplification of the complete set of single-stranded DNA described in the first aspect above; then determine the content of Bifidobacterium genomic DNA in the sample to be tested based on the real-time PCR standard curve plotted in step (B1).

[0028] The content of Bifidobacterium genomic DNA in the sample to be tested can be the number of copies of Bifidobacterium genomic DNA per unit volume of the sample to be tested.

[0029] In the fourth and fifth aspects, when performing the aforementioned quantitative real-time PCR amplification, the concentration of the two single-stranded DNAs constituting the primer pair in the reaction system can both be 0.2 μmol / L, and the concentration of the single-stranded DNA probe in the reaction system can also be 0.2 μmol / L.

[0030] In the fourth and fifth aspects, the annealing temperature can be 65°C when performing the aforementioned quantitative PCR amplification.

[0031] Sixthly, the present invention claims protection for any of the following applications:

[0032] (C1) The use of the complete set of single-stranded DNA described in the first aspect above or the primer pairs described in the second aspect above in the preparation of the reagents or kits described in the third aspect above;

[0033] (C2) The use of the complete set of single-stranded DNA described in the first aspect above, or the primer pairs described in the second aspect above, or the reagents or kits described in the third aspect above, in the detection of Bifidobacterium strains, or in the preparation of products for the detection of Bifidobacterium strains.

[0034] In the above aspects, the detection of Bifidobacterium strains refers to the detection of Bifidobacterium strains in intestinal microorganisms (including qualitative and / or quantitative detection).

[0035] In the above aspects, the Bifidobacterium strains to be detected may be Bifidobacterium animalis, Bifidobacterium breve, Bifidobacterium longum, Bifidobacterium chain, Bifidobacterium adolescentis, Bifidobacterium infantis, Bifidobacterium astrum, Bifidobacterium bifidum, Bifidobacterium rodentum, Bifidobacterium thermophilum, Bifidobacterium thermophilum, Bifidobacterium skadoviformes, Bifidobacterium dentateum, Bifidobacterium dolphinum, Bifidobacterium galbana, Bifidobacterium rabbitis, Bifidobacterium chicken embryo, Bifidobacterium bovis, Bifidobacterium rumenum, Bifidobacterium mucalaba, Bifidobacterium pseudolongum, Bifidobacterium white scoursii, Bifidobacterium stylombos, or Bifidobacterium tsurumi, etc.

[0036] This invention uses Bifidobacterium, a representative of the dominant gut microbiota, as the model microbiota to explore a rapid quantitative method for the dominant gut microbiota, laying the foundation for quantitative research on the dominant gut microbiota.

[0037] Beneficial effects of this invention:

[0038] (1) The method is simple and the cycle is fast;

[0039] (2) The probe-based real-time quantitative PCR detection has high targeting and can restore the number of Bifidobacteria in the sample to a greater extent;

[0040] (3) The primer and probe set has high specificity and can identify Bifidobacterium genus in complex intestinal microbiota and effectively amplify various species under Bifidobacterium genus;

[0041] (4) It can simultaneously perform qualitative and quantitative detection of bacteria, with more accurate quantification.

[0042] (5) The test results provide guidance for the supplementation of probiotics for the test subjects. Attached Figure Description

[0043] Figure 1 The amplification curve of the type strain ATCC25527 (Bifidobacterium animalis).

[0044] Figure 2 The amplification curve is for the positive standard plasmid.

[0045] Figure 3 This is a standard curve obtained using positive standard plasmids.

[0046] Figures 4-10 The amplification curves are for positive and negative controls and 5 intestinal microbial samples. Figure 4 This is a positive control; Figure 5 This is a negative control. Figure 6 For example, sample S1; Figure 7 For example, sample S2; Figure 8 For example, sample S3; Figure 9 For example, sample S4; Figure 10 This is sample S5. Detailed Implementation

[0047] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0049] Example 1: Establishment of a real-time quantitative PCR method for detecting Bifidobacterium strains

[0050] I. Primer and probe design

[0051] Download the 16S rRNA sequences and their numbers for common Bifidobacterium species from the NCBI database: *Bifidobacterium animalis* (AB027536, AB050136, AB050137, AB050138, D86185), *Bifidobacterium breve* (AB006658), and *Bifidobacterium longum*. Bifidobacterium longum: AB437359, AB437360, AB924514, AB924515, AB924516, AB924517, AB924518, AB924519, AB924520, BIFRR16SK; Bifidobacterium catenulatum: AB425276, AB437357; Bifidobacterium adolescentis: AB437354; Bifidobacterium infantis: AY15138, AJ311604; Bifidobacterium steroides: AB437355; Bifidobacterium Bifidum (BBU25952, BBU25951, AB437356, AB681129), Corynebacterium coryneforme (AB437358), Bifidobacterium thermophilum (AB437364), and Bifidobacterium thermoacidophilum subsp.Porcinum (AB437361, AB437362, AB682358, AB682359, AY148470), Bifidobacterium scardovii (also known as Bifidobacterium scardovii: AB437363), Bifidobacterium dentium (D86183), Bifidobacterium choerinum (D86186), Bifidobacterium gallicum (D86189), Bifidobacterium cuniculi (AB438223), Bifidobacterium gallinarum (D86191), Bifidobacterium boum (D86190), Bifidobacterium rumenum Bifidobacterium merycicum (D86192), *Bifidobacterium moukalabense* (AB821293), *Bifidobacterium umpseudolongum subsp. Globosum* (D86194), *Bifidobacterium umpseudolongum subsp. Pseudolongum* (D86195), *Bifidobacterium pullorum* (D86196), *Bifidobacterium stellenboschense* (AB559505), *Bifidobacterium tsurumiense* (AB241106).

[0052] Sequence alignment of the downloaded sequences revealed that primers and probes in highly conserved regions could simultaneously detect various species within the genus Bifidobacterium. Therefore, primers and probes were designed within the highly conserved regions of the sequences. The specific sequence information of the primers and probes obtained in this invention is shown in Table 1.

[0053] Table 1. Primers and probes of the present invention

[0054] name Sequence (5'-3') Modification Serial Number Upstream primer Bif_FP CGTCGCGTCYGGTGTGAA / SEQ ID No.1 Downstream primer Bif_RP CACATCCAGCRTCCACC / SEQ ID No.2 probe Bif_Probe TGGTAGTCCACGCCGTAAAC 5'-ROX; 3'-BHQ2 SEQ ID No. 3

[0055] Note: In the sequence, Y represents C or T; R represents A or G.

[0056] II. Construction of Positive Standard Plasma

[0057] Based on the primer and probe detection regions in Table 1, positive standards were designed with a target sequence of 663 bases (specific sequence below). These sequences were inserted into the multiple cloning site region of the pUC57 vector and obtained as positive standard plasmids after sequencing verification.

[0058] (SEQ ID No. 4, in the sequence, Y represents C or T; R represents A or G.)

[0059] III. Establishment of a method for detecting Bifidobacterium strains using quantitative real-time PCR

[0060] This invention uses the complete genome extracted from intestinal microorganisms as a reaction template for the quantitative fluorescence detection of Bifidobacterium genes. The specific procedure is as follows:

[0061] 1) Extract the complete genome of gut microbiota;

[0062] 2) Use the Nanodrop micro-volume spectrophotometer to perform quality control on genomic nucleic acids;

[0063] 3) Genomic samples that pass quality inspection can be used as templates for probe-based quantitative PCR detection;

[0064] 4) The results were interpreted and the copy number was calculated based on the positive control (using the genomic DNA of Bifidobacterium animalis ATCC25527 as a template), the negative control (using nuclease-free water as a template), and the standard curve (drawn using the positive standard plasmid).

[0065] The reaction system is shown in Table 2.

[0066] Table 2. Reaction System

[0067] composition Volume (μL) 2×Probe Mixture 12.5 Upstream primer Bif_FP (10 μM) 0.5 Downstream primer Bif_RP (10 μM) 0.5 Probe Bif_Probe (10μM) 0.5 Genome or positive standard plasmid 1 Enzyme-free nucleic acid water 10 total 25

[0068] Note: In the table, 2×Probe Mixture is a product of Kangwei Century, with the product number CW0932M.

[0069] The reaction procedure is shown in Table 3.

[0070] Table 3. Reaction Procedure

[0071]

[0072]

[0073] Control sample quality control requirements:

[0074] The Ct value for the positive control is ≤30;

[0075] The negative control has a Ct value >36 or no obvious amplification curve;

[0076] All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and needs to be repeated.

[0077] Sample result judgment value requirements:

[0078] 1. Positive: Ct value ≤ 36 and amplification curve is S-shaped.

[0079] 2. Negative: Ct value > 36 or amplification curve not showing an S-shape indicates undetected.

[0080] 3. Qualitative Experiment: After amplification, only the positive or negative result of the sample to be tested is determined, i.e., whether the sample contains Bifidobacterium. First, the validity of this experiment is determined according to the quality control requirements for control samples. If both the negative and positive control samples meet the requirements, the experiment is valid; otherwise, the experiment is invalid. If the quality control of the control samples is qualified, the sample results are determined according to the sample result determination requirements. If the result is positive, the sample to be tested contains Bifidobacterium strains (positive); if the result is negative, the sample to be tested does not contain Bifidobacterium strains (negative).

[0081] Quantitative experiments: Positive standard plasmids were prepared into a series of known concentrations and used as templates for quantitative real-time PCR amplification. A quantitative real-time PCR standard curve was plotted (the x-axis represents the content (copy number) of Bifidobacterium genomic DNA, and the y-axis represents the Ct value). Then, total DNA was extracted from the test samples and used as templates for quantitative real-time PCR amplification. After amplification, the content (copy number) of Bifidobacterium genomic DNA in the test samples was determined based on the standard curve.

[0082] Example 2: Testing primers using the model strain ATCC25527 (Bifidobacterium animalis).

[0083] The genome of the model strain ATCC25527 was quality controlled using a Nanodrop One micro-quantitative analyzer at a concentration of 40.78 ng / μL. 1 μL of the sample was used as a template for detection. For specific methods, please refer to Example 1.

[0084] Test results as follows Figure 1 The Ct value was 6.98, and there was a clear S-curve, indicating that the primers and probes can effectively amplify Bifidobacterium.

[0085] Example 3: The specificity and sensitivity of primers and probes were tested using positive standard plasmids, and a standard curve was established.

[0086] The positive standard plasmid prepared in Example 1 was serially diluted to concentrations of 1 × 10⁻⁶. 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 Copy / μL, set these 5 concentration gradients as standards, and create a standard curve.

[0087] The primer and probe sets used in the detection, as well as the reaction system and procedure, are the same as in Example 1. After the standard curve was prepared, it was evaluated using two metrics: the correlation coefficient R. 2 And amplification efficiency (E). Correlation coefficient R2 It reflects the linear relationship of the data and is mainly used to evaluate the reproducibility of repeated samples and whether different concentrations of initial template have the same amplification efficiency. R 2 The value should be greater than 0.98. The closer the value is to 1, the better the linear relationship and the more accurate the data. Amplification efficiency (E) calculation formula: E = 10 -1 / 斜率 -1. Amplification efficiency (E): It is generally believed that the amplification efficiency should be between 90-110%, and the corresponding slope is between -3.58 and -3.1.

[0088] Amplification curve as shown Figure 2 As shown, the final standard curve is as follows: Figure 3 As shown. Amplification efficiency 105.27%, correlation coefficient R 2 >0.99.

[0089] Example 4: Detection using intestinal microbial samples

[0090] Genomic DNA from five intestinal microbial samples (S1, S2, S3, S4, and S5) was analyzed. Bifidobacterium animalis ATCC25527 was used as a positive control, and nuclease-free water was used as a negative control. A standard curve was constructed using a positive standard plasmid. Specific information for the five samples is shown in Table 4.

[0091] Table 4. Detailed information on 5 gut microbiome samples

[0092] Sample number Sample type Genomic DNA concentration (ng / μL) S1 Gut microbiota 793.03 S2 Gut microbiota 102.15 S3 Gut microbiota 538.97 S4 Gut microbiota 17.20 S5 Gut microbiota 39.44

[0093] The primer and probe sets used in the detection, as well as the reaction system and reaction procedure, are described in Example 1.

[0094] The results are as follows: First, the quality control samples (positive and negative controls) were analyzed. The positive control showed significant amplification, while the negative control showed no amplification. The Ct values ​​and quantitative results of the five samples to be tested are shown in Table 5, and the corresponding amplification curves are shown below. Figures 4-10 As shown.

[0095] Table 5. Ct values ​​and quantitative results of 5 samples to be tested.

[0096] sample Ct value Quantitative results Positive control 18.16 3.67e+05 negative control / / S1 16.26 1.21e+06 S2 15.03 2.61e+06 S3 16.54 1.01e+06 S4 31.82 6.87e+01 S5 20.05 1.12e+05

[0097] Note: " / " indicates Undetermined (i.e., Ct value cannot be detected).

[0098] As shown in the table above, sample S2 has the lowest Ct value of 15.03 and a quantitative copy number of 2.61 × 10⁻⁶. 6The S4 sample had the highest Ct value of 31.82 and a quantitative copy number of 68.7, indicating that the S2 sample had the highest Bifidobacterium copy number and the S4 sample had the lowest Bifidobacterium copy number.

[0099] Furthermore, this invention constructs a 16S rRNA gene library, detects the abundance of Bifidobacterium in these 5 samples through sequencing, and then compares it with the above-mentioned quantitative fluorescence detection results. Details are as follows:

[0100] Five samples (S1, S2, S3, S4, and S5) were used to construct a next-generation sequencing library of the V4 variable region of the 16S rRNA gene. The specific method is as follows: using the same amount of nucleic acid as a template, the V4 variable region of the 16S rRNA gene was amplified; the target fragment of the PCR product was enriched using purified magnetic beads; ligation was performed with Illumina sequencing adapters, followed by library enrichment and purification, thus completing the library construction. The constructed library was sequenced on an Illumina Novaseq sequencer, and the abundance of Bifidobacterium was obtained through bioinformatics analysis, as shown in Table 6.

[0101] Table 6. Abundance percentage of Bifidobacterium genus in 5 samples detected by sequencing.

[0102] Sample number Bifidobacterium abundance percentage S1 0.4839 S2 17.8732 S3 2.7067 S4 0.0731 S5 3.6933

[0103] As shown in Table 6, sample S2 had the highest abundance of Bifidobacterium, at 17.8732%, while sample S4 had the lowest abundance of Bifidobacterium, at 0.0731%.

[0104] Comparing the next-generation sequencing data of 5 samples (Table 6) and the fluorescence quantitative detection results of 5 samples (Table 5), the detection results were found to be consistent. Therefore, this embodiment confirms the specificity and sensitivity of the primers and probes in this invention from the perspective of next-generation sequencing.

[0105] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A complete set of single-stranded DNA for detecting Bifidobacterium strains, consisting of primer pairs and single-stranded DNA probes; The primer pair consists of the upstream primer shown in SEQ ID No. 1 and the downstream primer shown in SEQ ID No. 2; The nucleotide sequence of the single-stranded DNA probe is shown in SEQ ID No.

3.

2. The complete set of single-stranded DNA according to claim 1, characterized in that: The single-stranded DNA probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

3. The complete set of single-stranded DNA according to claim 2, characterized in that: The fluorescent reporter group is ROX; the fluorescent quencher group is BHQ2.

4. The primer pair for detecting Bifidobacterium strains is the primer pair described in claim 1.

5. A reagent or kit for detecting Bifidobacterium strains, characterized in that: In addition to containing the complete set of single-stranded DNA as described in any one of claims 1-3 or the primers as described in claim 4, the reagent or kit also contains all or part of the following: (A1) TaqMan Real-Time Quantitative PCR Amplification Buffer; (A2) Positive standard plasmid; the positive standard plasmid is a plasmid containing the DNA fragment shown in SEQ ID No. 4; (A3) Positive control; the positive control is Bifidobacterium animalis ATCC25527; (A4) Negative control; the negative control is nuclease-free water.

6. A method for detecting whether a sample to be tested contains Bifidobacterium strains, comprising the following steps: extracting total DNA from the sample to be tested, using it as a template, and performing quantitative real-time PCR amplification with the complete set of single-stranded DNA as described in any one of claims 1-3; then determining whether the sample to be tested contains Bifidobacterium strains based on the amplification results as follows: if the Ct value is ≤36 and the amplification curve is S-shaped, then the sample to be tested contains or is a candidate for containing Bifidobacterium strains; if the Ct value is >36 or the amplification curve is not S-shaped, then the sample to be tested does not contain or is a candidate for not containing Bifidobacterium strains.

7. A method for detecting the genomic DNA content of Bifidobacterium strains in a sample to be tested, comprising the following steps: (B1) Prepare a series of known concentrations of positive standard plasmids from the reagent or kit described in claim 5, and use them as templates to perform real-time PCR amplification with any of the complete single-stranded DNAs described in claims 1-3, and plot a real-time PCR standard curve. (B2) Extract total DNA from the sample to be tested and use it as a template to perform real-time PCR amplification with the complete set of single-stranded DNA as described in any of claims 1-3; then determine the content of Bifidobacterium genomic DNA in the sample to be tested based on the real-time PCR standard curve plotted in step (B1).

8. The method according to claim 6 or 7, characterized in that: When performing the aforementioned quantitative real-time PCR amplification, the concentration of each of the two single-stranded DNA molecules constituting the primer pair in the reaction system is 0.2 μmol / L, and the concentration of the single-stranded DNA probe in the reaction system is 0.2 μmol / L; and / or When performing the aforementioned quantitative PCR amplification, the annealing temperature is 60℃.

9. Any of the following applications: (C1) The use of the complete set of single-stranded DNA as described in any one of claims 1-3 or the primer pair as described in claim 4 in the preparation of the reagent or kit as described in claim 5; (C2) The use of the complete set of single-stranded DNA as described in any one of claims 1-3, or the primer pair as described in claim 4, or the reagent or kit as described in claim 5 in the detection of Bifidobacterium strains, or in the preparation of products for the detection of Bifidobacterium strains.

10. The complete set of single-stranded DNA according to any one of claims 1-3, or the primer pair according to claim 4, or the reagent or kit according to claim 5, or the method according to any one of claims 6-8, or the application according to claim 9, characterized in that: The Bifidobacterium strains used for detection are those found in intestinal microorganisms.

Images