Method for detecting low-arsenic accumulation genotype of wheat grains based on KASP marker
By designing a KASP marker method for stable genetic SNP loci that accumulate low arsenic in wheat grains, and combining it with fluorescence detection, the problems of long identification cycles and low accuracy in traditional methods have been solved, enabling rapid and accurate genotyping and promoting the breeding process of low arsenic wheat.
Patent Information
- Application Number
- CN202511075982.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-01
- Publication Date
- 2025-12-23
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately identifying arsenic accumulation genotypes in wheat grains. Traditional methods are time-consuming and rely on phenotypic determination, which cannot meet the needs of early-stage breeding screening. Furthermore, there is a lack of KASP marker detection methods for stable genetic loci.
A KASP marker method was designed for stable genetic SNP sites with low arsenic accumulation in wheat grains. The low arsenic accumulation genotype was rapidly identified by KASP-PCR amplification combined with fluorescence detection and using specific KASP primers and Touchdown PCR program.
It achieves highly specific, rapid, and accurate genotype identification, shortens the detection cycle, improves breeding efficiency, is suitable for high-throughput detection, directly serves breeding practices, and promotes the breeding of low-arsenic wheat varieties.
Smart Images

Figure CN121183005A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of wheat molecular breeding technology, and more specifically, it relates to a method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers. Background Technology
[0002] Arsenic is a highly toxic and carcinogenic metalloid element widely present in the environment. It can enter crops through contaminated soil and groundwater, ultimately threatening human health through the food chain. As one of the world's major food crops, wheat's accumulation of arsenic in its grains poses a serious threat to food safety. Therefore, elucidating the genetic mechanisms of arsenic accumulation in wheat grains and breeding wheat varieties with low arsenic accumulation are of great significance.
[0003] Currently, research on arsenic accumulation in crops mainly focuses on crops such as rice and maize, while the genetic mechanisms of arsenic accumulation in wheat grains are relatively limited. Although existing studies have identified some genetic loci associated with arsenic accumulation in wheat grains, these loci are mostly minor, and some are only observed in supplementary materials, lacking significance and making them difficult to consistently apply to breeding practices. Furthermore, traditional methods for identifying low-arsenic-accumulating genotypes in wheat rely on phenotypic determination of grain arsenic content, which requires physicochemical analysis (such as ICP-MS) after plant maturity. This approach is time-consuming, inefficient, and dependent on environmental conditions, failing to meet the needs of early breeding screening.
[0004] Molecular marker-assisted selection technology offers a potential solution to the aforementioned problems. Among them, KASP (competitive allele-specific PCR) marker technology, based on fluorescence detection for precise genotyping, boasts advantages such as high specificity, ease of operation, and suitability for high-throughput detection, making it widely used in crop breeding. However, currently, there is a lack of specific KASP marker detection methods developed based on stable genetic loci for the low arsenic accumulation trait in wheat grains. This makes it difficult to efficiently and accurately identify low arsenic accumulation genotypes, thus hindering the breeding progress of low arsenic wheat varieties.
[0005] Therefore, developing a KASP marker detection method based on stable genetic loci to achieve rapid and accurate identification of low arsenic accumulation genotypes in wheat grains is of great value for promoting low arsenic wheat breeding and ensuring food safety. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers.
[0007] A method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers includes the following steps:
[0008] 1) Extract genomic DNA from wheat samples;
[0009] 2) KASP primers were designed for stable genetic SNP loci controlling low arsenic accumulation in wheat grains. The SNP loci were selected from at least one of the following: AX-110393422 (chromosome 1A, 531641827bp), AX-110370420 (chromosome 2A, 58462017bp), AX-109339465 (chromosome 2D, 111001161bp), AX-109455432 (chromosome 3B, 118139943bp), AX-109359598 (chromosome 3B, 404801032bp), and AX-111655266 (chromosome 6B, 694252672bp).
[0010] KASP primers include two allele-specific forward primers (F1, F2) and one universal reverse primer (R), where the 5' end of F1 is connected to the FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) and the 5' end of F2 is connected to the HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT).
[0011] 3) Using the DNA from step 1) as a template, perform KASP-PCR amplification using the primers from step 2). The reaction system (10 μL) includes:
[0012] 2 μL of genomic DNA (50-100 ng / μL), 5 μL of 2×KASPMasterMix, 0.14 μL of KASP primer mixture (final concentration 70 nM), and sterile ddH2O to bring the total to 10 μL;
[0013] The reaction program was as follows: pre-denaturation at 94℃ for 15 minutes; denaturation at 94℃ for 20 seconds; annealing at 61℃ → 55℃ for 60 seconds (decreasing by 0.8℃ per cycle), for a total of 10 cycles;
[0014] Subsequently, denaturation was performed at 94°C for 20 seconds, followed by annealing and extension at 57°C for 60 seconds, for a total of 26-35 cycles. Fluorescence signals were collected after each cycle (FAM: 485nm excitation / 520nm emission; HEX: 528nm excitation / 560nm emission).
[0015] 4) Genotype determination based on fluorescence signals: If only FAM signal is detected, the individual is identified as homozygous for the dominant haplotype; if only HEX signal is detected, the individual is identified as homozygous for the inferior haplotype; if both signals are detected simultaneously, the individual is identified as heterozygous.
[0016] 5) When the genotype is the dominant haplotype, it is determined to be a low arsenic accumulation genotype.
[0017] Preferably, the KASP primer sequences for the SNP sites in step 2) are as follows:
[0018] AX-110393422: F1 is GAAGGTGACCAAGTTCATGCTGTTCGCATCCTTCATTTCATCTG, F2 is GAAGGTCGGAGTCAACGGATTGTTCGCATCCTTCATTTCATCTA, R is CCATGGATCCGAACAAAATGGA;
[0019] AX-110370420: F1 is GAAGGTGACCAAGTTCATGCTGGATTTAGGCTAGTTAGATGGTATGC, F2 is GAAGGTCGGAGTCAACGGATTGGATTTAGGCTAGTTAGATGGTATGT, R is CTAACTAGAAGACCATCAGCGGCA;
[0020] AX-109339465: F1 is GAAGGTGACCAAGTTCATGCTGTTTCGGCCATTTGGTTAAATTC, F2 is GAAGGTCGGAGTCAACGGATTGTTTCGGTTAAATTTG, R is CAGATATTCGGCGAATTTCAGC;
[0021] AX-109455432: F1 is GAAGGTGACCAAGTTCATGCTGAGTAGAGTCAAGTGAGAAC, F2 is GAAGGTCGGAGTCAACGGATTGAGTAGAGTCAAGTGAGAAT, R is TGCGCTGGGTTGAGGAGGAG;
[0022] AX-109359598: F1 is GAAGGTGACCAAGTTCATGCTGAGACCGTAGTTGTTTGGACCG, F2 is GAAGGTCGGAGTCAACGGATTGAGACCGTAGTTGTTTGGACCA, R is AGCATCTGCATAGCTCTTCTGC;
[0023] AX-111655266: F1 is GAAGGTGACCAAGTTCATGCTGAGCGGACCGAATAGATAAGGT, F2 is GAAGGTCGGAGTCAACGGATTGAGCGGACCGAATAGATAAGGC, R is GGCTATAACATGGGCCCATC.
[0024] Preferably, the genomic DNA extraction in step 1) is performed using the CTAB method, and the extracted DNA purity must meet the requirements of A260 / A280 of 1.8-2.0 and concentration of 50-100 ng / μL.
[0025] Preferably, the number of PCR cycles in step 3) is adjusted according to the DNA concentration: when the DNA concentration is 50-100 ng / μL, 26 cycles are used; when the DNA concentration is <50 ng / μL, the number of cycles is increased to 35.
[0026] Preferably, the dominant haplotypes in step 4) are: AX-110393422 is GG, AX-110370420 is GG, AX-109339465 is CC, AX-109455432 is CC, AX-109359598 is CC, and AX-111655266 is TT.
[0027] Preferably, the criteria for determining the low arsenic accumulation genotype in step 5) are: carrying at least one dominant haplotype and having an arsenic content in the grain ≤ 0.5 mg / kg.
[0028] Preferably, wheat samples are selected from wheat seedlings, leaves or grains, and the sampling period is from the seedling stage to the physiological maturity stage.
[0029] Preferably, in step 3), KASPMasterMix is KASPV4.0 from LGCBiosearch Technologies, which contains Taq enzyme, dNTPs and fluorescent probes.
[0030] Preferably, in step 4), the fluorescence signal detection is performed using a real-time quantitative PCR instrument with detection channels of FAM (485nm excitation / 520nm emission) and HEX (528nm excitation / 560nm emission).
[0031] Preferably, the method is used for screening wheat germplasm resources, identifying the genotype of hybrid offspring, or detecting the purity of low-arsenic varieties.
[0032] Compared with the prior art, the present invention has the following beneficial effects:
[0033] 1. High detection specificity and precise identification of low-arsenic genotypes: This method designs specific KASP primers for six stable genetic SNP loci (AX-110393422, AX-110370420, AX-109339465, AX-109455432, AX-109359598, AX-111655266) that control arsenic accumulation in wheat grains. The primer sequences are precisely matched with the polymorphic bases of the SNP loci (e.g., the F1 primer of AX-111655266 matches the C allele, and the F2 primer matches the T allele). Furthermore, the Touchdown PCR program (annealing at 61℃→55℃, decreasing by 0.8℃ per cycle) further improves the amplification specificity, effectively distinguishing dominant haplotypes (e.g., GG, CC, TT), inferior haplotypes (e.g., AA, GG, CC), and heterozygotes, avoiding misjudgments caused by non-specific amplification.
[0034] 2. High accuracy and significant correlation with phenotype: The SNP loci detected by this method are multi-environmentally stable genetic loci, among which the major locus AX-111655266 was identified in all environments. Dominant haplotypes are significantly correlated with grain arsenic content; for example, the dominant haplotype TT of AX-111655266 reduces grain arsenic content compared to the inferior haplotype CC, and the dominant haplotype GG of AX-110393422 reduces it. Genotype is directly determined by fluorescence signals, combined with ICP-MS phenotypic verification, resulting in high consistency between genotype and phenotype, ensuring reliable identification results for low-arsenic genotypes.
[0035] 3. Short detection cycle, enabling early screening: This method is based on wheat genomic DNA detection, and samples can be taken from early materials such as seedling leaves and seedling tissues. There is no need to wait for plant maturity and grain formation. Compared with the traditional method that relies on grain arsenic content determination (which requires physiological maturity), the detection cycle is greatly shortened. Individuals carrying dominant haplotypes can be quickly screened in the early stages of breeding (such as F2 generation), reducing the retention of ineffective breeding materials and improving breeding efficiency.
[0036] 4. Simple and efficient operation, suitable for high-throughput detection: The PCR reaction system (10μL) and procedure of this method are standardized, including pre-denaturation, Touchdown amplification and fluorescence acquisition stages, which can be completed automatically by a real-time quantitative PCR instrument; a single reaction can detect 96 or 384 samples at the same time, and the number of cycles can be flexibly adjusted according to the DNA concentration (26-35 cycles), which is suitable for large-scale germplasm resource screening or breeding population typing, reducing detection costs.
[0037] 5. Directly serving breeding practices and assisting in the cultivation of low-arsenic varieties: This method can accurately identify materials carrying one or more dominant low-arsenic haplotypes, providing clear targets for molecular marker-assisted breeding. By detecting dominant haplotypes at sites such as AX-109339465 (2D) and AX-111655266 (6B), materials with grain arsenic content ≤0.5 mg / kg can be screened in a targeted manner, accelerating the cultivation process of low-arsenic-accumulating wheat varieties and reducing the threat of arsenic pollution to food safety.
[0038] 6. Wide range of applications, covering multiple application scenarios: This method can not only be used for genotyping of wheat hybrid offspring, but also for screening low-arsenic genotypes in natural population germplasm resources, detecting the purity of low-arsenic varieties, and verifying genetic stability (such as the homozygosity identification of high-generation homozygous lines), providing comprehensive technical support for genetic research and breeding applications of low-arsenic accumulation traits in wheat. Attached Figure Description
[0039] Figure 1 This is a KASP genotyping result image of the AX-110393422 locus in this invention;
[0040] Figure 2 This is a KASP genotyping result image of the AX-110370420 locus in this invention;
[0041] Figure 3 This is a KASP genotyping result image of the AX-109339465 locus in this invention;
[0042] Figure 4 This is a KASP genotyping result image of the AX-109455432 locus in this invention;
[0043] Figure 5 This is a KASP genotyping result image of the AX-109359598 locus in this invention;
[0044] Figure 6 This is a KASP typing result image of the AX-111655266 locus in this invention;
[0045] Figure 7 This is a schematic diagram of the arsenic content distribution in wheat grains in this invention;
[0046] Figure 8 These are the GWAS Manhattan diagram and QQ diagram in this invention. Detailed Implementation
[0047] Please see Figure 1-8 This invention provides a method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers. To make the objectives, technical solutions, and effects of this invention clearer, the following detailed description is provided in conjunction with specific embodiments.
[0048] Preparation of experimental materials:
[0049] Wheat samples for testing: The wheat materials to be tested were selected, including natural population varieties, hybrid progeny lines, or intermediate breeding materials. The samples were obtained from wheat seedling leaves, mature leaves, or grains (ground into powder), and the sampling period was from the seedling stage to the physiological maturity stage. All samples were from germplasm resources preserved by the Institute of Crop Molecular Breeding, Henan Academy of Agricultural Sciences, and had passed DNA quality testing.
[0050] Main reagents and instruments:
[0051] Genomic DNA extraction reagents: CTAB extraction buffer (containing 2% CTAB, 1.4M NaCl, 20mM EDTA, 100mM Tris-HCl, pH 8.0), chloroform-isoamyl alcohol (24:1), anhydrous ethanol, 70% ethanol, RNase A (10mg / mL);
[0052] KASP reaction reagents: 2×KASPMasterMix (LGC Biosearch Technologies' KASPV4.0, containing hot-start Taq enzyme, dNTPs, and FAM / Hex fluorescent probes), sterile ddH2O;
[0053] KASP primers: Specific primers designed based on 6 stable genetic SNP loci (AX-110393422, AX-110370420, AX-109339465, AX-109455432, AX-109359598, AX-111655266), the sequences of which are shown in Table 1 below;
[0054] Instruments: High-speed centrifuge (12000 rpm), Nucleic acid and protein analyzer (NanoDrop) TM One), real-time quantitative PCR instrument (with FAM and Hex fluorescence detection channels), constant temperature incubator, grinder.
[0055] Genomic DNA extraction and quality testing:
[0056] DNA extraction steps:
[0057] Wheat genomic DNA was extracted using the CTAB method:
[0058] Take 0.1g of wheat leaf tissue, grind it into powder in liquid nitrogen, and transfer it to a 2mL centrifuge tube;
[0059] Add 600 μL of CTAB extraction buffer preheated at 65℃, vortex to mix, and then incubate at 65℃ for 30 minutes (inverting and mixing 2-3 times during this period).
[0060] Add an equal volume of chloroform-isoamyl alcohol (24:1), gently invert and mix for 10 minutes, then centrifuge at 4°C and 12,000 rpm for 10 minutes.
[0061] Transfer the supernatant to a new centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, and incubate at -20°C for 30 minutes to precipitate the DNA.
[0062] Centrifuge at 4℃ and 12000rpm for 10 minutes, discard the supernatant, wash the precipitate twice with 70% ethanol, and air dry at room temperature;
[0063] Add 50 μL of ddH2O containing RNase A, incubate at 37°C for 30 minutes to remove RNA, and store at -20°C for later use.
[0064] DNA quality testing:
[0065] Purity testing: The A260 / A280 ratio is measured using a nucleic acid protein analyzer and is required to be between 1.8 and 2.0 to ensure that there is no contamination from impurities such as proteins and phenols.
[0066] Concentration detection: Adjust the DNA concentration to 50-100 ng / μL. If the concentration is too low, it needs to be concentrated using a vacuum concentrator; if it is too high, it needs to be diluted with ddH2O.
[0067] Integrity test: 1% agarose gel electrophoresis (120V, 30 minutes) was used to observe whether the DNA bands were clear and undegraded.
[0068] KASP-labeled PCR reaction system and procedure:
[0069] Reaction system preparation (10 μL system): Prepare the PCR reaction system precisely according to the table below. All operations should be performed on ice:
[0070] Element Volume (μL) Remark Genomic DNA (50-100 ng / μL) 2.0 The concentration must be uniform to avoid impurities. 2×KASPMasterMix 5.0 Contains Taq enzyme, dNTPs, and FAM / Hex fluorescent probes KASP primer mixture 0.14 Final concentration 70 nM, containing F1, F2, and R primers (Table 1) <![CDATA[Sterile ddH2O]]> Add to 10 μL Nuclease water replenishment system
[0071] Table 1: KASP primer sequences for 6 stable genetic SNP loci:
[0072]
[0073] PCR reaction procedure:
[0074] Pre-denaturation stage: 94℃ for 15 minutes to activate hot-start Taq enzyme and completely denature the DNA template;
[0075] Touchdown amplification phase (10 cycles): 94℃ for 20 seconds (denaturation), 61℃ → 55℃ for 60 seconds (annealing, decreasing by 0.8℃ per cycle) to improve specificity and avoid non-specific amplification;
[0076] Fluorescence acquisition phase (26-35 cycles): 94℃ for 20 seconds (denaturation), 57℃ for 60 seconds (annealing and extension). Fluorescence signals are acquired after each cycle (FAM: 485nm excitation / 520nm emission; Hex: 528nm excitation / 560nm emission). Note: The number of cycles should be adjusted according to the DNA concentration; 26 cycles for 50-100 ng / μL, and 35 cycles for <50 ng / μL.
[0077] Genotyping and Result Analysis:
[0078] Fluorescence signal detection: After the PCR reaction is completed, the fluorescence intensity of FAM and Hex is read by a real-time quantitative PCR instrument to generate a scatter plot.
[0079] Genotype determination criteria:
[0080] Only FAM fluorescence signal was detected: the individual was identified as a dominant haplotype homozygote (e.g., AX-110393422 was GG, AX-109339465 was CC);
[0081] Only Hex fluorescence signal was detected: the individual was identified as a homozygous inferior haplotype (e.g., AX-110393422 is AA, AX-109339465 is GG);
[0082] FAMHEX fluorescence signal detected: identified as heterozygous (e.g., AX-110393422 is GA).
[0083] Determination of low arsenic accumulation genotype: A sample is classified as having a low arsenic accumulation genotype when it carries at least one dominant haplotype. Specifically:
[0084] AX-111655266(6B) is the major-effect locus controlling arsenic accumulation in grains. The dominant haplotype TT can reduce arsenic content by 42.70% (BLUP value), explaining 15.14%-21.53% of phenotypic variation. The genetic effects of the quantitative trait nucleotide (QTN) locus are shown in the table below:
[0085]
[0086] When two or more dominant haplotypes are polymerized (such as AX-109339465+AX-111655266), the arsenic content reduction effect is more significant (40%-60%).
[0087] Accuracy verification: Standard samples with known genotypes (such as low-arsenic varieties homozygous for AX-111655266TT and high-arsenic varieties homozygous for CC) were selected, and KASP detection and ICP-MS phenotypic verification (determination of grain arsenic content) were performed simultaneously. The results showed that the genotype and phenotype consistency was ≥98%.
[0088] Application scenarios:
[0089] Screening of wheat germplasm resources: Rapid identification of materials carrying low-arsenic dominant haplotypes in natural populations;
[0090] Molecular marker-assisted breeding: screening for target genotypes in early generations (F2-F3) of hybrid offspring to reduce the cost of phenotypic identification;
[0091] Variety purity testing: to verify the genetic stability of low-arsenic varieties and ensure that the homozygosity of dominant haplotypes is ≥95%.
[0092] This implementation method strictly follows the KASP marker sequence, PCR parameters, and genotype-phenotype association relationships recorded in the disclosure document, without adding any additional content. It can stably and efficiently detect low arsenic accumulation genotypes in wheat grains, providing reliable technical support for low arsenic wheat breeding.
[0093] The embodiments of the present invention are given for illustrative and descriptive purposes only, and are not intended to be exhaustive or to limit the invention to the forms disclosed. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of the invention, and to enable those skilled in the art to understand the invention and to design various embodiments with various modifications suitable for a particular purpose.
Claims
1. A method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers, characterized in that: Includes the following steps: 1) Extract genomic DNA from wheat samples; 2) KASP primers were designed for stable genetic SNP loci controlling low arsenic accumulation in wheat grains. The SNP loci were selected from at least one of the following: AX-110393422 (chromosome 1A, 531641827bp), AX-110370420 (chromosome 2A, 58462017bp), AX-109339465 (chromosome 2D, 111001161bp), AX-109455432 (chromosome 3B, 118139943bp), AX-109359598 (chromosome 3B, 404801032bp), and AX-111655266 (chromosome 6B, 694252672bp). KASP primers include two allele-specific forward primers (F1, F2) and one universal reverse primer (R), where the 5' end of F1 is connected to the FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) and the 5' end of F2 is connected to the HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT). 3) Using the DNA from step 1) as a template, perform KASP-PCR amplification using the primers from step 2). The reaction system (10 μL) includes: 2 μL of genomic DNA (50-100 ng / μL), 5 μL of 2×KASPMasterMix, 0.14 μL of KASP primer mixture (final concentration 70 nM), and sterile ddH2O to bring the total to 10 μL; The reaction program was as follows: pre-denaturation at 94℃ for 15 minutes; denaturation at 94℃ for 20 seconds; annealing at 61℃ → 55℃ for 60 seconds (decreasing by 0.8℃ per cycle), for a total of 10 cycles; Subsequently, denaturation was performed at 94°C for 20 seconds, followed by annealing and extension at 57°C for 60 seconds, for a total of 26-35 cycles. Fluorescence signals were collected after each cycle (FAM: 485nm excitation / 520nm emission; HEX: 528nm excitation / 560nm emission). 4) Genotype determination based on fluorescence signals: If only FAM signal is detected, the individual is identified as homozygous for the dominant haplotype; if only HEX signal is detected, the individual is identified as homozygous for the inferior haplotype; if both signals are detected simultaneously, the individual is identified as heterozygous. 5) When the genotype is the dominant haplotype, it is determined to be a low arsenic accumulation genotype.
2. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 1, characterized in that, The KASP primer sequences for the SNP sites mentioned in step 2) are as follows: AX-110393422: F1 is GAAGGTGACCAAGTTCATGCTGTTCGCATCCTTCATTTCATCTG, F2 is GAAGGTCGGAGTCAACGGATTGTTCGCATCCTTCATTTCATCTA, and R is CCATGGATCCGAACAAAATGGA; AX-110370420: F1 is GAAGGTGACCAAGTTCATGCTGGATTTAGGCTAGTTAGATGGTATGC, F2 is GAAGGTCGGAGTCAACGGATTGGATTTAGGCTAGTTAGATGGTATGT, and R is CTAACTAGAAGACCATCAGCGGCA; AX-109339465: F1 is GAAGGTGACCAAGTTCATGCTGTTTCGGCCATTTGGTTAAATTC, F2 is GAAGGTCGGAGTCAACGGATTGTTTCGGTTAAATTTG, and R is CAGATATTCGGCGAATTTCAGC; AX-109455432: F1 is GAAGGTGACCAAGTTCATGCTGAGTAGAGTCAAGTGAGAAC, F2 is GAAGGTCGGAGTCAACGGATTGAGTAGAGTCAAGTGAGAAT, and R is TGCGCTGGGTTGAGGAGGAG; AX-109359598: F1 is GAAGGTGACCAAGTTCATGCTGAGACCGTAGTTGTTTGGACCG, F2 is GAAGGTCGGAGTCAACGGATTGAGACCGTAGTTGTTTGGACCA, and R is AGCATCTGCATAGCTCTTCTGC; AX-111655266: F1 is GAAGGTGACCAAGTTCATGCTGAGCGGACCGAATAGATAAGGT, F2 is GAAGGTCGGAGTCAACGGATTGAGCGGACCGAATAGATAAGGC, and R is GGCTATAACATGGGCCCATC.
3. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 2, characterized in that, In step 1), genomic DNA was extracted using the CTAB method. The extracted DNA purity should meet the requirements of A260 / A280 of 1.8-2.0 and a concentration of 50-100 ng / μL.
4. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 3, characterized in that, In step 3), the number of PCR cycles is adjusted according to the DNA concentration: when the DNA concentration is 50-100 ng / μL, use 26 cycles; when the DNA concentration is <50 ng / μL, increase to 35 cycles.
5. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 4, characterized in that, The dominant haplotypes mentioned in step 4) are: AX-110393422 is GG, AX-110370420 is GG, AX-109339465 is CC, AX-109455432 is CC, AX-109359598 is CC, and AX-111655266 is TT.
6. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 5, characterized in that, The criteria for determining the low arsenic accumulation genotype in step 5) are: carrying at least one of the dominant haplotypes and having an arsenic content in the grain ≤ 0.5 mg / kg.
7. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 6, characterized in that, The wheat samples were selected from wheat seedlings, leaves, or grains, and the sampling period was from the seedling stage to the physiological maturity stage.
8. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 7, characterized in that, In step 3), KASPMasterMix is KASPV4.0 from LGCBiosearch Technologies, which contains Taq enzyme, dNTPs, and fluorescent probes.
9. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 8, characterized in that, In step 4), fluorescence signal detection was performed using a real-time quantitative PCR instrument with detection channels of FAM (485nm excitation / 520nm emission) and HEX (528nm excitation / 560nm emission).
10. The method for detecting low arsenic accumulation genotypes in wheat grains based on KASP markers as described in claim 9, characterized in that, The method is used for screening wheat germplasm resources, identifying the genotype of hybrid offspring, or detecting the purity of low-arsenic varieties.