Recombinant and modified CRY proteins for controlling insect pests

Abstract

The present disclosure relates to recombinant and modified Cry proteins for use in methods and compositions for controlling coleopteran pests, in particular sugar cane weevil pests, more specifically sugar cane weevil pests of the crop plant sugar cane. More specifically, the present disclosure relates to recombinant and modified Cry proteins based on and derived from a Cry protein named SCW35. The present disclosure also relates to the production of pesticidal compositions using these proteins. In addition, the present disclosure relates to a method for controlling coleopteran pests, more particularly the coleopteran pest sugarcane weevil.

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 493,433, filed March 31, 2023, the entire contents of which are incorporated herein by reference.

[0003] Reference to electronic sequence listing

[0004] The entire contents of the electronic sequence list (207422000340seqlist.xml; size: 45,894 bytes; creation date: March 27, 2024) are incorporated here by reference. Technical Field

[0005] This disclosure relates to methods for controlling insect pests (particularly Coleoptera pests, and more specifically, crop sugarcane). Sugarcane weevil ( Sphenophorus levis This disclosure relates to methods and compositions for controlling insect pests, specifically recombinant and modified Cry proteins. More specifically, this disclosure relates to recombinant and modified Cry proteins based on and derived from a Cry protein named SCW35. This disclosure also relates to the production of insecticidal compositions using these proteins. Furthermore, this disclosure relates to the use of these proteins to control insect pests, more specifically, to control Coleoptera pests (e.g., insects that kill insects). Sugarcane weevil The method. Background Technology

[0006] Invertebrate pests cost the global economy hundreds of billions of dollars annually, consuming and destroying cultivated crops vital to human health and survival. In addition to these economic losses, the damage caused by invertebrate pests also wastes a significant portion of potential agricultural food.

[0007] Sugarcane (Saccharum genus) is an important crop used to produce a variety of foods and ethanol. A clonal crop, sugarcane belongs to the same family as corn, rice, and wheat, and is cultivated as the world's largest source of sugar. In addition to its importance as food, sugarcane is also a source of biofuel, ethanol, with a global market size of approximately $50 billion. Sugarcane pests include borers (such as the sugarcane borer), suckers (such as whiteflies), and soil pests (such as termites). The most important sugarcane pests belong to the orders Lepidoptera, Coleoptera, Hemiptera, Hymenoptera, and Isoptera; examples of pests from each order are the sugarcane borer, bollweevil, red-leafhopper, leaf-cutting ant, and termite. One particularly harmful insect pest is the sugarcane weevil or sugarcane billbug (official name: sugarcane billbug). Sphenophorus levis It is a type of Coleoptera pest belonging to the family Cercopithecidae. Sugarcane weevil The damage to sugarcane plants is twofold: first, the insect burrows into the plant's stem tissue and lays eggs; second, the larvae hatching from the eggs feed voraciously on the plant. This damage can result in the loss of 60% of the young stems and 30% of the total crop loss.

[0008] To combat insects affecting sugarcane, the most common solution is the use of chemical mixtures or biopesticides containing at least one insecticidal and / or nematicidal ingredient. These chemical mixtures work by inhibiting multiple stages of the insect's life cycle, affecting behaviors essential for its survival, or directly causing its death. However, these chemicals often affect a wide range of pest groups beyond the target pest, which can harm beneficial symbiotic organisms in the crop, leading to yield reduction. Other problems with these chemical mixtures include the potential environmental accumulation of toxic compounds in the mixture within the crop's surrounding environment. Furthermore, chemical pesticides may not be effective against pests on sugarcane because the feeding behavior of larvae in the stalks prevents effective contact between the pesticide and the insect pests. Some insect pests, such as... Sugarcane weevil They feed at the base of the stem. This feeding behavior makes large-scale application of chemical pesticides more difficult because effective application is done on the ground, not in the air. For biological pesticides, several options are available, including parasitoid wasps (e.g., Cotesia flavipes , Trichogramma galloi and Tetrastichus howardii ), insect pathogenic fungi (e.g., Metarhizium anisopliae) Metarhizium anisopliae ) and Beauveria bassiana ( Beauveria bassianaBiological pesticides (Bacillus thuringiensis) and bacteria (e.g., Bacillus thuringiensis). Compared to chemical mixtures, biological pesticides are more expensive. Furthermore, biological pesticides have strict requirements for application methods and are only effective under limited conditions. To achieve a certain level of treatment efficacy, multiple approaches are usually required to control insect pests.

[0009] The use of heterologous Bacillus thuringiensis (Bt) proteins, such as delta-endotoxin proteins, can replace chemical mixtures and biopesticides because these proteins can target pests more precisely, degrade more rapidly in the surrounding soil, and have lower levels of bioaccumulation compared to many chemical pesticide mixtures. Furthermore, these proteins allow for the use of other delivery methods, including through compositions and / or transgenic plants. These active delta-endotoxin proteins exert toxicity on target insect pests by inducing selective stomach poisoning in the insect gut. These proteins attach to the interior of the insect gut and cause deterioration of the intestinal cell membrane, ultimately creating holes in the gut that kill the insect. Unlike the insect gut, the human gut is capable of rapidly and harmlessly breaking down any Bt proteins it comes into contact with.

[0010] Many Bt proteins are species-selective, thus limiting their applicability to specific pest species. While this species selectivity makes Bt proteins more suitable for human consumption than some chemical pesticides, it also means that targeted Bt proteins are needed to address specific pests. Therefore, extensive research is required to identify specific Bt proteins effective against particular target pests. Furthermore, many insects have developed resistance to specific Bt proteins, especially those that have been consistently used in many generations of crops.

[0011] Clearly, we need to find novel and effective proteins that are toxic to plant pests, especially sugarcane pests, more specifically the sugarcane weevil or sugarcane beetle (formal name: Sugarcane weevil Bt proteins have not yet been successfully targeted at this harmful pest, but their advantages over chemical mixtures make them an ideal tool for controlling it. Summary of the Invention

[0012] To meet these needs, this disclosure provides methods for controlling coleopteran pests using recombinant modified, truncated, and / or mutant forms of the Cry8 protein (designated SCW35), insecticidal compositions comprising these proteins, expression cassettes encoding these proteins, and plants comprising them. Specifically, this disclosure relates to the control of coleopteran pests... Sugarcane weevil Uses of toxic recombinant modifications, truncated and / or mutated SCW35 protein.

[0013] In some aspects, this disclosure relates to recombinant polypeptides having at least 40%, at least 60%, or at least 90% sequence identity with SEQ ID NO: 1, and / or variants or fragments thereof. In some embodiments of this aspect, the recombinant polypeptide comprises SEQ ID NO: 1.

[0014] In another aspect, this disclosure relates to a recombinant polypeptide comprising at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1; and / or comprising at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1. In some embodiments of this aspect, the recombinant polypeptide comprises a sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polypeptide has at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5; and / or comprises at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0015] In a further embodiment of this aspect (which may be combined with any of the foregoing embodiments), the recombinant polypeptide is a fusion protein comprising at least a portion of the polypeptide, variants thereof, and fragments of any of the foregoing embodiments. In some embodiments of this aspect, the polypeptide has insecticidal activity against at least one agricultural insect pest. In some embodiments of this aspect, the at least one insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0016] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0017] Certain aspects of this disclosure relate to recombinant polynucleotides encoding polypeptides of any of the foregoing embodiments. In some embodiments of this aspect, the recombinant polynucleotide comprises a sequence selected from SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO: 11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide has codons optimized for expression in agriculturally important crops. In some embodiments of this aspect, the agriculturally important crop is sugarcane, and the polynucleotide includes SEQ ID NO: 11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide is a non-genomic polynucleotide. In some embodiments of this aspect, the polynucleotide is a synthetic polynucleotide, and / or the polynucleotide is cDNA.

[0018] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises at least one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect, the polynucleotide comprises at least one of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, or tissue-specific promoters.

[0019] In some aspects, this disclosure relates to a transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide, a polynucleotide, or an isolated construct or expression cassette of any of the foregoing embodiments. In some embodiments of this aspect, the one or more polypeptides are selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect, the one or more polynucleotides are selected from SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

[0020] Another aspect of this disclosure relates to an insecticidal composition comprising: (i) one or more polypeptides of any of the foregoing embodiments, wherein the concentration of said one or more polypeptides is sufficient to control at least one agricultural insect pest; (ii) one or more polynucleotides of any of the foregoing embodiments, wherein said polynucleotides optionally have codons optimized for expression in agriculturally important crops; and / or (iii) one or more isolated constructs or expression cassettes of any of the foregoing embodiments. In some embodiments of this aspect, said one or more polypeptides are selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5. In some embodiments of this aspect, said one or more polynucleotides are selected from SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), said at least one insect pest is a coleopteran pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), when the composition is applied to plants or plantations, the concentration of the one or more polypeptides present is sufficient to control at least one agricultural insect pest in or on the plant. In some embodiments of this aspect, the plants and plantations include sugarcane. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) also contain one or more inert ingredients and / or an acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as an orally acceptable, orally applicable, or orally ingestible feed for consumption by insect pests. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated for direct soil application and / or direct potting substrate application. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a controlled-release formulation.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), control of coleopteran pests includes: (a) reducing pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or (b) increasing pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pests are selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0021] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) or Scarabaeidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0022] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: (a) providing a composition comprising at least one polypeptide from any of the foregoing embodiments, or providing a composition from any of the foregoing embodiments; and (b) contacting an insect pest population with an effective amount of the composition. In some embodiments of this aspect, the at least one polypeptide is selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) comprises one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; applying the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into the pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), contact in step (b) includes applying the composition to the plant or the area to be planted. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to the plant by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), pests are brought into contact with an effective amount of the composition by feeding, spraying, spreading, coating, or wetting the composition, or any combination thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to insect pest populations that have not been exposed to the composition.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0023] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0024] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: (a) providing an insecticidal composition comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5; (b) introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and wherein the insect pest population is reduced. In some embodiments of this aspect, the introduction in step (b) comprises one or more of the following: providing the pest with a composition formulated as insect bait; feeding the pest the composition; applying the composition to a plant; applying the composition to plant parts fed by the pest; applying the composition to an insect pest trap; or injecting the composition into a plant. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste, colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier.

[0025] In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants by at least one of foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an insect pest population not exposed to the composition, or the pest mortality rate is increased by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include providing a chemical mixture, insecticidal protein, and / or biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, insecticidal protein, and / or biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0026] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0027] Other aspects of this disclosure relate to the use of the polypeptides in any of the foregoing embodiments for the purpose of inhibiting insect growth, controlling or killing insects, and / or controlling or killing insect populations. Brief description of the attached diagram

[0029] Figure 1A-1CSequence alignments of peptides SCW35 (“SEQ1”, SEQ ID NO: 1), SCW52 (“SEQ2”, SEQ ID NO: 2), SCW57 (“SEQ3”, SEQ ID NO: 3), SCW58 (“SEQ4”, SEQ ID NO: 4), and SCW104 (“SEQ5”, SEQ ID NO: 5) are shown. Figure 1A The first part of the comparison is shown. Figure 1B The second part of the comparison is shown. Figure 1C The third part of the comparison is shown. Figure 1A-1C In the diagram, the asterisk below indicates that the same amino acid residues are present in each sequence, while a space or period indicates that at least one sequence has different amino acid residues at that position.

[0030] Figure 2 The results of the bioassay screening for the toxicity of recombinant Cry proteins against sugarcane weevil (or sugarcane weevil, SCW) larvae are shown. The vertical axis shows the relative mortality percentage for each tested protein, and the horizontal axis lists these proteins. The first five bars (dark gray) show the mortality percentage of the proteins disclosed herein; from left to right, they are: SCW35 (SEQ ID NO: 1), SCW52 (SEQ ID NO: 2), SCW57 (SEQ ID NO: 3), SCW58 (SEQ ID NO: 4), and SCW104 (SEQ ID NO: 5). The remaining bars (light gray) include tests for proteins of the Cry3 family (SCW1, SCW2, SCW5, SCW6), Cry34 and Cry35 (SCW3 / SCW4, SCW3 / SCW4 / SCW6), Cry7 family (SCW7, SCW83, SCW86, SCW91, SCW93, SCW95, SCW98), and Cry8 family (SCW16, SCW64–SCW67, SCW71–73, SCW31, SCW32, SCW34, SCW60, SCW75). Table 1 below provides the corresponding codes for each protein for x-axis labeling.

[0031] Figure 3 The LC50 measurements of recombinant Cry proteins SCW52 (left; SEQ ID NO: 2) and SCW104 (right; SEQ ID NO: 5) are shown. The vertical axis represents the percentage of mortality, and the horizontal axis represents the dose of the Cry protein (μg / mL).

[0032] Figure 4Plant expression of a construct developed for the protein SCW52 (SEQ ID NO: 15) is shown. The construct components are labeled as follows: “T-NOS” and “T-NOS terminator (1)” each represent Agrobacterium tumefaciens (…). Agrobacterium tumefaciens The terminator of alkaloid synthase is "ScoSCW52"; "ScoSCW52" represents SEQ ID NO: 2; "I-OsACT1 intron" represents rice ( Oryza sativa (rice)) Introns of the actin gene I; “leader CAB 5UTR” represents the 5' untranslated region of the chlorophyll a / b-binding protein gene; “L-cab” represents the coding sequence of the chlorophyll a / b-binding protein gene; “P-2X35S” represents a plasmid component containing the cauliflower mosaic virus 35S promoter and repeat expression enhancer; “P-OsAct1+I-Act1” represents a plasmid component containing rice ( O. sativa The plasmid components of actin gene I and its corresponding introns; “6xHis-tag(1)” represents a six-histidine tag; “NPTII CDS” represents nptII The gene coding sequence; "SpecR" represents the spectinomycin resistance gene; "pUC_Ori" represents the origin of replication of the pUC plasmid; "pVS1" represents the presence of Pseudomonas spp. ( Pseudomonas The plasmid vector assembly contains sequences that enhance plasmid stability. Lengths are listed in base pairs (bp), with left and right boundaries indicated.

[0033] Figure 5 The results of toxicity bioassay screening for the chimeric protein SCW52 transformation events 004.003.A, 008.049.B, and 008.059.A in sugarcane are shown along the horizontal axis from left to right, compared to a negative control (“Ctrl(-)”) of non-genetically modified plants for sugarcane weevil (or sugarcane weevil, sugarcane beetle) larvae. The vertical axis shows the mortality percentage, calculated as the percentage of larvae that died after feeding (where 100% mortality means all larvae died). Detailed Implementation

[0034] The following description illustrates exemplary methods, parameters, etc. However, it should be understood that these descriptions are not intended to limit the scope of this disclosure, but rather to describe exemplary embodiments.

[0035] Methods for controlling insect pests

[0036] One aspect of this disclosure relates to a method for controlling insect pest populations, comprising: (a) providing a composition comprising at least one polypeptide from any of the foregoing embodiments, or providing a composition from any of the foregoing embodiments; and (b) contacting an insect pest population with an effective amount of the composition. In some embodiments of this aspect, the at least one polypeptide is selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, and / or variants or fragments thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), contact in step (b) includes one or more of the following: providing the pest with a composition formulated as an insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part (e.g., a sugarcane stalk) that the pest feeds on; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; applying the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into the pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g. for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the pest is brought into contact with an effective amount of the composition by feeding, spraying, spreading, coating, or wetting the composition or any combination thereof. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the contact in step (b) includes applying the composition to the plant or the area to be planted. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to the plant in at least one of the following ways: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. The method of plant treatment may vary depending on factors known in the art, such as the timing of planting, the resilience of individual plant parts or organs, the timing of insect pests, the extent and location of insect pest infestation, and / or the effective amount of the composition contained in the treatment.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to an insect pest population not exposed to the composition. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include providing a chemical mixture, an insecticidal protein (e.g., Bt protein), and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, insecticidal protein, and / or biocontrol agent before, during, or after step (b). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0037] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0038] Another aspect of this disclosure relates to a method for controlling insect pest populations, comprising: (a) providing an insecticidal composition comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5, or variants or fragments thereof; (b) introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and wherein the insect pest population is reduced. In some embodiments of this aspect, the introduction in step (b) comprises one or more of the following: providing the pest with a composition formulated as insect bait; feeding the pest the composition; applying the composition to a plant; applying the composition to plant parts fed by the pest; applying the composition to an insect pest trap; or injecting the composition into a plant. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g. for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is applied to plants in at least one of the following manner: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment. The method of plant treatment may vary depending on factors known in the art, such as planting timing, the resilience of individual plant parts or organs, the timing of insect pest appearance, the extent and location of insect pest infestation, and / or the effective amount of the composition included in the treatment. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to an insect pest population that has not been exposed to the composition. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include providing a chemical mixture, an insecticidal protein (e.g., Bt protein), and / or a biocontrol agent, and contacting the insect pest population with an effective amount of the chemical mixture, insecticidal protein, and / or biocontrol agent before, during, or after step (b).In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest or insect pest population is resistant to at least one Bt toxin. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0039] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0040] Other aspects of this disclosure relate to the use of the peptides in any of the foregoing embodiments for inhibiting insect growth, controlling or killing insects, and / or controlling or killing insect populations. In some embodiments, contact with one or more peptides from the foregoing embodiments results in insect stunting, cessation of plant damage, or insect death.

[0041] The active ingredient (i.e., the recombinant polypeptide) in this embodiment is typically present in the composition and can be applied to the crop area, plant, or seed to be treated. The composition of this embodiment can be applied simultaneously or sequentially with other compounds. The number of applications and the application rate depend on the severity of insect pest infestation.

[0042] "Controlling insect pest populations" aims to limit or eliminate associated damage to plants caused by insect pests by, for example, inhibiting their ability to grow, feed, and / or reproduce, or by killing them. The method includes preparing a compound or mixture containing an insecticidal recombinant polypeptide, and then contacting the compound or mixture with the insect pest. In some embodiments, this contact may include delivering the insecticidal polypeptide from insect bait to the insect pest. Another embodiment includes coating the insecticidal polypeptide onto plant seeds, whereby an insect interacts with the seeds or the resulting plant, thereby triggering the insecticidal activity of the polypeptide. In some embodiments, contacting the pest with the insecticidal composition of this disclosure includes exposing the insect pest to the insecticidal polypeptide at the site of insect attack. "Contact" also includes applying the composition to the outer surface of the pest, applying the composition to the plant on which the pest feeds, applying the composition to the soil where the pest may be present, applying the composition to a general area of ​​the pest population, applying the composition to an insect pest trap, injecting the composition into the plant or the pest, and any combination thereof.

[0043] The presence of the insecticidal polypeptides protects plants from insect pests, thereby controlling insect pests. On one hand, the use of expression cassettes to produce active insecticidal polypeptides can be used to prepare the compositions disclosed herein. In another embodiment, the invention provides recombinant microorganisms, transgenic plants, and / or any other animal organisms expressing active insecticidal polypeptides. These methods include transforming the organism with a nucleic acid sequence encoding the insecticidal polypeptide. Specifically, the nucleic acid sequences disclosed herein can be used to prepare plants and microorganisms with insecticidal activity. Thus, the invention provides transformed bacteria, yeast, plants, plant cells, plant tissues, plant parts, propagules, organs, tissues, embryos, and seeds. The compositions are insecticidal nucleic acids and proteins of bacterial species. The embodiments described herein can be used in agriculture as methods for protecting plants from insect pests and methods for influencing insect pests.

[0044] Compositions and formulations containing insecticidal polypeptides or variants or fragments thereof can be used in methods of controlling or influencing insect pests. "Influencing insect pests" is intended to mean, for example, preventing insect pests from further feeding on plants, harming insect pests, or killing insect pests. In this use, "influencing insect pests" is a form of insect pest control. Certain aspects and embodiments of this disclosure further provide methods for influencing plant insect pests, including, for example, applying a composition or formulation containing an insecticidal polypeptide to the environment of the insect pest. In one embodiment, the insecticidal polypeptide is combined with a carrier and subsequently applied to the environment of the insect pest. While these embodiments are not bound by any operational theory, in one embodiment, the insect pest ingests the insecticidal polypeptide, thereby influencing the insect pest. Insect pests can be contacted with an effective amount of the insecticidal composition by feeding, spraying, spreading, coating, wetting, and / or combinations thereof. The insecticidal composition can be applied to plants that insect pests are feeding on and / or will feed on by foliar treatment, seed coating, injection treatment, pre-emergence treatment, post-emergence treatment, and / or any combination thereof.

[0045] The compositions of this embodiment can be used to protect plants, plant parts, propagules, embryos, tissues, organs, seeds, and plant products in a variety of ways. For example, these compositions can be used in methods involving placing an effective amount of the insecticidal composition into the environment of pests by spraying, spreading, or seed coating. In one specific embodiment, such plants are sugarcane plants. In plant propagation materials (fruits, tubers, etc.) Bulbs, stems, tissue-cultured seedlings, corms, grains, seeds, and artificial seeds are typically treated with a protective coating before being sold commercially. This coating contains a herbicide, insecticide, fungicide, bactericide, nematicide, molluscicide, or a mixture of several of these formulations. If desired, it may also be used with other carriers, surfactants, or adjuvants commonly used in the formulation field to provide protection against damage caused by bacteria, fungi, or animal pests. The protective coating can be applied by impregnating the plant material with a liquid formulation or by coating it with a combination of wet or dry formulations. Furthermore, in special cases, other methods applied to plants may be used, such as treatments targeting buds or fruits. Plant material in embodiments coated with the insecticidal polypeptides of this disclosure can be treated with a protective coating containing a treatment compound, such as captan, carboxin, thiram, methaxamethyl, pyrimiphos-methyl, and other substances commonly used in seed treatments. Alternatively, the materials in the embodiments include a protective coating, which includes an insecticidal composition used alone or in combination with one of the protective coatings commonly used for seed treatment.

[0046] In other embodiments, the insecticidal composition of this disclosure can be applied to areas where plants are grown or will be grown, for example, directly to the soil or to the substrate of plant pots used to prepare planting material. This treatment method may be particularly suitable for sugarcane, as sugarcane is typically propagated using tissue-cultured seedlings or stem segments (rather than seeds). Furthermore, Sugarcane weevil The larvae lay their eggs near the sugarcane roots and feed on the sugarcane stalks, meaning that treatment of the soil or planting substrate may be effective.

[0047] Those skilled in the art will understand that the compositions and methods of this embodiment can be used alone or in combination with other compositions and methods for controlling insect pests affecting plants. For example, this embodiment can be used in combination with other insecticidal proteins, chemical mixtures, and / or biocontrol agents (e.g., biological insecticides). In another embodiment, the insecticidal polypeptides, variants of insecticidal peptides, and / or fragments thereof disclosed herein can be used in integrated pest management practices.

[0048] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. These terms apply to amino acid polymers, where one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and also to naturally occurring amino acid polymers.

[0049] The methods described herein can provide control by reducing pest populations by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to pest populations that have not been exposed to the composition or preparation.

[0050] Coleoptera pests and other insect pests

[0051] The recombinant protein disclosed herein is effective in killing a variety of insect pests. Specifically, the recombinant protein disclosed herein is effective in killing a variety of Coleoptera insect pests. Examples of non-restricted Coleoptera insect pests in this disclosure include: species of the genus *Lepidium* (*Leptothrix*). Leptinotarsa ​​spp. For example, the potato leaf beetle ( L. decemlineata (Colorado potato beetle); a species of the leaf beetle family ( Chrysomela spp For example, the poplar leaf beetle (C. scripta) (cottonwood leaf beetle); Hypothenemus spp. For example, coffee berry borer ( H. hampei (Coffee berry borer); Red-brown weevil ( Rhynchophorus ferrugineus(Red palm weevil); species of the genus Rice weevil ( Sitophilus spp.), for example, the corn weevil ( S. zeamais (Maize weevil) Epitrix spp., for example, tobacco flea beetle ( E. hirtipennis (Tobacco flea beetle) and E. cucumeris (Potato flea beetle); species of the genus *Flea beetle* ( Phyllotreta spp.), for example, the cruciferous flea beetle (spp.) P. cruciferae (Crucifer flea beetle) and P. pusilla (Western black flea beetle); species of the genus *Cercopithecus* ( Anthonomus spp For example, pepper weevil ( A. eugenii (Pepper weevil) Hemicrepidus spp .,For example H. memnonius (wireworms); species of the genus *Cyprinus* ( Melanotus spp.), for example M. communis (Wireworm); Ceutorhychus spp . For example, *C. assimilis* (cabbage seedpod weevil); species of the genus *C.* (cabbage flea beetle). Phyllotreta spp.), for example, the cruciferous flea beetle (spp.) P. cruciferae) (Crucifer flea beetle) Aeolus spp., for example A. mellillus (Wireworm); Aeolus spp., for example A. mancus (Wheat wireworm); Horistonotus spp., for example H. uhlerii (Gnaphalium affineum); species of the genus *Lepidoptera* (Gnaphalium affineum) Phyllophaga spp. (white grub); species of the genus *S.* (*S.*) Chaetocnema spp.), for example C. pulicaria (corn flea beetle); species of the genus *Popillia*, such as the Japanese golden beetle (…). P. japonica (Japanese beetle); species of the genus *Ladybug* (a herbivorous ladybug).Epilachna spp.), for example E. varivestis (Mexican bean beetle) Cerotoma spp. for example C. trifurcate (Bean leaf beetle); species of the genus *Brassica rapa* ( Epicauta (spp.) For example E. pestifera and E. lemniscata (Blister beetles); species of the genus *Blister beetle* ( Sphenophorus spp.), for example Sugarcane weevil and S. maidis ; Species of the genus *Firefly* ( Diabrotica (spp.) For example Diabrotica speciosa , Trechus subsignatus , Migdolus fryanus , Cerotoma arcuata tingomariana , Cosmopolites spp., for example, banana bulb weevil ( C. sordidus (banana borer); and scarab beetles ( Scarabaeidae ).

[0052] In some embodiments, the insecticidal protein of this disclosure is effective against species of the genus *Cryptocarya* (*Cryptocarya*). Sphenophorus (spp.) are active. The genus *Billbug* is a genus of beetles belonging to the family Cicadaeidae in the order Coleoptera. This genus contains over 60 species, but exemplary *Billbug* species include, but are not limited to, species of the genus *Billbug*, such as... Sugarcane weevil (Sugarcane weevil or sugarcane beetle) S. maidis (Corn elephant armor) S. zeae (Timothy billbug) S. parvulus (Bluegrass billbug) and S. callosus (Southern corn weevil).

[0053] Of particular note is Sugarcane weevil Sugarcane weevil, or sugarcane beetle. Adults of this insect drill holes in the internodes of sugarcane plants near the ground and lay their eggs near the roots or inside the stalks. Sugarcane WeevilThe larvae hatch after 7-12 days and feed directly on sugarcane stalks. Although the burrowing behavior of the female adults causes some initial damage, the main damage comes from the larvae's feeding. The larvae's activity is limited to the first and second internodes of the sugarcane plant. The larval feeding period is 26 to 50 days, followed by a pupal stage of 5 to 13 days. According to research by Degaspari et al., Sugarcane weevil Adults can survive in the soil for up to 250 days (Degaspari, N., et al. Biologia deSphenopherus levis Vaurie, 1978 (Col.: Curculionidade), em dieta artificial eno campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p.553-558, 1987).

[0054] For every 1% of root and stem biomass destroyed by the sugarcane weevil, 1% of sugarcane is lost (Casteliani, A). et al Crop Protection, 137, 105262, 2020). SCW can cause up to 60% tiller mortality in sugarcane plants, resulting in up to 30% yield loss and significantly shortening the lifespan of sugarcane fields (Precetti and Arrigoni, ). Vaurie, 1978 (Coleoptera: Curculionidae). Copersucar, (São Paulo, Brazil. 1990). Since sugarcane weevils cannot fly long distances, it is believed that infection spreads in the field through the transport of infected seedlings (Vinha, F). et al, Sci. Agrar. Parana., 280-288 (2020).

[0055] breeding Sugarcane weevilThe larvae presented a challenge to the experimental design because their larval stage lasted 26 to 50 days, with a larval survival rate of only 35.8%. Among larvae entering the pupal stage, the survival rate was as high as 93%, with the pupal stage lasting 5 to 13 days (Degaspari, N., et al., Biologia de Sphenopherus levis Vaurie, 1978 (Col.:Curculionidade), em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987). These survival challenges and the long duration of metamorphosis resulted in the insect population growing slowly to a suitable, sustainable sample size.

[0056] The potential insecticidal activity of the proposed proteins against Hemiptera, Diptera, *Miscanthus* species, and / or other piercing-sucking insects (e.g., Orthoptera or Thysanoptera) was considered. Diptera include, but are not limited to, *Leymus* species, such as *Leymus trifoliata*. L. trifolii (leafminer) and American serpentine leafminer ( L. sativae (Vegetable leafminer) Scrobipalpula spp., for example S. absoluta (Tomato leafminer) Delia spp., for example, the gray ground fly ( D. platura (seedcorn maggot) D. brassicae (cabbage maggot) and D. radicum (cabbage rootfly) Psilia spp .,For example P. rosae (Carrot rust fly); and the genus *Spotted leaf fly* (…). Tetanops spp .),For example T. myopaeformis (Beetroot maggot).

[0057] The potential activity of the insecticidal proteins disclosed herein against lepidopteran insects has been further considered. Lepidopteran insects include, but are not limited to, any lepidopteran insects currently known or later identified, including insect species and any combinations thereof from the suborders Zeugloptera, Glossata, and Heterobathmiina. Typical lepidopteran insects include, but are not limited to, species of the genus *Cyprinus* (…). Ostriniaspp.), for example O. nubilalis (European corn borer) Plutella spp., for example P. xylostella (diamondbackmoth); species of the genus *Greywingnodon* ( Spodoptera spp.), for example S. frugiperda (fallarmyworm) S. ornithogalli (Yellow-striped armyworm) S. praefica (Western yellowstriped armyworm) S. eridania (Southern armyworm) and S. exigua (Beet armyworm); species of the genus *Noctuid* ( Agrotis spp.), for example, A. ipsilon (black cut worm), A. segetum (Common cutworm) A. gladiaria (claybacked cutworm) and A. orthogonia (pale western cutworm) Striacosta spp., for example S. albicosta (Western bean cutworm); species of the genus *Bottlehorn* ( Helicoverpa spp.), for example H. zea (corn earworm) H. punctigera (native budworm) S. littoralis (Egyptian cotton leafworm) and H. armigera (cottonbollworm); Heliothis spp, for example H. virescens (Tobacco budworm) Diatraea spp., for example D. grandiosella (Southwestern corn borer) and D. saccharalis (Sugarcane borer); species of the genus *Pseudococcus* (Trichoplusia spp.), for example, the powdery armyworm ( T. ni (cabbage looper); [[ID= upstream]]Sesamia spp., for example, stem borer moth ( [[ID= upstream]]S. nonagroides) (Mediterranean corn borer) [[ID= upstream]]Pectinophora spp., for example [[ID= upstream]]P. gossypiella (pinkbollworm) ） ; [[ID= upstream]]Cochylis spp., for example [[ID= upstream]]C. hospes( The banded sunflower moth. [[ID= upstream]]Manduca spp., for example [[ID= upstream]]M. sexta (Tobacco hornworm) and M. [[ID= upstream]]quinquemaculata (Tomato hornworm) [[ID= upstream]]Elasmopalpus spp., for example E. [[ID= upstream]]lignosellus (lesser cornstalk borer) [[ID= upstream]]Pseudoplusia spp., for example P. [[ID= upstream]]includens (soybean looper); [[ID= upstream]]Anticarsia pestifera spp., for example A. gemmatalis (Velvetbean caterpillar) Plathypena spp., for example P. scabra (Green cloverworm); species of the genus Pisces ( Pieris spp.), for example P. brassicae (cabbage butterfly) Papaipema spp., for example P. nebris (stalk borer); Pseudaletia spp., for example P. unipuncta (Common armyworm); genus *Noctua* ( Peridroma spp.), for example P. saucia (Xinjiang Noctuid Moth) P. saucia )); Keiferia spp., for example K. lycopersicella ( tomato

[0058] Tomato pinworm); Artogeia spp., for example A. rapae (Imported cabbage worm); Phthorimaea spp., for example P. operculella (Potato tuberworm) Crymodes spp., for example C. devastator (glassy cutworm) Feltia spp., for example F. ducens (Dingy cutworm); and Telchin spp., for example, the giant moth ( T. licus In one aspect of this embodiment, the insecticidal protein disclosed herein is active against blackcutworm, sugarcane borer, and / or southwestern corn borer.

[0059] The preferred developmental stage for testing insecticidal activity is the larvae or immature forms of the aforementioned insect pests. The insects can be reared in complete darkness at approximately 20°C to approximately 25°C and a relative humidity of approximately 30% to approximately 70%. Bioassays can be performed as described by Czapla and Lang (1990) J. Econ. Entomol. 83(6):2480-2485. Methods for rearing insect larvae and performing bioassays are well known to those skilled in the art.

[0060] Those skilled in the art are familiar with various bioassay techniques for assessing insecticidal activity and efficacy. Common protocols involve adding an experimental compound to a pest's food source in a sealed container. Common measures of insecticidal activity and efficacy include changes in mortality or other behaviors. Insectic activity can be measured by (but is not limited to) mortality, weight loss, attraction, repellency, and other behavioral and physiological changes following feeding and adequate exposure.

[0061] Cry protein from Bacillus thuringiensis

[0062] Bacillus thuringiensis (Bt) strains expressing insecticidal toxins have been used as biopesticides. This is because they produce delta-endotoxins, also known as crystalline toxins or cry proteins. Bt toxins are a class of insecticidal proteins that are synthesized as protoxins and crystallized as parasporal inclusions. When ingested by insect pests, their microcrystalline structure is dissolved by the alkaline pH of the insect's midgut, and the protoxin is cleaved by intestinal proteases to produce the active toxin. The activated Bt toxin binds to receptors in the insect's intestinal epithelium, causing membrane damage and associated swelling and dissolution of the insect's gut. The insect dies from starvation and septicemia. See, for example, Li et al. (1991) Nature 353:815-821. Any bacterial host cell expressing the novel nucleic acid sequences disclosed herein and producing crystalline proteins is considered useful, such as Bacillus thuringiensis (Bt). B. thuringiensis ), Bacillus megaterium, Bacillus subtilis, Escherichia coli or Pseudomonas species.

[0063] The classification of various delta-endotoxins is based on their activity profiles and sequence homology. Until 1990, the major categories were determined by their activity profiles, with Cry1 proteins active against Lepidoptera (moths and butterflies), Cry2 proteins active against both Lepidoptera and Diptera (flies and mosquitoes), Cry3 proteins active against Coleoptera (beetles), and Cry4 proteins active against Diptera (Hofte and Whitely, 1989, Microbiol. Rev. 53: 242-255). In 1998, a new nomenclature was developed that systematically classified Cry proteins based on amino acid sequence homology rather than activity against certain insect species (Crickmore et al. 1998, Microbiol. Molec. Biol. Rev. 62: 807-813). The Bacillus thuringiensis δ-endotoxin Nomenclature Committee maintains a database of Cry protein nomenclature and the perceived cladistic relationships between various proteomes, accessible at: http: / / www.lifescissexac.uk / home / Neil_Crickmore / Bt / .

[0064] Comparison of the amino acid sequences of Cryotoxins with different specificities further revealed five highly conserved sequence segments. The structure of Cryotoxins comprises three distinct domains, from the N-terminus to the C-terminus: a cluster of seven α-helices involved in pore formation (referred to as "domain I" or "domain 1"), three antiparallel β-sheets involved in cell binding (referred to as "domain II" or "domain 2"), and a β-sandwich (referred to as "domain III" or "domain 3"). The location and characteristics of these domains are known to those skilled in the art. See, for example, Li et al. (1991), ibid., and Morse et al. (2001), Structure 9:409-417.

[0065] Bt (Bacillus thuringiensis) protein

[0066] Certain aspects of this disclosure relate to recombinant, isolated, and / or modified Bt proteins. Specifically, this disclosure relates to Cry8-type Bt proteins. Studies have shown that Cry8 proteins have insecticidal activity against Coleoptera pests, such as those in the chafer family, aphid family, and leaf beetle family. To date, approximately 60 Cry8 genes have been reported (Naveenarani M. et al. 2022). Cry8 proteins are 1160–1210 amino acids in length and have a molecular weight of 128–137 kDa. Among them, the isolated Cry8Aal and Cry8Bal have insecticidal activity against some pests in the chafer family (Michaels T. et al., 1994, U.S. Patent No. 5554534) and have been used in the development of transgenic insect-resistant corn (Abad A. et al. 2002, WO 02 / 34774). A2). Despite this research history, Bt protein members of the Cry8 family have not yet been found effective against many coleopteran pests because Bt proteins typically exhibit insecticidal effectiveness patterns specific to insect taxonomic units. Specifically, previously known coleopteran toxic proteins, such as the Cry3, Cry7, and Cry8 protein families, have been found to be effective against many coleopteran pests. Sugarcane weevil Non-toxic (see) Figure 2 ).

[0067] In some aspects, this disclosure relates to recombinant polypeptides having at least 40%, at least 60%, or at least 90% sequence identity with SEQ ID NO: 1, and / or variants or fragments thereof. In some embodiments of this aspect, the recombinant polypeptide comprises SEQ ID NO: 1.

[0068] In another aspect, this disclosure relates to a recombinant polypeptide comprising at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 1; and / or comprising at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1. In some embodiments of this aspect, the recombinant polypeptide comprises a sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polypeptide has at least one amino acid substitution, deletion, and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5; and / or comprises at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0069] In a further embodiment of this aspect (which may be combined with any of the foregoing embodiments), the recombinant polypeptide is a fusion protein comprising at least a portion of the polypeptide, variants thereof, and fragments of any of the foregoing embodiments. In some embodiments of this aspect, the polypeptide has insecticidal activity against at least one agricultural insect pest. In some embodiments of this aspect, the at least one insect pest is a coleopteran pest. In some embodiments of this aspect, the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil

[0070] ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil .

[0071] Certain aspects of this disclosure relate to recombinant polynucleotides encoding polypeptides of any of the foregoing embodiments. In some embodiments of this aspect, the recombinant polynucleotide comprises a sequence selected from SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. In some embodiments of this aspect, the agriculturally important crop is sugarcane, and the polynucleotide comprises SEQ ID NO: 11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide has a codon optimized for expression in an agriculturally important crop. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the polynucleotide is a non-genomic polynucleotide. In some embodiments of this aspect, the polynucleotide is a synthetic polynucleotide, and / or the polynucleotide is cDNA.

[0072] This disclosure provides recombinant and / or isolated Cry8-derived proteins, named SCW35 (SEQ ID NO: 1) and its variants and fragments, such as SCW52 (SEQ ID NO: 2), SCW57 (SEQ ID NO: 3), SCW58 (SEQ ID NO: 4), and SCW104 (SEQ ID NO: 5). SCW35 (SEQ ID NO: 1) is 1169 residues in length. SCW52 (SEQ ID NO: 2) corresponds to a truncated SCW35, which is only 632 residues in length. SCW57 (SEQ ID NO: 3) corresponds to SCW35 with a mutation at position 291 (tyrosine (Y) to cysteine ​​(C) and position 353 (glutamine (Q)) to alanine (A) (see [link to relevant documentation]). Figure 1A It is also truncated and only 632 residues in length. SCW58 (SEQ ID NO: 4) corresponds to SCW35, which has a leucine (L) mutation at position 178 to a cysteine ​​(C) residue (see SEQ ID NO: 4). Figure 1A It is truncated and only 632 residues in length. SCW104 (SEQ ID NO: 5) corresponds to SCW35, which has a mutation at position 597 (alanine (A) to glycine (G)). Figure 1B The sequence is truncated, consisting of only 632 residues. The truncation corresponds to the removal of the C-terminal and N-terminal portions of the original Cry8 protein sequence, but the three active domains (domain 1, domain 2, and domain 3) remain intact. These sequences are aligned as follows... Figure 1A-1C As shown. SCW35, SCW52, SCW57, SCW58, and SCW104 are designed for... Sugarcane weevil The efficacy is described in Example 2 (see Example 2). Figure 2 ).

[0073] In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide having at least 40% sequence identity with SEQ ID NO:1. In further embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide that is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:1. In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide having at least 60% sequence identity with SEQ ID NO:2. In further embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:2. In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide having at least 60% sequence identity with SEQ ID NO: 3. In further embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3. In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide having at least 60% sequence identity with SEQ ID NO: 4. In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4. In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide having at least 60% sequence identity with SEQ ID NO: 5. In some embodiments (which may be combined with any of the foregoing embodiments), the insecticidal Bt protein is a polypeptide that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.

[0074] Not wishing to be bound by theory, we believe that if at least domain 1 and domain 2 of the disclosed protein are present and combined with domain 3 of different Bt proteins, insecticidal activity will be maintained. This disclosure contemplates chimeras incorporating one or more or more of the domains of the disclosed proteins. Variants and / or fragments of the proteins disclosed herein include, but are not limited to, homologous (or partially homologous) sequences and peptides based on sequences selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, and / or derived from polynucleotides altered by site-directed mutagenesis, domain exchange, DNA shuffling, or any other method known in the art.

[0075] In other embodiments, the isolated and / or recombinant proteins disclosed herein can be used as recombinant proteins expressed in transgenic plants, microorganisms, and fungi. Thus, a recombinant microorganism or fungus expressing an active insecticidal protein and a transgenic plant are provided. The method involves transforming an organism with a nucleic acid sequence encoding an insecticidal polypeptide. Specifically, these insecticidal polynucleotides can be used to prepare plant, microorganism, fungal, and other animal cells with insecticidal activity. Therefore, the present invention provides transformed bacteria, yeast, fungi, plants, plant cells and animal cells, plant tissues, plant parts, propagules, organs, tissues, embryos, and seeds. Another embodiment of this disclosure includes a composition comprising insecticidal nucleic acids and / or insecticidal proteins incorporated into or expressed in a microorganism, fungus, or plant. The embodiments herein can be used in agriculture as methods for protecting plants from insect pests and for controlling insect pests or insect pest populations.

[0076] As used herein, the terms “insecticide activity,” “insecticide gene,” or “insecticide polynucleotide” refer to the nucleotide sequence encoding a polypeptide that exhibits insecticidal activity. As used herein, the term “insecticide activity” refers to the ability of a substance (e.g., a polypeptide) to inhibit the growth, feeding, or reproduction of insect pests and / or kill insect pests. “Insecticide polypeptide,” “insecticide protein,” or “insect toxin” are intended to refer to proteins with insecticidal activity.

[0077] As used herein, the terms “insectic activity” and “pesticide activity” are synonymous and refer to the activity of an organism or substance (e.g., a protein) that can be measured by (but is not limited to) pest mortality, pest weight loss, pest repellency, and other behavioral and bodily changes following appropriate feeding and exposure. In this way, insecticidal activity affects at least one measurable parameter of pest fitness. Methods for assessing insecticidal activity are well known in the art. See, for example, U.S. Patent Nos. 6,570,005 and 6,339,144. As used herein, “insectic efficacy” refers to the level of insecticidal or pesticidal activity exhibited by an organism or substance. Generally, higher insecticidal efficacy corresponds to lower pest fitness and higher pest mortality.

[0078] The isolated and / or recombinant proteins disclosed herein include a variety of embodiments that can be conveniently used as insecticidal compositions for exogenous applications, such as for topical and / or systemic application to field crops, forage grasses, fruits and vegetables, and ornamental plants, and / or as recombinant proteins for expression in transgenic plants or microorganisms. The insecticidal compositions of the present invention will be described in more detail in the next section (“Compositions Containing SCW Proteins”). In one embodiment, the biological insecticidal composition comprises a water-dispersible granule. The granule comprises one or more of the SCW proteins disclosed herein. In another embodiment, the insecticidal composition comprises an oil-flowable suspension of one or more of the SCW proteins disclosed herein.

[0079] Orally acceptable or orally applicable insect feeds in which the insecticidal proteins of this disclosure can be incorporated are well known in the art, as described herein. These can be contained in any composition that can be orally ingested by the target insect pest, for example, in forms including cell extracts, cell suspensions, cell homogenates, cell lysates, cell supernatants, cell filtrates, cell precipitates, and / or protein extracts or purified proteins or fusion proteins of this disclosure, when the proteins or fusions of this disclosure are expressed from host cells (e.g., plant, fungal, or bacterial cells). In one embodiment, a composition containing the insecticidal peptides of this disclosure can be formulated as a powder, granule, pellet, granule, spray, emulsion, gel, or solution, any of which can be topically applied to a matrix that is, or can be, an orally ingestible, or orally acceptable, orally applicable feed for the target insect pest.

[0080] In some embodiments, controlling insect pests includes feeding the composition to the pests, applying the composition to the outer surface of the pests, applying the composition to plants that the pests feed on, applying the composition to soil where the pests may be present, applying the composition to a general area of ​​the pest population, or injecting the composition into the plant or the pest. In one specific embodiment, the plant is a sugarcane plant. In some embodiments, the insect pest population is reduced by 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, insect infestation is reduced by 50% to 100% compared to methods of treating insect infestation using SCW proteins without the exogenous application of this disclosure.

[0081] SCW protein in expression cassette

[0082] Certain aspects of this disclosure relate to an isolated construct or expression cassette comprising a nucleotide or polynucleotide encoding a polypeptide of any of the foregoing embodiments, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element. In some embodiments of this aspect, the polypeptide comprises at least one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect, the polynucleotide comprises at least one of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the promoter is selected from constitutive promoters, inducible promoters, or tissue-specific promoters.

[0083] In another aspect, this disclosure provides a method for preparing an expression cassette comprising a nucleic acid sequence encoding one of the SCW proteins of this disclosure. Methods for preparing expression cassettes are well known in the art. Expression cassettes are typically designed with a promoter at the 5' end of the cassette, upstream of a desired polynucleotide segment encoding a protein of this disclosure, said protein including SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, variants thereof, fragments thereof, and combinations thereof.

[0084] A promoter may consist of multiple different promoter elements that are operatively linked to initiate transcription of a sequence encoding a protein disclosed herein. A DNA sequence consisting of a promoter-protein-coding DNA may be operatively linked at its 3' end to a transcription termination signal sequence that functions in microorganisms, fungi, animals, and / or plants to produce a recombinant DNA construct.

[0085] On one hand, the aforementioned recombinant DNA construct is contained in an expression cassette for expression in cells. The expression cassette is designed with a promoter upstream of the desired polynucleotide segment encoding the protein of this disclosure at its 5' end. The 5' untranscribed DNA may contain a promoter, which may consist of multiple different promoter and enhancer elements operatively linked to initiate transcription of a downstream sequence, including a sequence encoding the polypeptide of this disclosure. One or more transcribed but not translated DNA sequences may be operatively linked to the 3' end of the promoter in the expression cassette, including a leader sequence and / or intron sequences. The intron sequences are optionally located at the 3' end of the leader sequence, or in some cases within an open reading frame encoding the desired protein. A polynucleotide segment encoding an optional translocation polypeptide (e.g., a signal peptide or chloroplast transport peptide) may be inserted into the 5' end of the protein-coding sequence of this disclosure to localize the protein of this disclosure to a specific subcellular location. The nucleotide sequence encoding the protein disclosed herein is optionally operably located within the above-described expression cassette and operably linked with any necessary polyadenylation (polyA) and / or transcription termination sequences that function in microbial, fungal, animal, and / or plant cells.

[0086] As used herein, an "expression cassette" refers to a nucleic acid sequence capable of directing the expression of a specific nucleotide sequence in a suitable host cell. It contains a promoter operatively linked to the target nucleotide sequence, which in turn is operatively linked to a termination signal. It typically also contains the sequence required for the correct translation of the nucleotide sequence. An expression cassette containing the target nucleotide sequence may have at least one component that is heterologous to at least one of its other components. Expression cassettes may also be naturally occurring but obtained through recombinant processes for heterologous expression. However, typically, expression cassettes are heterologous relative to the host; that is, the specific nucleic acid sequence of the expression cassette is not naturally present in the host cell and must be introduced into the host cell or a progenitor cell of the host cell through a transformation event. Expression of the nucleotide sequence in the expression cassette can be controlled by a constitutive promoter or an inducible promoter, the latter initiating transcription only when the host cell is exposed to certain specific external stimuli. In the case of multicellular organisms such as plants, the promoter may also be tissue- or organ- or developmentally stage-specific.

[0087] Expression cassettes containing the target nucleotide sequence can be chimeric, meaning that at least one component is heterologous relative to at least one of its other components. Expression cassettes can also be expression cassettes containing a natural promoter driving their native gene; however, they are obtained in a recombinant form that can be used for heterologous expression. This use of the expression cassette means that it is not naturally present in the cell in which it is introduced. The term "isolated nucleic acid molecule" as used herein refers to a synthetically produced nucleic acid molecule that exists outside its natural environment and is therefore not a natural product. Isolated nucleic acid molecules can exist in purified form or in non-natural environments, such as, but not limited to, recombinant microbial cells, plant cells, plant tissues, or plants.

[0088] The aforementioned elements are arranged sequentially and can be used in various combinations depending on the desired expression outcome. Other aspects of this disclosure include isolated nucleic acid sequences or constructs containing a promoter operatively linked to a coding region encoding, for example, recombinant SCW35 protein, or, for example, recombinant SCW52 protein, recombinant SCW57 protein, recombinant SCW58 protein, recombinant SCW104 protein, or combinations thereof. Other aspects of this disclosure include isolated nucleic acid sequences or constructs containing a promoter operatively linked to a coding region encoding, for example, a recombinant protein having the sequence SEQ ID NO: 1, a recombinant protein having the sequence SEQ ID NO: 2, a recombinant protein having the sequence SEQ ID NO: 3, a recombinant protein having the sequence SEQ ID NO: 4, a recombinant protein having the sequence SEQ ID NO: 5, or combinations thereof. Such coding regions are typically operatively linked to a transcription termination region, thereby enabling the promoter to drive transcription of the coding region, thereby allowing the cell to produce the recombinant protein in vivo.

[0089] In one embodiment, this disclosure provides isolated or recombinant polynucleotides encoding the insecticidal polypeptides disclosed herein, wherein said polynucleotides have codons optimized for expression in crops. In one aspect, the crop is sugarcane.

[0090] Recombinant polynucleotides can be used to construct expression vectors for subsequent transformation into target organisms, to develop probes for isolating other homologous (or partially homologous) genes, and to generate altered SCW polypeptides by methods known in the art, such as site-directed mutagenesis, domain exchange, or DNA shuffling. In one specific embodiment, the polynucleotide sequence is selected from SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

[0091] In some embodiments, the SCW peptide comprises an amino acid sequence derived from the full-length nucleic acid sequence disclosed herein, as well as shorter amino acid sequences resulting from the use of alternative downstream start sites or from processing to produce a shorter protein with insecticidal activity. Processing may occur in the organism expressing the protein or in pests that have ingested the protein. Therefore, isolated or recombinant nucleic acid sequences conferring insecticidal activity are provided herein. The amino acid sequence of the SCW peptide is also provided herein. Proteins translated from these genes enable cells to control or kill pests that ingest them.

[0092] Molecular biology and biotechnology methods

[0093] Any methods known in the art for modifying cellular DNA (e.g., genomic DNA and organelle DNA) and producing proteins can be used to practice what is disclosed herein.

[0094] The term "recombinant" or "modified nucleic acid" refers to a polynucleotide synthesized by artificially manipulating isolated polynucleotide segments through genetic engineering or chemical synthesis, combining two originally separate sequence segments. In this way, polynucleotide segments with desired functions can be linked together to produce the desired functional combination.

[0095] In some implementations, a non-integrative expression system can be used to induce the expression of one or more introduced genes. The expression system (expression vector) may include, for example, an origin of replication or autonomous replication sequence (ARS) and expression control sequences, promoters, enhancers, and necessary processing information sites, such as ribosome binding sites, RNA splicing sites, polyadenylation sites, transcription termination sequences, and mRNA stabilizing sequences. Where appropriate, it may also contain signal peptides of secretory polypeptides from the same or related species, which enable the protein to cross and / or remain in the cell membrane, cell wall, or be secreted from the cell.

[0096] The screening and molecular analysis of recombinant strains and / or plants or plant cells and materials disclosed herein can be performed using nucleic acid hybridization techniques. Hybridization procedures can be used to identify polynucleotides with sufficient homology to the useful subject regulatory sequences taught herein, such as those modified using the techniques described herein. Specific hybridization techniques are not essential to this invention. These techniques can be readily applied by those skilled in the art as hybridization techniques have been improved. Hybridization probes can be labeled with any suitable markers known to those skilled in the art. Hybridization and washing conditions (e.g., temperature and salt concentration) can be varied to alter the stringency of the detection threshold. For further guidance on hybridization conditions, see, for example, Sambrook et al. (1989) (see below) or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY).

[0097] Similarly, screening can be performed using peptide-based techniques, including enzyme-linked immunosorbent assay (ELISA), fluorescence detection (if fluorescent labeling is used), or Western blotting. Those skilled in the art will understand that any available peptide-based technique can be used for the screening aspects or implementations disclosed herein.

[0098] In addition, polymerase chain reaction (PCR) can be used for screening and molecular analysis of genetically modified strains and / or plants or plant cells and materials, as well as for creating desired isolated nucleic acids. PCR is a repetitive, enzymatic, primerized method for synthesizing nucleic acid sequences. This procedure is well known and commonly used by those skilled in the art (see Mullis, U.S. Patents 4,683,195, 4,683,202, and 4,800,159; Saiki et al. (1985) Science 230: 1350-1354). PCR is based on the enzymatic amplification of a target DNA fragment flanked by two oligonucleotide primers that hybridize to the opposite strand of the target sequence. The 3' ends of the primers face each other. Repeated cycles of template denaturation, primer annealing to their complementary sequences, and extension of the annealed primers in DNA polymerase result in the amplification of the segment defined by the 5' end of the PCR primer. Since the extension product of each primer can serve as a template for another primer, each cycle effectively doubles the amount of DNA template produced in the previous cycle. This leads to the exponential accumulation of specific target fragments, reaching millions of times within hours. This can be achieved by using thermostable DNA polymerases, such as those from thermophilic bacteria. Thermus aquaticus The Taq polymerase isolated from it allows for a fully automated amplification process. Other available enzymes are known to those skilled in the art.

[0099] The nucleic acids and proteins disclosed herein may also contain homologs of the specific disclosed sequences. Homology or genetic identity can be 40%–100%. In some cases, such homology or genetic identity is greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. Those skilled in the art can readily determine the degree of homology or identity required for any intended use of the sequence. The percentage of sequence identity between the two nucleic acids used herein was determined using algorithms known in the art, such as those disclosed in Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264–2268, with modifications thereof found in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873–5877. This algorithm has been incorporated into the NBLAST and XBLAST procedures of Altschul et al. (1990) J. Mol. Biol. 215:402–410. Use the NBLAST procedure for BLAST nucleotide searching, score=100, word length=12, to obtain nucleotide sequences with the desired percentage of sequence identity. For vacancy alignments for comparison, use Gapped BLAST, as described in Altschul et al. (1997) Nucl. Acids. Res. 25:3389-3402. When using the BLAST and Gapped BLAST procedures, use the default parameters for the respective procedures (NBLAST and XBLAST). See www.ncbi.nih.gov.

[0100] Plant cells and all forms of plants are also preferred targets for coatings and other applications of the insecticidal compositions disclosed herein. Monocotyledonous plant cells can be used, particularly including sugarcane (e.g., species of the genus *Saccharum*). SaccharumCells can be derived from tissue types including embryos, callus, leaf discs, and other explants. The plant cells targeted by the insecticidal composition can be differentiated or undifferentiated (e.g., callus, undifferentiated callus, immature and mature embryos, immature zygotic embryos, immature cotyledons, hypocotyls, suspension culture cells, protoplasts, leaves, leaf cells, root cells, phloem cells, and pollen). Plant cells include, but are not limited to, cells derived from: seeds, suspension cultures, explants, immature embryos, embryos, zygotic embryos, somatic embryos, embryogenic callus, meristems, somatic meristems, organogenic callus, protoplasts, leaf bases, leaves from mature plants, leaf tips, immature inflorescences, cotyledons, immature cotyledons, hypocotyls, meristematic zones, callus, cells from leaves, cells from stems, cells from roots, cells from buds, gametophytes, sporophytes, pollen, and microspores. Plant cells also include various forms of cultured cells (e.g., single cells, protoplasts, embryos, and callus), wherein the protoplasts or cells are generated from plant parts selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, or meristematic cells. In this document, recombinant host cells refer to cells that have been genetically modified to contain isolated or recombinant nucleic acid molecules, or contain one or more genes to produce at least one recombinant protein. Nucleic acids encoding the SCW proteins of this disclosure can be introduced by any method known in the art suitable for a particular cell type, including but not limited to transformation, liposome transfection, electroporation, or any other method known to those skilled in the art.

[0101] This invention provides a method for detecting any nucleotide or polypeptide in the foregoing embodiments, comprising the following steps: Obtain plant material samples for analysis; DNA was extracted from the sample; Provide primer pairs that contain at least forward and reverse primers; Amplify the region between primer pairs; and Detecting the presence of amplification products; or including the steps Obtain plant material samples for analysis; Extract DNA or RNA from the sample; Provide probes or combinations of probes designed to bind to polynucleotides comprising polynucleotides according to the foregoing embodiments; Hybridize the probe with the sample; and The actual hybridization of the detection probe.

[0102] Antibody

[0103] This invention also covers antibodies against the SCW peptide or variants or fragments thereof of this embodiment. The antibodies disclosed herein include polyclonal antibodies and monoclonal antibodies, as well as antibody fragments that retain their ability to bind to the SCW peptide. An antibody, monoclonal antibody, or fragment thereof is said to be able to bind to a molecule if it can specifically react with the molecule, thereby causing the molecule to bind to the antibody, monoclonal antibody, or fragment thereof.

[0104] This invention provides a kit for detecting the presence of an SCW peptide in a sample or for detecting the presence of a nucleotide sequence encoding an SCW peptide in a sample. In one embodiment, the kit provides antibody-based reagents for detecting the presence of an SCW peptide in a sample. In another embodiment, the kit provides labeled nucleic acid probes for detecting the presence of one or more polynucleotides encoding an SCW peptide. The kit is accompanied by suitable reagents and controls for carrying out the detection method, as well as instructions for use.

[0105] This invention provides a kit for detecting one or more polynucleotides or peptides as described in the foregoing embodiments. In one embodiment, the kit includes tools for detecting the presence of one or more polynucleotides as described in the foregoing embodiments and / or tools for detecting one or more peptides as described in the foregoing embodiments, wherein the tools include primer pairs designed for binding to the polynucleotide, or wherein the tools include primer pairs and probes designed for binding to the polynucleotide, and / or wherein the tools include antibodies for detecting one or more peptides as described in the foregoing embodiments.

[0106] Composition containing SCW protein and related nucleotides

[0107] Another aspect of this disclosure relates to an insecticidal composition comprising: (i) one or more polypeptides from any of the foregoing embodiments, wherein the concentration of said one or more polypeptides is sufficient to control at least one agricultural insect pest; (ii) one or more polynucleotides from any of the foregoing embodiments, wherein said polynucleotides have codons optimized for expression in agriculturally important crops; and / or (iii) one or more isolated constructs or expression cassettes from any of the foregoing embodiments. In some embodiments of this aspect, said one or more polypeptides are selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect, said one or more polynucleotides are selected from SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), said at least one insect pest is a coleopteran pest. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), when the composition is applied to sugarcane plants or sugarcane plantations, the concentration of the one or more polypeptides present is sufficient to control at least one agricultural insect pest in or on the sugarcane plants. Some embodiments of this aspect (which may be combined with any of the foregoing embodiments) further include one or more inert ingredients, acceptable carriers, surfactants or adjuvants commonly used in the formulation field, or other components that facilitate product handling and application against specific target pests. Suitable carriers and adjuvants may be solid or liquid and correspond to substances commonly used in formulation technology, such as natural or recycled minerals, solvents, dispersants, wetting agents, thickeners, binders, or fertilizers. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a suspension, solution, emulsion, dusting powder, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granule, adjuvant, paste (e.g. for coating or smearing), colloid, culture medium, artificial diet, or encapsulated in an agriculturally acceptable carrier (e.g., polymeric material). In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as an orally acceptable, orally applicable, or orally ingestible feed for consumption by insect pests.In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated for direct soil application and / or direct potting substrate application. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the composition is formulated as a controlled-release formulation. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), control of coleopteran pests includes: (a) reducing pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or (b) increasing pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments of this aspect (which may be combined with any of the foregoing embodiments), the coleopteran pest is selected from: Sugarcane weevil , Sphenophorus maidis Cotton boll weevil ( Anthonomus grandis ), genus *Fireflybea* ( Diabrotica Species, Trechus subsignatus, Migdolus fryanus, Cerotoma arcuata tingomariana Potato beetle ( Leptinotarsa ​​decemlineata), Banana bulb weevil ( Cosmopolites sordidus) Coffee berry borer ( Hypothenemus hampei) Red-brown weevil ( Rhynchophorus ferrugineus ) and Scarabaeidae ( Scarabaeidae) Species. In some embodiments of this aspect, the Coleoptera pest is Sugarcane weevil Such formulations can be prepared by conventional methods, such as drying, lyophilizing, homogenizing, extracting, filtering, centrifuging, sedimentation, or concentrating cell cultures containing the polypeptides.

[0108] The compositions disclosed herein comprise at least one, at least two, at least three, at least four, or five SCW proteins disclosed herein. In some embodiments, the composition further comprises one or more additional Bt proteins, such as additional Cry8 proteins. In some embodiments, the compositions disclosed herein further comprise additional active agents, such as chemical mixtures (e.g., insecticidal chemicals), insecticidal proteins (e.g., Bt proteins), or biocontrol agents (e.g., Bacillus thuringiensis). In some embodiments, the compositions disclosed herein further comprise agricultural-related agents (i.e., agrochemicals). In some embodiments, the compositions disclosed herein comprise one or more agrochemicals, including but not limited to herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, acaricides, plant growth regulators, harvesting aids, and fertilizers.

[0109] In one embodiment, the formulation of the bio-insecticide composition can be prepared by a variety of methods well known in the art, including but not limited to drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, or concentration. In any such orally acceptable, orally applicable, orally ingestible bait intended for consumption by target insect pests, the concentration of the protein disclosed herein should be at least about 0.001% to about 99% of the total weight of the composition. In one embodiment, the concentration of the protein disclosed herein should be about 1 part protein to 4 parts target insect pest bait.

[0110] The above composition can be obtained by adding surfactants, inert carriers, preservatives, humectants, feeding stimulants, attractants, encapsulating agents, adhesives, emulsifiers, dyes, UV protectants, buffers, flow aids or fertilizers, micronutrient donors or other formulations that affect plant growth. Suitable surfactants include, but are not limited to, anionic compounds, such as carboxylates, including metal carboxylates; carboxylates of long-chain fatty acids; N-acylsarcosine salts; monoesters or diesters of phosphates and fatty alcohol ethoxylates, or salts of such esters; fatty alcohol sulfates, such as sodium dodecyl sulfate, sodium octadecyl sulfate, or sodium cetyl sulfate; ethoxylated fatty alcohol sulfates; ethoxylated alkylphenol sulfates; lignin sulfonates; petroleum sulfonates; alkylaryl sulfonates, such as alkylbenzene sulfonates or lower alkylnaphtalene sulfonates, such as butylnaphtalene sulfonate; salts of sulfonated naphthalene-formaldehyde condensate; and sulfonated phenol-formaldehyde condensate. Salts of condensates; more complex sulfonates, such as amide sulfonates, such as the sulfonated condensation product of oleic acid and N-methyl taurine; or dialkylsulfosuccinates, such as sodium sulfonate of dioctyl succinate. Nonionic agents include condensation products of fatty acid esters, fatty alcohols, fatty acid amides or fatty alkyl or alkenyl substituted phenols with ethylene oxide, fatty acid esters of polyol ethers (e.g., sorbitol fatty acid esters), condensation products of such esters with ethylene oxide (e.g., polyoxyethylene sorbitol fatty acid esters), block copolymers of ethylene oxide and propylene oxide, alkynyl diols (e.g., 2,4,7,9-tetraethyl-5-decyn-4,7-diol), or ethoxylated alkynyl diols. Examples of cationic surfactants include, for example, aliphatic monoamines, diamines, or polyamines, such as acetates, naphthenic esters, or oleates; or oxyamines, such as amine oxides of polyoxyethylene alkylamines; amide-linked amines prepared by condensation of carboxylic acids with diamines or polyamines; or quaternary ammonium salts.

[0111] Examples of inert materials include, but are not limited to, inorganic minerals such as kaolin, layered silicates, carbonates, sulfates, phosphates, mica, amorphous silica, talc, clay, volcanic ash, or plant materials such as cork, corn cob powder, peanut shells, rice husks, and walnut shells. Kaolin, for example, includes kaolinite, dickite, pearl clay, silica-rich kaolinite, halloysite, and...

[0112] Hydrocarboxylate can be used as a carrier material. Montmorillonite, such as bedeite, chlorodiazepite, lithium montmorillonite, saponite, zinc montmorillonite, and bentonite, can be used as carrier materials. Vermiculite, such as biotite, can be used as a carrier material.

[0113] The composition of this embodiment may be in a suitable form for direct application or a concentrate of the main composition, which needs to be diluted with an appropriate amount of water or other diluent before application. The insecticide concentration will vary depending on the nature of the specific formulation, specifically whether it is a concentrate or for direct application. The composition contains 1% to 98% of a solid or liquid inert carrier and 0% to 50% or 0.1% to 50% of a surfactant. These compositions will be applied according to the label dosage of commercially available products, for example, approximately 0.01 to 5.0 pounds per acre in dry condition or approximately 0.01 to 10 pints per acre in liquid condition.

[0114] The compositions disclosed herein include cell or tissue extracts, suspensions, homogenates, lysates, supernatants, filtrates, and precipitates, wherein such cells or tissues express at least one SCW protein, and / or also provide purified proteins derived from such cells and / or tissues.

[0115] sugarcane plants

[0116] The sugarcane plants disclosed herein include species and hybrids of the genus *Saccharum*, such as the tropical species (*Saccharum officinarum*), the Chinese species (*Saccharum sinense*), the Indian species (*Saccharum barberi*), the large-stemmed wild species (*Saccharum robustum*), the spontaneum species (*Saccharum spontaneum*), species of the genus *Saccharum*, and hybrids of the genus *Saccharum*. Cultivated sugarcane crops are typically hybrids of many sugarcane species that can be crossbred between varieties. Sugarcane is classified as a monocotyledonous plant and belongs to the same plant family (Poaceae) as other important crops (such as maize, rice, and wheat). As one of the world's major sources of sugar, sugarcane is a key crop for the economies of many subtropical and tropical countries that grow sugarcane, particularly Brazil. Furthermore, as a source of ethanol, sugarcane offers a potential environmentally valuable alternative to gasoline for certain fuel processes worldwide.

[0117] The prominent nodes of sugarcane are the most commercially valuable part of the plant, rich in sucrose between the nodes (i.e., the internodes of the stem). The internodes of the stem are rich in vascular tissue, and the vascular tissue of sugarcane contains abundant sucrose deposits.

[0118] Sugarcane propagation is carried out by cutting the top of mature sugarcane near the base, and then removing the stalks from the vegetation. Additionally, tissue-cultured seedlings derived from buds and cultivated in greenhouses can also be used for propagation. Harvesting of mature sugarcane can be done by hand (a labor-intensive process providing thousands of jobs) or by machine using heavy machinery. Sugar is extracted from the sugarcane stalks through a milling process and then supplied to the commercial market through a refining process.

[0119] In some aspects, this disclosure relates to treating seeds, plant parts, or plant tissues with recombinant proteins or compositions containing recombinant proteins according to any of the above embodiments. In some embodiments, the plant part is selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, somatic embryos, or meristematic cells. Plant parts include differentiated and undifferentiated tissues, including but not limited to roots, stems, buds, leaves, pollen, and seeds.

[0120] In some aspects, this disclosure relates to a transgenic plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell comprising a polypeptide, a polynucleotide, or an isolated construct or expression cassette of any of the foregoing embodiments. In some embodiments of this aspect, the one or more polypeptides are selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments of this aspect, the one or more polynucleotides are selected from SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. In other aspects, this disclosure relates to a plant, plant part, propagule, seed, tissue, organ, embryo, or plant cell transformed (e.g., transient or stable transformation) with at least one polynucleotide encoding one of the insecticidal polypeptides.

[0121] As used herein, the term "plant" refers to any plant at any developmental stage, particularly seed plants. The term "plant cell" refers to the structural and physiological unit of a plant, comprising a protoplast and cell wall. Plant cells can be isolated single cells or cultured cells, or they can be part of higher-level tissue units such as plant tissues, plant organs, or the whole plant. The term "plant cell culture" refers to a culture of plant units such as protoplasts, cultured cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various developmental stages. The term "plant material" refers to leaves, stems, roots, flowers or parts of flowers, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant. The term "plant organ" refers to a distinctive and clearly structured and differentiated part of a plant, such as a root, stem, leaf, bud, or embryo. The term "plant tissue" refers to a group of plant cells organized into structural and functional units. Any tissue of a plant, whether within the plant or in a culture state, is included. This term includes, but is not limited to, whole plant, plant organs, plant seeds, tissue cultures, and any group of cells organized into structural and / or functional units. The use of this term in conjunction with or alone with any particular type of plant tissue covered above or in this definition does not exclude any other type of plant tissue.

[0122] In some aspects, this disclosure relates to an insecticidal composition applied to protoplasts or cells of plants from any of the above embodiments. Plant cells can be differentiated or undifferentiated (e.g., callus, undifferentiated callus, immature and mature embryos, immature zygotic embryos, immature cotyledons, hypocotyls, suspension culture cells, protoplasts, leaves, leaf cells, root cells, phloem cells, and pollen). Plant cells include, but are not limited to, cells from: seeds, leaves, stems, roots or buds, suspension cultures, explants, immature embryos, embryos, zygotic embryos, somatic embryos, embryogenic callus, meristems, somatic meristems, organogenic callus, protoplasts, leaf bases, leaves from mature plants, leaf tips, immature inflorescences, cotyledons, immature cotyledons, hypocotyls, meristematic zones, callus, gametophytes, sporophytes, pollen, or microspores. Plant cells also include various forms of cultured cells (e.g., single cells, protoplasts, embryos, and callus tissues), wherein protoplasts or cells are derived from plant parts selected from leaves, stems, anthers, pistils, roots, fruits, flowers, seeds, cotyledons, hypocotyls, embryos, or meristematic cells. Besides sugarcane as described above, plant cells or tissues can also be derived from plants including, but not limited to, maize (e.g., corn), Zea mays ), barley (for example, Hordeum vulgareMillet (e.g., fingermillet, fonio millet, foxtail millet, pearl millet, barnyard millets, millet) Eleusine coracana ), fine-stemmed millet ( Panicum sumatrense ), millet ( Panicum milaceum ), Pennisetum glaucum, species of the genus Digitaria ( Digitaria spp.), species of the genus Barnyardgrass ( Echinocloa spp.), oats (e.g.) Avena sativa Rice (e.g., indica rice, japonica rice, aromatic rice, glutinous rice). Oryza sativa , glumed rice ( Oryza glaberrima ), rye (e.g., Secale cereale , Secale cereanum ), foxtail grass (for example, Setaria italica , Setaria viridis ), species of the genus *Brucea* ( Brachypodium sp.), sorghum (e.g., Sorghum bicolor ), teff (e.g., Eragrostis TEF ), triticale (e.g., X Triticosecale Wittmack, Triticosecale schlanstedtense Wittm. Triticosecale neoblaringhemii A. Camus, Triticosecale neoblaringhemii A. Camus), wheat (e.g., common wheat, spelt, durum, einkorn, emmer, kamut). Triticum aestivum , Triticum spelta , Triticum durum , Triticum urartu , Triticum monococcum , Triticum turanicum Species of the genus *Wheat* ( Triticum spp.), switchgrass (e.g., Panicum virgatum ), species of the genus Brassica ( Brassica sp.), tobacco (e.g., Nicotiana benthamiana , Nicotiana tabacum ),peanut( Arachis hypogaea ), banana (Musa species) Musa sp.)), potato ( Solanum tuberosum),strawberry( Fragaria ananassa ),coffee( Coffea arabica ), cotton (upland cotton) Gossypium hirsutum )),tomato( Solanum lycopersicum (or any other polyploid and / or asexually reproduced plant species.)

[0123] Plant expression

[0124] There are various plant gene transformation technologies, mainly divided into two categories: indirect gene transfer and direct gene transfer. Indirect transfer refers to the insertion of exogenous DNA into the genome through the action of biological vectors, while direct transfer is based on physical and biochemical processes.

[0125] Depending on the genetic transformation technique and the species or genotype to be transformed, different tissues and / or cells may be used. Typically, these tissues or cells include, but are not limited to, embryogenic callus, callus tissue, protoplasts, embryos, somatic embryos, meristems, and any other plant parts, tissues, or cells with regenerative capacity.

[0126] Indirect transformation based on Agrobacterium spp. ( Agrobacterium The bacterial-mediated transformation system (AMPS) is the most widely used method for obtaining transgenic plants. Advantages of this method include the ability to transfer relatively long DNA segments without rearrangement, while maintaining low copy number integration of the transgene, thus ensuring higher genotypic stability of the resulting events. Currently, various Agrobacterium species and strains, plasmids, and protocols have been developed and improved for genetic transformation of multiple plant species. The advantages of these methods include: a higher probability of single-copy events, stable integration, genetically inherited introduced traits, consistent gene expression across generations, and low gene silencing rates.

[0127] Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) and Agrobacterium rhizogenes ( A. Rhizogenes is Gram-negative soil plant pathogens belonging to the Rhizobium family can cause diseases in dicotyledonous plants, namely crown gall. (crown) Agrobacterium is a Gram-negative soil plant pathogen belonging to the Rhizobium family. It can cause diseases in dicotyledonous plants, namely crown gall and hairy root gall. In this plant-pathogen interaction, Agrobacterium (…) AgrobacteriumThere is a natural gene transfer process between bacteria and plant cells, in which a fragment of bacterial DNA (T-DNA) is transferred into the plant cell and integrated into the nuclear genome. In nature, bacteria transfer T-DNA (“transferred DNA”), which is part of the bacterial plasmid Ti (“tumor-inducing”), and integrates it into the genome of the infected plant cell. The T-DNA fragment transferred to the plant cell contains genes involved in the constitutive biosynthesis of plant hormones (auxins and cytokinins), which alter the normal developmental program of the infected tissue and lead to tumor formation. Furthermore, it contains genes for the synthesis of sugars and amino acids (called...).

[0128] The oncogene is opine, while sugars and amino acids are the carbon and nitrogen sources for bacteria (Oger et al., 1997). T-DNA is defined by 25-base-pair repeats at the left and right boundaries, which are crucial for its transfer. Phenolic compounds released from damaged plant tissue activate specific regions (vir regions), initiating the transfer of T-DNA into plant cells. Agrobacterium also possesses chromosome (chv) genes that promote the binding between bacteria and host cells, thereby forming channels containing T-DNA complexes (Sheng & Citovsky, 1996).

[0129] Because the fragment to be transferred is defined by its boundaries, any sequence flanked by those boundaries can be transferred into plants by Agrobacterium, allowing manipulation of these sequences to transfer the target coding sequence. Replacing or deleting the coding region of wild-type T-DNA (oncogene) produces non-oncogenetic (disarmed) Agrobacterium strains that can carry the target sequence. The modified T-DNA is able to transfer the target sequence into plants because the virulence gene (vir region) remains intact.

[0130] Furthermore, the Agrobacterium indirect transformation system allows for the transfer of artificial plasmid constructs into plants, provided the construct contains such a T-DNA boundary, and allows for the flexible use of molecular tools and materials developed for other bacterial strains.

[0131] These artificial plasmid constructs have promoters from different sources, such as plant promoters, viral promoters, bacterial and / or chimeric promoters, as well as genes that confer antibiotic resistance, herbicide resistance or tolerance or enzyme activity (phosphog-mannose isomerase (PMI) / mannose (Man)). Therefore, these markers can be used to select transformed cells or plants.

[0132] These constructs can also contain helper genes that interfere with related morphogenesis signaling pathways, thereby enhancing the efficiency of genetic transformation and plant tissue regeneration. Examples include, but are not limited to, LEAFY COTYLEDON1 (Lotan et al., 1998), Lec1 (Lowe et al., 2002), LEAFY COTYLEDON2 (Stone et al., 2001), WUSCHEL (WUS; Zuo et al., 2002), and e BABY BOOM (BBM; Boulirier et al., 2002).

[0133] In a first aspect of the invention, foreign or exogenous DNA to be introduced into a plant is cloned into a binary plasmid located between shared sequences (T-DNA) on its left and right boundaries. This binary plasmid is transferred into Agrobacterium cells and subsequently used to infect plant tissues. The vector containing the T-DNA region of the exogenous DNA is inserted into the plant genome. Marker gene expression cassettes and characteristic gene expression cassettes may be located in the same region of the T-DNA, in different T-DNA regions of the same plasmid, or in different T-DNA regions of different plasmids. In one embodiment of the invention, these expression cassettes are located in the same region as the T-DNA. Methods of indirect transformation via Agrobacterium are well known to those skilled in the art.

[0134] Alternatively, direct DNA transfer can be used to introduce DNA directly into plant cells. One method of direct DNA transfer is to bombard plant cells with a vector containing the DNA to be inserted using a particle gun (particle-mediated gene gun transformation). Other plant cell transformation methods include protoplast transformation (optionally in the presence of polyethylene glycol); sonication of plant tissues, cells, or protoplasts in a medium containing polynucleotides or vectors; microinjection of polynucleotides or vectors into plant material; microinjection, vacuum permeation, sonication, chemical transformation using silicon carbide, chemical transformation using PEG, and plant cell electroporation. Disadvantages of direct transformation include challenges associated with plant tissue regeneration and low transgene expression.

[0135] Furthermore, gene transformation can be achieved through direct insertion at specific sites via nuclease-mediated homologous recombination (genome editing). In recent years, genome editing technologies based on engineered or chimeric nucleases have made it possible to generate genetically modified organisms in a more precise and specific manner. The introduction of exogenous or foreign genes is achieved through homologous recombination, i.e., the introduction of a homologous recombination template (HR) containing exogenous DNA linked to a DNA fragment homologous to the recipient organism's genome. Available tools include the chimeric enzyme system CRISPR (clustered, regularly spaced, short palindromic repeats)-Cas, zinc finger (ZFN) nucleases, and TAL effector nucleases (TALENs). The Crispr-Cas system is an enzymatic system containing two main components: an endonuclease (Cas) and a guide RNA (single guide RNA - sgRNA; a guide to a specific cleavage site of the Cas endonuclease). The guide RNA may also contain two components: Crispr RNA (crRNA) - a 17-20 base sequence complementary to a specific DNA genomic sequence, and optional tracrRNA. The specific cleavage performed by the endonuclease and the guidance of sgRNA will be repaired through homologous recombination, specifically, the insertion of exogenous DNA side-joined by a homologous sequence into the cleavage site. This enzymatic system can be introduced into cells in various ways, using plasmids, through direct or indirect transformation, or using vectors such as proteins and other chemical reagents. Expression of the system components can occur transiently or stably, utilizing the cellular mechanisms of the recipient organism, or in vitro, delivering all ready-to-use components (endonuclease + sgRNA, transcribed and combined in vitro prior to cellular delivery) to the target cells or tissues. The contents described herein are not exhaustive and should not limit the use of different variants, systems, and methods of genome editing within the scope of this invention, including variants, systems, and methods known in the art and those not yet discovered.

[0136] After transformation, the transgenic plants regenerate from the transformed plant tissues, and offspring with exogenous DNA can be screened using suitable markers (e.g., kanamycin, genimycin, or glufosinate resistance). Those skilled in the art are familiar with the composition of suitable regeneration media.

[0137] Alternatively, other selection methods can be applied without inserting any genetic markers into the host genome (recipient organism) as previously described.

[0138] Promoters suitable for plant expression can be isolated from plants or other organisms. Various promoters have been isolated or developed, including constitutive promoters, "on and off" promoters, and promoters that respond to tissue-specific abiotic stresses. Many of these promoters have intron sequences associated with proper gene expression. In a preferred aspect of the invention, the promoter is a constitutive promoter, selected from the non-limiting group consisting of: CaMV 35s, CoYMV (Commelina yellow mottle virus), FMV 35s, ubiquitin, actin rice promoter (Act-1), Act-2, nopaline synthase promoter (NOS), octopine synthase promoter (OCS), zeatol dehydrogenase promoter (Adh-1), PvUbi1, SCBV, etc.

[0139] Additional elements such as introns, enhancer sequences, and transport proteins can be integrated into the expression cassette to enhance gene expression levels. Examples include transcriptional or translational enhancers such as the CaMV 35s enhancer, FMV 35s, Nos, supP, untranslated leader sequences from wheat major chlorophyll a / b binding polypeptide (L-Cab), and the kosak sequence 5' upstream of the translation initiation site.

[0140] Termination sequences were also considered on the expression cassette. Examples of suitable, functional plant polyadenylation signals include those from Agrobacterium tumefaciens carmine synthase (nos), protease inhibitor II gene rbcS (small subunit of pea ribulose-1,5-bisphosphate carboxylase), Lhcb1 (tobacco chlorophyll a / b binding protein), CaMV 35s, octopus carmine synthase, α-tubulin genes, etc.

[0141] According to the present invention, polynucleotides encoding proteins may have optimized (or otherwise altered) codons to improve their expression in plant material. Such codon optimization can be used to alter the predicted secondary structure of RNA transcripts produced in any transformed cells, or to disrupt hidden RNA instability elements present in unaltered transcripts, thereby enhancing the stability and / or availability of transcripts in transformed cells.

[0142] Several marker genes for plant event selection have been identified, some of which confer antibiotic resistance and others herbicide resistance. Examples of marker genes that can be used selectively in this invention include genes that confer resistance or tolerance to hygromycin, kanamycin, gentamicin, genimycin, glyphosate, and glufosinate, or genes that confer resistance to toxins such as eutypine. Other forms of selection may also be used, such as hormone-based selection systems, visual selection by expressing fluorescent proteins, mannose isomerases, xylose isomerases, etc. In one embodiment of the invention, the event selection marker gene is a gene that confers resistance to kanamycin and genimycin.

[0143] Use selectable marker genes, for example nptII Genes are crucial for selecting transformed cells during gene modification (HORSCH et al., 1985). Therefore, the insertion of genes into the events described in this invention... nptII The purpose of gene selection is to select cells that have been transformed with target genes.

[0144] Suitable methods for detecting plant material derived from genetically modified plants (events) based on antibody binding include (but are not limited to): Western blotting, enzyme-linked immunosorbent assay (ELISA), and mass spectrometry (e.g., surface-enhanced laser desorption / ionization (SELDI)). These immunological techniques are familiar to those skilled in the art. Typical steps involve incubating the sample with an antibody bound to a protein, washing to remove unbound antibodies, and detecting whether the antibody has bound. Many such detection methods are based on enzymatic reactions: for example, antibodies can be conjugated to enzymes such as peroxidase, and a color change can be detected upon application of a suitable substrate. Such antibodies can be monoclonal or polyclonal.

[0145] Methods for detecting plant material in an event include, but are not limited to, biofeeding assays, in which the leaves or other suitable parts of the plant in the event, or any plant material derived from the event, are infested by one or more insect pests. Measurements of the assay may include assessing leaf or plant damage after a time adjustment period, assessing mortality, or assessing other insecticidal effects. Such bioassays can be performed in the field or in a greenhouse and may involve natural or artificial insect infestations.

[0146] In another embodiment of the invention, the kit may include antibody binding detection techniques, such as Western blotting, ELISA, SELDI, or test strips. In another embodiment of the invention, the kit may include techniques for detection by biological insect detection (e.g., leaf-feeding bioassay or biomortality assay). In another embodiment of the invention, the kit may include any combination of the above detection techniques.

[0147] The invention has been generally described, and will be better understood by referring to certain specific embodiments, which are included herein to further illustrate the disclosure and are not intended to limit the scope of the invention as defined by the claims.

[0148] The following words and phrases have the following meanings.

[0149] As used in this article, “associated nucleic acids” or “operably linked nucleic acids” refers to at least two nucleic acids that are physically or functionally related. For example, if a promoter or regulatory DNA sequence is operably linked to a DNA sequence encoding RNA or protein, or is located at a position where the regulatory DNA sequence can affect the expression level of the coding or structural DNA sequence, then the two sequences are said to be “associated.”

[0150] As used herein, the term "biological insecticidal composition" refers to a substance, compound, or mixture that exhibits insecticidal activity against insects and comprises at least one aspect of biological origin. Many embodiments of this disclosure are derived from bacteria and / or plants.

[0151] As used in this article, "insect control / insect population control" refers to the suppression of the survival, growth, feeding, and / or reproductive capacity of insect pests through toxic effects, or the limitation of insect-related damage or loss to crops. "Insect control" may or may not refer to killing insects.

[0152] As used herein, “delivery” means contacting a composition (in the most preferred embodiment herein, an insecticidal protein) with insects to produce a toxic effect and control the insects. Insectic proteins can be delivered in a variety of known ways, such as through transgenic plants expressing insecticidal proteins, formulated protein compositions, sprayable protein compositions, bait substrates, or any other toxin delivery system recognized in the art.

[0153] The terms “identity” and “percentage of identity” used herein refer to the degree of similarity between two nucleic acid or protein sequences. For sequence comparison, one sequence is typically used as a reference sequence and compared with the test sequence. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percentage of sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. In the context of two nucleic acid or two amino acid sequences, the phrase “substantially identical” means that two or more sequences or subsequences have at least about 50% nucleotide or amino acid residue identity when compared and aligned to obtain maximum correspondence. This identity can be measured by one of the following sequence comparison algorithms or by visual inspection. In some embodiments, substantially identical sequences have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or even at least about 90% or 95% nucleotide or amino acid residue identity. In some embodiments, substantially identical sequences exist within a sequence region of at least about 50 residues, or within a sequence region of at least about 100 residues, or within a sequence region of at least about 150 residues. In further embodiments, sequences are said to be substantially identical when they are identical over the entire coding region.

[0154] The term "insecticide" as used in this article refers to the descriptive term for insecticidal activity against insects.

[0155] As used herein, the term "isolated toxin" refers to a synthetically produced toxin that exists outside its natural environment and is therefore not a natural product. Isolated toxins can exist in purified form or in non-natural environments, such as, but not limited to, recombinant microbial cells, plant cells, plant tissues, or plants.

[0156] The term “promoter” as used in this article refers to a recognition site on a DNA sequence or set of DNA sequences that provides an expression control element for a structural gene, and to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene.

[0157] As used herein, the term "protein" refers to an organic compound consisting of one or more chains of amino acids. These amino acids can be natural, non-natural, or a combination of natural and non-natural amino acids. The terms "protein," "peptide," and "polypeptide" are used interchangeably herein.

[0158] As used herein, the term "recombination" refers to any modification, alteration, or manipulation of a polynucleotide or protein. The terms "recombination" and "genetic modification" are used interchangeably to refer to any modification, alteration, or manipulation of a polynucleotide or protein in its native form or structure, or in its native environment or context. Modifications, alterations, or manipulations of polynucleotides or proteins may include, but are not limited to, the following examples (including, but not limited to): deletion of one or more nucleotides or amino acids; preparation of a fusion protein from two heterologous polypeptide components; whole-gene deletion; codon optimization; conserved amino acid substitution; or insertion of one or more heterologous polynucleotides.

[0159] As used herein, the term "susceptible insect larvae" refers to insect larvae whose growth is inhibited after oral ingestion of a sample of feed containing one or more proteins of the present disclosure, said feed being artificially produced or obtained from plant tissues artificially coated with or expressing one or more proteins of the present disclosure derived from recombinant genes, as measured by: failure to gain weight, suppression of molting cycle frequency, observed lethargy, reduced fecal production, or death compared to: 1) larvae that do not exhibit any of these signs when fed the same feed provided to susceptible larvae, or 2) larvae fed a control feed that does not contain one or more proteins of the present disclosure.

[0160] As used in this article, the term "transformation" refers to the process of introducing a foreign DNA sequence (e.g., a vector, recombinant DNA molecule) into a cell or protoplast, enabling the foreign DNA to integrate into the chromosome or to replicate autonomously. Transformation includes stable or transient transformation of the foreign DNA sequence.

[0161] As used in this article, “transformed cell” refers to a cell whose genetic composition (chromosomal DNA or other naturally occurring intracellular DNA) is altered by introducing exogenous DNA molecules into the cell.

[0162] As used in this article, the term "treatment" refers to the application of a composition to achieve insecticidal activity against target insect pests. Insecticide treatments are typically applied to plants or planted areas to control insect pests.

[0163] As used herein, the term "vector" refers to a DNA molecule capable of replicating in a host cell, and / or a DNA molecule to which another DNA sequence can be operatively linked, thereby enabling the replication of the linked sequence. A plasmid is an exemplary vector.

[0164] Nucleotides are represented by their bases using the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G). Amino acids are also represented by the following standard abbreviations: alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine ​​(C), glutamine (Q), glutamic acid (E), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), and valine (V).

[0165] The standard recombinant DNA and molecular cloning techniques used in this paper are well known in the art, and for a more detailed description, see Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). The transformation methods are well known to those skilled in the art and are detailed below.

[0166] Example

[0167] Example 1. Selection of Cry proteins for bioassay

[0168] This embodiment describes the selection process for candidate Cry proteins and the production of selected Cry proteins for bioassays.

[0169] Identification of candidate Cry proteins

[0170] To identify potential Cry proteins, we conducted a literature review outlining Bt proteins reported to have insecticidal activity against insect pests, particularly Coleoptera species. To narrow this broad list down to the most viable potential candidates, we selected those most likely to be effective against sugarcane weevils or sugarcane beetles. S. Levis The Bt protein family, which can effectively combat [the virus / organisms], [is involved in the fight against] [the virus / organisms]. Sugarcane weevil Insects with similar phylogenetic structures.

[0171] Most promising for prevention and treatment Sugarcane weevil The candidate Cry protein is targeted at insects belonging to the superfamily Curculionoidea. Sugarcane weevilThe active Cry protein is a member of this superfamily. Other candidate Cry proteins were screened from Cry proteins that are active in members of the Chrysomeloidea, Tenebrionoidea, and Scarabaeoidea families.

[0172] Synthesis and Cloning of Candidate Cry Proteins

[0173] A list of 25 candidate Cry proteins was compiled (Table 1). The coding sequences of these proteins were synthesized and cloned into the pD424-CH E. coli expression vector. This vector was induced by IPTG and produced a recombinant protein fused with a C-terminal six-histidine (His-6) tag. In addition, four truncated and modified forms of the SCW35 protein were designed to test its insecticidal activity (shown in bold in Table 1).

[0174] Table 1. Initial candidate Cry proteins selected for insecticidal testing.

[0175]

[0176] truncated and modified SCW35 protein

[0177] SCW35 (SEQ ID NO: 1) is a candidate insecticidal protein with a polypeptide length of 1169 amino acids. Several truncated and mutant versions of SCW35 have been generated. SCW52 (SEQ ID NO: 2) corresponds to the truncated SCW35, with a length of only 632 residues. SCW57 (SEQ ID NO: 3) corresponds to SCW35 with a mutation at position 291 (tyrosine (Y) to cysteine ​​(C) and at position 353 (glutamine (Q) to alanine (A), and is truncated with a length of only 632 residues. SCW58 (SEQ ID NO: 4) corresponds to SCW35 with a mutation at position 178 (leucine (L) to cysteine ​​(C), and is truncated with a length of only 632 residues. SCW104 (SEQ ID NO: 5) corresponds to SCW35, which is truncated to glycine (G) at position 597 and is only 632 residues long. This truncation corresponds to the removal of the C-terminus and N-terminus from the original Cry8 protein sequence, but the three active domains remain intact. Figure 1A-1C The alignment results for SCW35, SCW52, SCW57, SCW58, and SCW104 are shown.

[0178] Small-scale expression screening

[0179] These vector constructs were then transformed into *E. coli* BL-21(DE3) expression strains. Small-scale expression screening was subsequently performed using 4 mL of induction medium from all 31 clones, followed by cell lysis and small-scale immobilized metal affinity chromatography (IMAC). The recombinant proteins were eluted from the IMAC resin with imidazole-containing buffer, and the presence of soluble recombinant proteins was detected by SDS-PAGE. Proteins detected by SDS-PAGE were considered positive clones.

[0180] amplify expression

[0181] Positive clones identified in the small-scale expression screening were then scaled up in 4 L of autoinduction medium (FW Studier). Protein Expr. Purif. , 41, 207–234. 2005). After induction at 20°C for 48 hours, cells were harvested and lysed using lysis buffer containing lysozyme. Freeze-thaw and sonication were then performed. The lysates were then centrifuged, and the supernatant was purified by IMAC using an Akta Pure® FPLC system (GE Healthcare). The purified eluted sample was dialyzed against buffer A (TrisCl 50 mM, NaCl 300 mM, glycerol 10%) and quantified by BCA assay. Protein purity was then assessed by SDS-PAGE density assay. The final protein sample was concentrated to 500 μg / mL for further processing. Sugarcane weevil Further testing is required in bioassays.

[0182] result

[0183] Following expression, all 31 proteins showed soluble positive results. These positive clones were then scaled up for bioassay analysis.

[0184] Example 2. Bioassay using recombinant Cry protein

[0185] This embodiment describes a method for testing the efficacy of the Cry protein identified by the method of Example 1. More specifically, this embodiment describes the oral delivery of soluble recombinant Cry protein to sugarcane weevils. Sugarcane weevil The method. The identified Cry protein leads to Sugarcane weevil Stunting or death.

[0186] Materials and methods

[0187] Sugarcane weevil breeding

[0188] Bioassays require the use of Sugarcane weevilThe newborn larvae. However, due to the low survival rate of eggs and larvae, rearing... sweet Sugarcane weevil It is quite challenging. S. Levis The larval stage lasts 26 to 50 days, with a survival rate of only 35.8%, while the pupal stage lasts 5 to 13 days, with a survival rate as high as 93% (Degaspari, N. et al., Biologia de Sphenopherus levis Vaurie, 1978 (Col.: Curculionidade), em dieta artificial e no campo. Pesquisa Agropecuária Brasileira, Brasília, DF, v. 22, n. 3, p. 553-558, 1987). This results in slow insect population growth, requiring continuous collection of adults from the field to replenish the population available for testing. Sugarcane weevil There is a seasonal cycle, so a large number of adult insects can only be collected between October and March. At the beginning of the bioassay screening phase, about 25 larvae / day are available for collection, but the number of larvae available for bioassay increases in late September and October.

[0189] Bioassay

[0190] The purified recombinant Cry protein (selected in Example 1) was added at a concentration of 500 μg / mL to... Sugarcane weevil In the artificial feed, at 45℃ (maximum), the ratio of protein solution to feed was 1 part protein solution to 4 parts feed, yielding 100 μg Bt protein / mL feed. After incorporation, the feed was evenly distributed into a 96-well detection plate (300 μL feed per well), and one newborn SCW larva was infected in each well. The larvae were incubated at 25℃ for 7 days.

[0191] The Cry protein concentration (100 μg / mL feed) used in the bioassay was selected based on the LC50 values ​​of Coleoptera-specific Bt proteins in the literature, ranging from 0.1 to 5.1 μg / mL (GR Oliveira et al.). BMC Biotechnol. 11, 85. 2011; M. Ekobu et al. J. Econ. Entomol. 103, 1493–1502. 2010; IO Oyediran et al. Insect Sci (23, 913–917. 2016). The toxic protein was projected to cause SCW larval mortality exceeding 50%. Therefore, a feed protein concentration of 100 μg / mL ensured that the Cry protein would not cause SCW mortality. Sugarcane weevilNon-toxic.

[0192] Toxicity screening program

[0193] The screening protocol consisted of bioassays using the same protein concentration (100 μg / mL feed). After 7 days of incubation, the mortality percentage was calculated, taking into account both dead larvae and actual mortality (larvae with lower activity after brush touch). The LC50 for each purified recombinant Cry protein was also calculated. As described above, Sugarcane weevil The larval survival rate is low; therefore, the mortality rate of the screening bioassay control is consistently 30-40%. The higher mortality rate here is due to the high toxicity of the Cry protein.

[0194] result

[0195] The results of the toxicity screening of recombinant Cry protein are summarized in Figure 2 middle. Figure 2 In this context, the relative mortality rate is reported as the percentage of mortality that is higher than the expected mortality rate of the control group, which is calculated by subtracting the percentage of the negative control mortality rate from the average actual mortality rate. Figure 2 The results show that SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 exhibit superior mortality rates compared to other known insecticidal Cry proteins. Furthermore, Figure 3 The results of this examination are shown in the LC50 plots of the highly efficient recombinant Cry proteins SCW52 (SEQ ID NO: 2) and SCW104 (SEQ ID NO: 5).

[0196] These surprising results show that these different truncated and mutant forms of the recombinant SCW35 protein have... sugar cane Elephant Armor It exhibits exceptionally high toxicity. Furthermore, bioassays have confirmed that the soluble form of SCW35 increases the toxicity of the SCW35 protein.

[0197] Example 3. Bioassay of SCW35, SCW52, SCW57, SCW58 and SCW104 protein variants

[0198] The examples describe methods for testing the efficacy of SCW35, SCW52, SCW57, SCW58, and SCW104 variants. More specifically, this example describes the oral delivery of soluble recombinant and / or variant SCW35, SCW52, SCW57, SCW58, and SCW104 proteins to sugarcane weevils. Sugarcane weevil The method.

[0199] Materials and methods

[0200] Synthesis and Cloning of Candidate Cry Proteins

[0201] Variants of the SCW35, SCW52, SCW57, SCW58, and SCW104 proteins described in the above embodiments were constructed, including variants containing one or more of the following modifications, alone or in any combination: point mutations, domain exchanges, truncation, and other variations in amino acid sequence and / or protein structure. The synthesis and cloning of these variants were performed according to the methods described in Example 1.

[0202] Express

[0203] The variants were expressed in small-scale and large-scale expression screenings, as described in Example 1. The variants are expected to exhibit soluble positive results. Positive clones will then be scaled up for bioassay analysis.

[0204] Sugarcane weevil breeding

[0205] As described in Example 2, raising Sugarcane weevil Used for biological assays.

[0206] Bioassay

[0207] Bioassays were performed on the SCW35, SCW52, SCW57, SCW58 and SCW104 variants as described in Example 2.

[0208] Toxicity screening program

[0209] The screening scheme was carried out as described in Example 2.

[0210] result

[0211] The analysis and presentation of bioassay results are as described in Example 2. Compared to the SCW35, SCW52, SCW57, SCW58, and SCW104 proteins tested in Example 2, the SCW35, SCW52, SCW57, SCW58, and SCW104 variants are expected to... Sugarcane Elephant First It has approximately the same or higher toxicity.

[0212] Example 4. SCW52 Plant expression and efficacy

[0213] This embodiment describes the use of SCW52 in plants to control [a disease / problem] in sugarcane. Sugarcane weevilThe method described herein is as follows. Specifically, this embodiment describes the generation of the construct for expressing SCW52, the conversion of the construct into sugarcane, the assessment of the presence of SCW52 protein in sugarcane, the determination of the copy number of the inserted transgene, and the bioassay of the inserted transgene.

[0214] Materials and methods

[0215] Developing constructs using SCW52 and nptII genes

[0216] Constructs for expressing embodiments of this disclosure are developed using conventional gene cloning techniques, including commercial bacterial plasmids, restriction enzyme digestion, and fragment ligation (using ligases).

[0217] The constructed method disclosed herein is achieved by using p35S / iOsAct1- SCW52 -tNOS and pOsAct1 / iOsAct1- nptII Developed using TNOS cassette ligation. The two-cassette T-DNA was transferred from the cloning plasmid to the basal plasmid (a binary plasmid vector with a host bacterial spectrum including *E. coli* and *Agrobacterium tumefaciens*) using restriction endonucleases, thereby generating the publicly disclosed construct. Figure 4 (SEQ ID NO: 14).

[0218] After completing the final cloning step, the construct was inserted into *E. coli* strain TOP10 using heat shock technology. The isolated colonies containing the construct were inoculated into LB liquid medium supplemented with 150 µg / ml spectinomycin and cultured at 37°C with shaking at 250 rpm for 16 hours. Then, a stock solution containing bacterial suspension and 10% (v / v) glycerol was prepared and stored in an ultra-low temperature freezer at -80°C.

[0219] The construct of this invention was transferred from *Escherichia coli* to *Agrobacterium tumefaciens* strain EHA105 by isolating and purifying plasmid DNA and transforming it into *Agrobacterium tumefaciens* using electroporation. Similar to the *E. coli* strain, the stock solution containing *Agrobacterium tumefaciens* suspension and 10% (v / v) glycerol was stored in an ultra-low temperature freezer at -80°C.

[0220] Agrobacterium-mediated plant transformation

[0221] To obtain embryogenic callus, sugarcane leaf rolls grown in the field or greenhouse for up to 12 months were collected to isolate the initial explants.

[0222] After surface sterilization, under aseptic conditions, cut transverse sections approximately 0.05–5 mm thick from above the meristem. Place the sections on the surface of callus induction medium [MS – Murashige and Skoog, from Murashige and Skoog (1962) A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Plant Physiology, 15, 473–497; sucrose, vitamin B5, amino acids selected from proline, casein hydrolysate, citric acid, mannitol, copper sulfate, glycine, gelling agent, 2,4D]. Maintain the culture in the dark at 26 ± 2°C, and subculture every 15 days for 3 to 5 cycles, each cycle lasting 7–28 days. One week before transformation, select callus tissue again for characteristics favorable to embryogenesis: nodular, compact, opaque, and slightly yellowish callus tissue.

[0223] The Agrobacterium culture contained strain EHA105 transformed by the construct of this invention, and was cultured in glycerol stock solution as the starting medium at 28°C in the dark for 2-3 days. The culture was resuspended in MS liquid medium supplemented with acetylsyleugenone to prepare an Agrobacterium suspension, and the final OD was adjusted. 600 It is prepared at a concentration of 0.1-1.0 (MS salt, sucrose, and vitamin B5) for infection of callus tissue.

[0224] Callus tissue with embryogenesis characteristics was visually selected and directly transferred to Agrobacterium suspension, and stirred at a constant speed of 50 rpm for 30 minutes in the dark.

[0225] Subsequently, callus tissue was isolated from the Agrobacterium suspension and excess suspension was removed. The callus tissue was then placed in a semi-solid culture medium (MS salt, sucrose, vitamin B5, citric acid, gelling agent, 2,4-D and acetylsuccinone) and cultured at 22°C in the dark for 1–5 days.

[0226] After co-culturing, the callus tissue was transferred to DT resting medium (MS salt; sucrose, vitamin B5, amino acids selected from proline and asparagine, casein hydrolysate, citric acid, copper sulfate, glycine, gelling agent, 2,4D, timentin) and stored in the dark at 26°C for 5–14 days.

[0227] Transformed cells were screened by continuous subculturing in a selective medium containing phytoregulators and the selector genistein. The selective medium containing genistein included MS salts, sucrose, vitamin B5, amino acids selected from proline and asparagine, casein hydrolysate, copper sulfate, glycine, a gelling agent, 2,4D, and termetin. Callus was kept in the dark at 26°C for 21 days, then transferred to regeneration medium (equivalent to the selective medium without 2,4D), followed by elongation medium (containing MS salts, sucrose, vitamin B5, casein hydrolysate, a gelling agent, and termetin). The callus was exposed to a 16-hour photoperiod at 4,000 lux in the presence of the selector for proliferation, rooting, and acclimatization, before being transferred to a greenhouse. This process was used to generate clones expressing the target protein.

[0228] Enzyme-linked immunosorbent assay (ELISA)

[0229] To assess SCW52 protein activity using ELISA, different sugarcane tissues at different stages of crop development were studied.

[0230] To analyze SCW52 protein by ELISA, 200 mg ± 1 plant tissue samples were impregnated using a TissueLyser instrument (QIAGEN, Germanytown, Maryland, USA). 350 µL of phosphate extraction buffer (PBS) containing Tween™ 20 (0.138 M NaCl; 0.027 mM KCl; 0.05% Thermo Scientific™ Tween™ 20, pH 7.4) was added to the impregnated tissue.

[0231] After adding buffer, homogenize by vortexing, then centrifuge at maximum speed for 20 minutes. Collect the supernatant and quantify total protein using the Bradford method (SCW52).

[0232] The standards used to obtain calibration curves were the diluted commercially available BSA (bovine serum albumin) standards provided in the kit described above. Standard solutions (prepared with PBST buffer) at concentrations of 2000 µg / mL, 1000 µg / mL, 500 µg / mL, 250 µg / mL, 125 µg / mL, and 0 µg / mL were used. 10 µL of each standard solution was added to the wells of the microplate in triplicate. A total of six curves were generated through independent dilutions. For the samples, 10 μL of the three independent protein extracts was used per well. Then, 200 μL of Coomassie Brilliant Blue reagent solution was added to each well containing the calibrator and sample. The plate was capped and incubated at room temperature for 5 minutes. The absorbance at 595 nm was read using SoftmaxPro® 7.0 software (Molecular Device, US).

[0233] Each study sample was measured three times to obtain total soluble protein. After each repeated quantification of total protein, the sample with the smallest median variation in quantification was selected for ELISA analysis. After total protein quantification, the sample was diluted 8-fold.

[0234] The SpectraMax® microplate reader (Molecular Devices, USA) was used to read the spectra in 96-well plates at two different wavelengths, 450 nm and 630 nm, to obtain the results. For SCW52, a commercially available His-tag kit was used for protein detection and quantification.

[0235] The analysis was based on the correlation between the absorbance values ​​of the test samples and the predicted values ​​in the equation estimated by measuring the absorbance of the standard curve. Synthetic proteins were diluted to the desired concentration in PBST buffer. Each sample was analyzed in duplicate. SCW52 concentrations are expressed based on total protein (µg / mg).

[0236] Determine the copy number of the transgene inserted into the host plant germplasm.

[0237] Taqman® PCR (qPCR / Taqman®) assessment of inserted plants SCW112 and nptII Gene copy number. Taqman® real-time PCR reactions were performed using QuantStudio 6 and 7 Flex Real-Time PCR (Applied Biosystems™, EUA). The primer pairs and probes used are shown in Table 2. SCW52 and nptIIThe endogenous positive control for the reaction (used to confirm the presence and quality of the DNA used and the validity of the reaction), the sugarcane polyubiquitin gene (forward primer: 5'ACCATTACCCTGGAGGTTGAGA 3' (SEQ ID NO: 16); reverse primer: 5'GTCCTGGATCTTCGCCTTCA 3' (SEQ ID NO: 17); probe: VIC-5'CTCTGACACCATCGAC 3'-MGB (SEQ ID NO: 18)) was used in multiplex mode.

[0238] Table 2. Primer pairs and probes

[0239] The qPCR reaction used 1X TaqMan® Fast PCR Master Mix II (Applied Biosystems, USA), and the concentrations of each primer and corresponding probe were specified (Table 2). The thermal cycling program was as follows: 50°C for 2 minutes to activate uracil N-glycosylation enzyme; 95°C for 20 seconds to activate DNA polymerase; 40 cycles of 95°C for 3 seconds (denaturation) and 60°C for 30 seconds (annealing and extension).

[0240] Data analysis was performed by manually inputting the threshold for the exponential phase of the amplification curve. For SCW52 and nptII Gene copy number is inferred through DeltaCt (dCt) analysis, which subtracts the Ct value of the target gene (the number of cycles at which the fluorescence signal emitted by the amplified product reaches a threshold) from the Ct value of the endogenous gene. In this analysis, it is assumed that the copy number doubles at each Ct value, and a known copy number of the same control is used as a reference.

[0241] In vitro biological test: Sugarcane weevil

[0242] Utilizing target pests Sugarcane weevil In vitro bioassays (feeding bioassays) showed that the insecticidal protein SCW52 expressed in plants can effectively control pests.

[0243] For bioassays, plant tissues from genetically modified sugarcane plants (successful events) and non-transgenic sugarcane plants (negative controls) were collected, freeze-dried, mixed with insect gel bait, and aliquoted into bioassay plates. Each well of the culture plate was inoculated with... Sugarcane weevil The larvae (neonate) were incubated for 7 days at 25±1℃, relative humidity 60±10%, and photoperiod 12:12h (light:dark). At the end of incubation, the larval mortality rate was assessed.

[0244] result

[0245] The constructs generated by SCW52 are as follows Figure 4 As shown, its sequence is SEQ ID NO: 15. According to the... SCW52 and nptII The conversion events performed selected one or two. SCW52 and nptII Gene copying events are tested in vitro.

[0246] After 7 days of bioassay, the average mortality rate of the modified plants (SCW52 expression plants) was 78%. Figure 5 ).

Claims

1. A recombinant polypeptide having at least 40%, at least 60%, at least 90%, or 100% sequence identity with SEQ ID NO: 1, and / or a variant or fragment thereof.

2. A recombinant polypeptide comprising at least one amino acid substitution, deletion and / or insertion compared to SEQ ID NO: 1; and / or at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 1, optionally wherein the recombinant polypeptide comprises a sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO:

5.

3. The recombinant polypeptide according to claim 2, wherein the polypeptide has at least one amino acid substitution, deletion and / or insertion compared to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5; and / or has at least one addition at the N-terminus or C-terminus compared to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO:

5.

4. The recombinant polypeptide according to any one of claims 1-3, wherein the recombinant polypeptide is a fusion protein, variant thereof, or fragment comprising at least a portion of the polypeptide according to any one of claims 1-3.

5. The recombinant polypeptide according to any one of claims 1-4, wherein the polypeptide has insecticidal activity against at least one agricultural insect pest, wherein the at least one insect pest is a coleopteran pest, and optionally wherein the coleopteran pest is a sugarcane weevil ( Sphenophorus levis ).

6. A polynucleotide encoding a polypeptide of any one of claims 1-5.

7. A recombinant polynucleotide encoding the polypeptide of claim 6, wherein the recombinant polynucleotide comprises a sequence selected from SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:

10.

8. The recombinant polynucleotide of claim 6, wherein the polynucleotide has a codon optimized for expression in an agriculturally important crop, optionally wherein the agriculturally important crop is sugarcane, and wherein the polynucleotide comprises SEQ ID NO:

11.

9. The recombinant polynucleotide of claim 6, wherein the polynucleotide is a non-genomic polynucleotide, optionally wherein the polynucleotide is a synthetic polynucleotide, and / or wherein the polynucleotide is cDNA.

10. An isolated construct or expression cassette comprising a nucleotide encoding a polypeptide of any one of claims 1-5 or a polynucleotide of any one of claims 6-9, wherein the nucleotide or polynucleotide is operatively linked to a promoter and optionally operatively linked to a heterologous regulatory element.

11. The isolated construct or expression cassette according to claim 10, wherein the polypeptide comprises at least one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5, and / or wherein the polynucleotide comprises at least one of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO:

10.

12. The isolated construct or expression cassette according to claim 10 or claim 11, wherein the promoter is selected from constitutive promoters, inducible promoters, and tissue-specific promoters.

13. A transgenic plant, plant part, propagule, seed, tissue, organ, embryo or plant cell comprising a polypeptide of any one of claims 1-5, a polynucleotide of any one of claims 6-8 or an isolated construct or expression cassette of any one of claims 10-12; Optionally, the one or more polypeptides are selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5; and / or Optionally, the one or more polynucleotides are selected from SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:

10.

14. An insecticidal composition comprising: (i) One or more polypeptides of any one of claims 1-5, wherein the concentration of the one or more polypeptides is sufficient to control at least one agricultural insect pest. (ii) one or more polynucleotides of any one of claims 6-9, wherein said polynucleotide has a codon optimized for expression in agriculturally important crops; and / or (iii) One or more separate constructs or expression boxes according to any one of claims 10-12; Optionally, the one or more polypeptides are selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5; and / or Optionally, the one or more polynucleotides are selected from SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:

10.

15. The insecticidal composition of claim 14, wherein the at least one agricultural insect pest is a coleopteran pest, and wherein when the composition is applied to plants or plantations, the concentration of the one or more polypeptides present is sufficient to control at least one agricultural insect pest in or on the plants.

16. The insecticidal composition according to claim 14 or claim 15, further comprising one or more inert components and / or an acceptable carrier; (i) The composition is formulated as a suspension, solution, emulsion, spreader, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granules, adjuvant, paste, gel, culture medium, artificial feed, or encapsulated in an agriculturally acceptable carrier; (ii) wherein the composition is formulated as an orally acceptable, orally administerable or orally ingestible bait for consumption by insect pests; (iii) The composition is formulated for direct soil application and / or direct potting substrate application; and / or (iv) The composition is formulated as a controlled-release formulation.

17. The insecticidal composition according to any one of claims 14-16, wherein, Control of Coleoptera pests includes: a) Reduces pest infestation by 40%, 50%, 60%, 70%, 80%, 90%, or 100%; or b) Increases pest mortality by 40%, 50%, 60%, 70%, 80%, 90%, or 100%.

18. The insecticidal composition according to any one of claims 15-17, wherein the coleopteran pest is the sugarcane weevil.

19. A method for controlling insect pest populations, comprising: a) Provide a composition comprising at least one polypeptide of any one of claims 1-5 or provide a composition of any one of claims 14-18; and b) Contact the insect pest population with an effective amount of the composition; Optionally, at least one of the polypeptides is selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO:

5.

20. The method of claim 19, wherein The contact in step (b) includes one or more of the following: providing the pest with a composition formulated as insect bait; feeding the pest with the composition; applying the composition to the outer surface of the pest; applying the composition to a plant; applying the composition to a plant part fed by the pest; applying the composition to a soil area where the pest may be present; applying the composition to an area where the pest population may be present; providing the composition formulated as a controlled-release formulation to an area where the pest is expected to appear; applying the composition to an insect pest trap; injecting the composition into a plant; or injecting the composition into a pest; or The contact in step (b) includes applying the composition to a plant or an area to be planted, optionally wherein the composition is applied to the plant in at least one of the following ways: foliar treatment, seed coating, injection treatment, pre-emergence treatment, and / or post-emergence treatment.

21. The method according to claim 19 or claim 20, wherein the composition is formulated as a suspension, solution, emulsion, spreader, dispersible granules or pellets, wettable powder, emulsifiable concentrate, aerosol, spray, impregnated granules, adjuvant, paste, gel, culture medium, artificial feed, or encapsulated in an agriculturally acceptable carrier; and / or wherein the composition is prepared by drying, freeze-drying, homogenization, extraction, filtration, centrifugation, sedimentation, cryopreservation, or concentration.

22. The method according to any one of claims 19-21, wherein feeding, spraying, dusting, coating, or wetting with the composition, or any combination thereof, brings the pest into contact with an effective amount of the composition.

23. The method according to any one of claims 19-22, wherein the insect pest population is reduced by 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to an insect pest population that has not been exposed to the composition; optionally wherein the insect pest or insect pest population is resistant to at least one Bt toxin.

24. The method according to any one of claims 19-23, further comprising providing a chemical mixture, an insecticidal protein, and / or a biocontrol agent, and contacting an insect pest population with an effective amount of the chemical mixture, the insecticidal protein, and / or the biocontrol agent before, during, or after step (b).

25. The method according to any one of claims 19-24, wherein the insect pest is a coleopteran pest, and optionally wherein the coleopteran pest is a sugarcane weevil.

26. A method for controlling insect pest populations, comprising: a) Providing an insecticidal composition comprising one or more polypeptides according to any one of claims 1-5; b) Introducing the insecticidal composition into an insect pest population, wherein the introduction is achieved by providing the composition in or on a food source of the insect pest; and The population of the aforementioned insect pests has decreased.

27. Use of the polypeptide of any one of claims 1-5 for inhibiting insect growth, controlling or killing insects and / or controlling or killing insect populations.

28. A kit for detecting peptides and / or polynucleotides, comprising tools for detecting the presence of one or more peptides according to any one of claims 1-5 and / or one or more polynucleotides according to any one of claims 6-9. The tool may contain primer pairs designed to bind to the polynucleotide, or the tool may contain primer pairs and probes designed to bind to the polynucleotide, and / or the tool may contain an antibody for detecting the polypeptide.

Images