EegRNA (Ribonucleic Acid) primer pair for detecting Indel marker related to porcine diarrhea virus resistance and application thereof

Abstract

The invention discloses an epegRNA (Ribonucleic Acid) primer pair for detecting an Indel marker related to porcine diarrhea virus resistance and application of the epegRNA primer pair. According to the epegRNA sequence provided by the invention, accurate AACA insertion mutation can be realized on a sequence of which the pig genome position is ChrX: 56448702 through pilot editing; the A / AAACA mutation can be used as a molecular marker to be applied to breeding for resisting porcine epidemic diarrhea.

Description

TECHNICAL FIELD

[0001] The application relates to an epegRNA primer pair for detecting an Indel marker related to porcine diarrhea virus resistance and an application thereof, and belongs to the technical field of animal genetic breeding and genetic engineering. BACKGROUND

[0002] Porcine epidemic diarrhea is a highly contagious enteric disease characterized by vomiting, diarrhea and dehydration in piglets caused by porcine epidemic diarrhea virus (PEDV). PEDV is one of the main pathogens causing viral diarrhea in pigs, which is extremely harmful to newborn piglets, and the mortality rate of sick nursing piglets is as high as 100%, which seriously threatens the high-quality and healthy development of China's pig industry. In recent years, due to the rapid variation of PEDV, the protective effect of the existing vaccine is unstable, and the protection period of maternal antibodies for newborn piglets is short, so the difficulty and cost of PEDV prevention and control increase. Therefore, screening and identifying PEDV resistance functional genes and obtaining resistance molecular genetic markers, and then implementing disease-resistant breeding to improve the resistance of pigs to PEDV from the genetic essence are of great significance for the prevention and control of PEDV.

[0003] Gene insertion / deletion (Insertion-deletion, Indel) is a type of variation in the genome, which refers to the insertion or deletion of a small fragment at a specific location in the genomic DNA, resulting in differences in the length of the DNA sequence at the site between different individuals (or strains). As a common DNA length polymorphism variation, Indel has become an important molecular marker in pig disease-resistant breeding due to its simple detection, low cost and good stability.

[0004] Prime editor (PE) is a gene editing method based on search and replacement without DNA double-strand break and without template strand, which can realize the insertion and deletion of target sequence bases and the free conversion of 12 types of bases. The PE system includes three core components, including the PE protein fused by the modified Cas9 nicking enzyme and the reverse transcriptase, the pegRNA (or the optimized epegRNA) and the nicking sgRNA (ngRNA, optional), the PE2 system is composed of the PE protein and the epegRNA, and in the more efficient PE3 / PE3b system, the ngRNA is used. At present, molecular breeding has become a new way for livestock breeding, PE editing is an important technical tool for identifying functional genetic variations, and screening and identifying resistance-related genetic variation sites through PE editing and other new biological technologies can promote the process of pig viral diarrhea disease-resistant breeding and promote the rapid development of modern animal husbandry. SUMMARY

[0005] The application aims to provide an epegRNA primer pair for detecting an Indel marker related to porcine epidemic diarrhea virus resistance and application thereof.

[0006] The application provides an epegRNA primer pair for detecting an Indel marker related to porcine epidemic diarrhea virus resistance, and the nucleotide sequence is shown as SEQ ID NO. 9-10; the Indel marker related to porcine epidemic diarrhea virus resistance is located at ChrX: 56448702 of the pig genome with the accession number NC_010461.5, and the base is A or AAACA.

[0007] The porcine epidemic diarrhea virus resistance of an individual pig with the genotype AAACA of the polymorphic site contained in the Indel marker is significantly higher than that of the A genotype.

[0008] The application further provides a detection reagent or kit containing the epegRNA primer pair.

[0009] The kit further comprises template DNA, Taq Plus Master Mix II.

[0010] The application further provides a gene editing method for inserting an Indel marker related to porcine epidemic diarrhea virus resistance, comprising the following steps: (1) annealing the epegRNA primer targeting the genetic variation site to form dsDNA; (2) connecting the dsDNA with a linearized pU6-tevopreq1-GG-acceptor vector, transforming the connection product into a competent cell, culturing, extracting, and obtaining an epegRNA3 expression plasmid; (3) co-transfecting the epegRNA3 expression plasmid and a lead editor pCMV-PEmax-P2A-BSD into pig small intestinal epithelial cells; using a PE2 editing system to perform base editing, and the mass ratio of the plasmid epegRNA to pCMV-PEmax-P2A-BSD in the PE2 system is 1:3; (4) performing drug screening using blasticidin, picking positive clone cells, and obtaining cells with an Indel marker related to porcine epidemic diarrhea virus resistance; the Indel marker related to porcine epidemic diarrhea virus resistance is located at ChrX: 56448702 of the pig genome, and the base is AAACA.

[0011] In step (1), the annealing reaction system contains annealing buffer and enzyme-free water.

[0012] The annealing procedure in step (1) is 95 ℃ 2 min, decreasing 0.1 ℃ every 8 s to 25 ℃.

[0013] The linearized pU6-tevopreq1-GG-acceptor vector in step (2) is obtained by restriction enzyme Bsal-HFv2 digestion.

[0014] The application also provides application of the epegRNA primer pair or the detection reagent or kit in identifying or selecting pigs with high porcine epidemic diarrhea virus resistance.

[0015] The application also provides application of the epegRNA primer pair or the detection reagent or kit in early prediction of porcine epidemic diarrhea virus resistance.

[0016] The application also provides application of the epegRNA primer pair or the detection reagent or kit in marker-assisted breeding related to porcine epidemic diarrhea virus resistance.

[0017] The application also provides a method for identifying or selecting pigs with high porcine epidemic diarrhea virus resistance, comprising the following steps: (1) extracting genomic DNA of a pig to be tested; (2) using the genomic DNA of the pig to be tested as a template, performing PCR amplification reaction by using the primer pair shown in SEQ ID NO. 1-2; (3) analyzing the PCR amplification product; when the genotype at the 152nd bp of the PCR amplification product is AAACA type, the pig to be tested is a pig with high porcine epidemic diarrhea virus resistance; when the genotype at the 152nd bp of the PCR amplification product is A type, the pig to be tested is a pig with low porcine epidemic diarrhea virus resistance.

[0018] The PCR amplification reaction system in step (2) comprises template DNA, the primer pair or Taq Plus Master Mix II.

[0019] The PCR amplification reaction procedure in step (2) is as follows: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, a total of 35 cycles; and 72 ℃ extension for 5 min.

[0020] Step (3) comprises detecting the genotype at the 152nd bp of the PCR amplification product, and the genotype AAACA type of an individual is significantly higher than that of A type in terms of porcine epidemic diarrhea virus resistance.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The provided epigRNA sequence can be efficiently and accurately inserted into the sequence at ChrX: 56448702 in the pig genome by using a leader editor; (2) A / AAACA mutation can be used as a molecular marker for breeding of pig epidemic diarrhea. Attached Figure Description

[0022] Figure 1 This is the PCR agarose gel image in this embodiment; where 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 represent 10 test samples; M is the DNA Marker I pattern; Figure 2 This is a genotyping diagram of the Meishan pig sample in this embodiment, where Figure A is the sequencing peak diagram of the wild type; Figure B is the sequencing peak diagram of the mutant type. Figure 3 This example shows the efficiency detection of mixed pool editing of porcine small intestinal epithelial cells after base insertion editing. Figures A, B, C, D, E, and F correspond to the efficiency detection of PE2-epegRNA1, PE2-epegRNA2, PE2-epegRNA3, PE3-epegRNA1, PE3-epegRNA2, and PE3-epegRNA3 editing, respectively. Figure 4 These are the sequencing peak diagrams of cells after base insertion editing in this embodiment, where Figure A is the sequencing peak diagram of wild type; Figure B is the sequencing peak diagram of mutant type. Figure 5 The figure shows the effect of base insertion editing on PEDV infection before and after in this embodiment, where A is the mRNA expression level of PEDV-M and B is the protein level of PEDV-N. Figure 6 This example illustrates the effect of base insertion mutations on PEDV titers. Detailed Implementation

[0023] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0024] Example 1 1. Ear tissue samples were collected from 300 Meishan pigs, and DNA extraction was performed using the FastPure DNA extraction kit. ® The Cell / Tissue DNAIsolation Mini Kit (Nanjing Novizan Biotechnology Co., Ltd., DC102-01) was used to extract genomic DNA from ear tissue and detect its concentration. The DNA sample was stored at -20℃ for later use.

[0025] 2. Primers were designed according to the sequence of pig genome (accession number NC_010461.5) in NCBI (https: / / www.ncbi.nlm.nih.gov / ) database, including forward primer: SEQ ID NO. 1: 5'-AGCCCCTGGATACAATGGGA-3' and reverse primer: SEQ ID NO. 2: 5'-CACAGCAGGAGAGGGATAGC-3', which were synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd. The PCR reaction system 20 μl included: template DNA (100 ng / μL) 1 μL, 1 μL of primer F and R with a concentration of 10 μM each, 2 × Taq Plus Master Mix II 10 μL, ddH2O 7 μL. The PCR reaction conditions were: 95℃ 5 min; 95℃ 30 s, 60℃ 30 s, 72℃ 30 s, 35 cycles; 72 ℃ 5 min. The PCR amplification product was as shown in Figure 1 The size of the PCR amplification product was 296 bp. The obtained PCR product was detected by Sanger sequencing, which had a genetic variation of 4 bp base insertion at AACA 152 bp of the PCR amplification fragment, and its position on the pig genome was ChrX: 56448702. The genotyping results of the two genotypes were as shown in Figure 2The wild type sequence is shown in SEQ ID NO. 3: AGCCCCTGGATACAATGGGAAGGCAGAGAAGGAGGGGGGCCAGCTCTTGGCATAAGAGAGCCAGTCTTCCTTCTTGCTGTTCCAAATCCAGTGCGTTTGGGGGGAGGGGTAGCCGAGCTTATCCCTAGAGAAGGCATCCTTTCCCACCAACACTTCGCTAGACTCCAGGCTTCATCAGGCAAAAGGTAGAGAGAGAAGATCAGTCAAGCCAGCCCCCAGTCCCTGGCCCACCCAGAGCCCTGTGCTCTAGTGCTAAGCCGACTCTACAATGTGCTGGCTATCCCTCTCCTGCTGTG; the mutant sequence is shown in SEQ ID NO. 4: AGCCCCTGGATACAATGGGAAGGCAGAGAAGGAGGGGGGCCAGCTCTTGGCATAAGAGAGCCAGTCTTCCTTCTTGCTGTTCCAAATCCAGTGCGTTTGGGGGGAGGGGTAGCCGAGCTTATCCCTAGAGAAGGCATCCTTTCCCACCAACAAACACTTCGCTAGACTCCAGGCTTCATCAGGCAAAAGGTAGAGAGAGAAGATCAGTCAAGCCAGCCCCCAGTCCCTGGCCCACCCAGAGCCCTGTGCTCTAGTGCTAAGCCGACTCTACAATGTGCTGGCTATCCCTCTCCTGCTGTG. The wild type genotype is denoted as WT, and the mutant genotype is denoted as MUT.

[0026] 3. Three pairs of epegRNA primers (SEQ ID NO. 5-10) were designed on the website http: / / pegfinder.sidichenlab.org / , in which the sgRNA targeting the genetic variation site, the backbone, and the 3' extension containing the primer binding sequence and reverse transcription template were included. Three pairs of ngRNA (SEQ ID NO. 11-16) were also designed for PE3 editing system. The annealing reaction system: 10 μL of 50 μM primer F and R, 10 μL of annealing buffer, and 20 μL of enzyme-free water. The reaction program: 95 ℃ for 2 min, decreasing by 0.1 ℃ every 8 s (700 times) to 25 ℃, and forming dsDNA after annealing. The specific primer sequences are shown in Table 1 and Table 2.

[0027] Table 1 Primer information

[0028] Table 2 Primer information

[0029] 4. Linearize pU6-tevopreq1-GG-acceptor (Wuhan Mirlin Biotech Co., Ltd., P41657) vector using Type IIS restriction enzyme Bsal-HFv2. The enzyme system is: 5 μg of vector, 1 μL of Bsal-HFv2 enzyme, 1 μL of Ncol-HF enzyme, 1 μL of Pvull-HF enzyme, 4 μL of rCutSmar Buffer, and enzyme-free water to 40 μL. Enzyme digestion at 37°C for 3 h, 1% agarose gel electrophoresis for 20 min, and purification and recovery of 2.2 kb linearized vector using a gel recovery kit (Omega Bio-tek, D2500-01). The obtained dsDNA was connected with the linearized vector using T4 DNA ligase, and the ligation product was transformed into DH5a competent cells, spread on LB medium with 100 ng / ml ampicillin resistance, and cultured at 37°C for 14 h. After picking positive clones, the bacterial liquid was expanded and cultured, and the plasmid was extracted. Universal primer U6 (Shanghai Genechem Co., Ltd.) was used for sanger sequencing, and epegRNA1, epegRNA2, epegRNA3, ngRNA1, ngRNA2, and ngRNA3 expression plasmids were successfully obtained.

[0030] 5. The above obtained plasmids and the lead editor pCMV-PEmax-P2A-BSD (Wuhan Mirlin Biotech Co., Ltd., P37189) were co-transfected into pig small intestinal epithelial cells by Lipofectamine TM 3000 (ThermoFisher, L3000015). The total amount of plasmid in a 6-well plate was 2 μg, wherein the mass ratio of plasmid epegRNA to pCMV-PEmax-P2A-BSD in the PE2 system was 1:3, and the mass ratio of plasmid ngRNA, epegRNA, and pCMV-PEmax-P2A-BSD in the PE3 editing system was 1:3:9. The liquid was changed after 6 h of transfection, and the cells were cultured in complete medium for 24 h before drug screening.

[0031] 6. The drug screening concentration of blasticidin is 10 μg / mL, and the cell DNA is extracted after 6 days of drug screening. Amplification is performed using the PCR primers and conditions in Step 2, and the recovered product is subjected to second-generation sequencing (illumina-PE250). The mutation efficiency is analyzed using the CRISPResso2 software, and the results are as follows Figure 3 It is shown that the editing efficiency of PE2-epegRNA1 is 4.78%, the editing efficiency of PE2-epegRNA2 is 24.66%, the editing efficiency of PE2-epegRNA3 is 27.46%, the editing efficiency of PE3-epegRNA1 is 9.56%, the editing efficiency of PE3-epegRNA2 is 18.87%, and the editing efficiency of PE3-epegRNA3 is 21.18%. It can be seen that using PE2-epegRNA3 for PE editing can obtain a higher editing efficiency.

[0032] 7. The positive monoclonal cells edited by PE2-epegRNA3 are picked using the limited dilution method, and the cell DNA is extracted for further culture. PCR amplification is performed using the primers and conditions in Step 2, and Sanger sequencing is used to detect the genotype. The results are as shown in Figure 4 It is shown that an AACA base insertion occurs at 127 bp in the PCR amplification product 152 bp.

[0033] Example 2

[0034] 1. The untreated pig small intestinal epithelial cells and the positive monoclonal cells picked after editing by PE2-epegRNA3 are inoculated in a six-well cell culture plate at a concentration of 1×10 5 Each well is added with 2 mL of DMEM culture medium containing 10% fetal bovine serum FBS and 1% penicillin-streptomycin solution (Beijing Solabio Technology Co., Ltd., P1400) for culture. When the cell confluence reaches 80%, the original culture medium is removed, 2 mL of serum-free DMEM culture medium containing 2 μg / mL trypsin is added, and PEDV with a virus infection multiplicity MOI of 1 is added for culture at 37 °C, 5% CO2 for 24 h, and the virus supernatant is collected. TRIzol and cell lysis solution are used to extract cell RNA and cell protein, respectively.

[0035] 2. The RNA of the cells was extracted by TRIzol method, and the RNA was reversely transcribed into cDNA by using a reverse transcription kit (Novozyme, R323-01), and the effect of the mutation of the genetic variation site on PEDV infection was detected by RT-qPCR. The PEDV-M primers used are as follows: upstream primer: SEQ ID NO. 17: 5'-AGGTCTGCATTCCAGTGCTT-3', downstream primer: SEQ ID NO. 18: 5'-GGACATAGAAAGCCCAACCA-3'. The RT-qPCR reaction system is as follows: 2x AceQ qPCR SYBR Green Master Mix 5 μL, 0.2 μL of upstream and downstream primers respectively, cDNA 1 μL, and enzyme-free water to make up to 10 μL. The amplification program is as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 10 s, 60°C annealing for 30 s, 40 cycles. The results are shown in Table 2. Figure 5 As shown in Fig. 2A, the genome copy number of PEDV after A / AAACA mutation is significantly reduced. Among them, WT is the cell before mutation, and MUT is the cell after mutation.

[0036] 3. The protein sample was determined for protein concentration by BCA method, 5x non-denatured protein loading buffer was added according to the protein concentration, and 98°C heating was performed for 10 min. With 10 μg of protein content as the standard loading amount, polyacrylamide gel electrophoresis was performed. The protein band was transferred to a 0.22 μm polyvinylidene fluoride membrane, and the transfer conditions were 300 mA and 50 min. After blocking with 5% skimmed milk, the primary antibody (PEDV-N, Shanghai Youlong Biological Technology Co., Ltd.; GAPDH, Wuhan Sanyou Biological Technology Co., Ltd., 60004-1-Ig) was incubated at 4°C overnight. The membrane was washed with 1x TBST on a decolorizing shaker for 3 times, each for 10 min. The corresponding mouse secondary antibody (Beijing Kangwei Century Biological Technology Co., Ltd., CW0102S) was incubated at room temperature for 1 h, and the membrane was washed with 1x TBST on a decolorizing shaker for 3 times, each for 10 min. The chemical luminescence was performed by using horseradish peroxidase to catalyze the chemical luminescent substance. The results are shown in Fig. 3. Figure 5 As shown in Fig. 3B, the protein expression level of PEDV after A / AAACA mutation is significantly reduced. Among them, GAPDH is used as an internal reference for protein, indicating that the loading amount concentration is consistent, WT is the cell before mutation, and MUT is the cell after mutation.

[0037] 4. The effect of the mutation of the genetic variation site on the titer of PEDV was detected by TCID 50 The Vero cells were prepared into 96-well monolayer cells, 100 μL per well, and the plating density was not more than 2x10 5mL; the virus liquid was thawed at room temperature, 7 1.5 ml centrifuge tubes were placed on the centrifuge tube rack for each virus liquid sample, 900 μL virus maintenance liquid was added to each centrifuge tube, the thawed virus liquid was shaken and mixed, 100 μL was taken by using a pipette and added to the first centrifuge tube and blown and mixed, and then sequentially diluted to 10 -7 ; the 96-well plate was taken out, the culture liquid was sucked off, washed with PBS, and then 100 μL of virus liquid was added (10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 6 gradients, 6 repeats for each gradient), and then placed in the incubator again, and the lesion condition of each well was observed and recorded daily, and calculated according to the Reed-Muench method. The results are shown in Figure 6 , and the A / AAACA mutation significantly reduced the titer of PEDV.

Claims

1. An epegRNA primer pair for detecting an Indel marker associated with porcine epidemic diarrhea virus resistance, characterized in that, The nucleotide sequence is shown as SEQ ID NO. 9-10; the Indel marker associated with porcine epidemic diarrhea virus resistance is located at ChrX: 56448702 on the pig genome with a base of A or AAACA.

2. A detection reagent or kit containing the epegRNA primer pair of claim 1.

3. The test reagent or kit according to claim 2, wherein The kit further comprises a template DNA, Taq Plus Master Mix II.

4. A method of gene editing to insert an Indel marker associated with porcine epidemic diarrhea virus resistance, comprising, The kit further comprises a template DNA, Taq Plus Master Mix II. The kit further comprises a template DNA, Taq Plus Master Mix II. (1) annealing the epegRNA primer targeting the genetic variation site of claim 1 to form dsDNA; (2) connecting the dsDNA with the linearized pU6-tevopreq1-GG-acceptor vector, transforming the connection product into competent cells, culturing, extracting, and obtaining an epegRNA3 expression plasmid; (3) co-transfecting the epegRNA3 expression plasmid and the lead editor pCMV-PEmax-P2A-BSD into pig small intestinal epithelial cells; using the PE2 editing system for base editing, and the mass ratio of the plasmid epegRNA and pCMV-PEmax-P2A-BSD in the PE2 system is 1:3; 5. The method of claim 4, wherein the gene editing is selected from the group consisting of CRISPR / Cas9, CRISPR / Cpf1, TALEN, and meganucleases. (4) using blasticidin for drug screening, and picking positive clone cells to obtain cells inserted with the Indel marker associated with porcine epidemic diarrhea virus resistance; the Indel marker associated with porcine epidemic diarrhea virus resistance is located at ChrX: 56448702 on the pig genome with a base of AAACA.

6. The method of claim 4, wherein the gene editing is selected from the group consisting of CRISPR / Cas9, CRISPR / Cpf1, TALEN, and meganucleases. The annealing program in step (1) is 95 ℃ for 2 min, and then decreasing by 0.1 ℃ every 8 s to 25 ℃.

7. A method of identifying or selecting pigs having high porcine epidemic diarrhea virus resistance, characterized by, The linearized pU6-tevopreq1-GG-acceptor vector in step (2) is obtained by restriction enzyme digestion of Bsal-HFv2, Ncol-HF, and Pvull-HF. The kit further comprises a template DNA, Taq Plus Master Mix II. (1) extracting the genomic DNA of the pig to be tested; (2) using the genomic DNA of the pig to be tested as a template, and performing PCR amplification reaction using the primer pair shown as SEQ ID NO. 1-2; (3) analyzing the PCR amplification product; when the genotype at position 152 bp of the PCR amplification product is AAACA type, the pig to be tested is a pig with high porcine epidemic diarrhea virus resistance; when the genotype at position 152 bp of the PCR amplification product is A type, the pig to be tested is a pig with low porcine epidemic diarrhea virus resistance.

8. Use of the epegRNA primer pair of claim 1 or the detection reagent or kit of claim 2 or 3 in identifying or selecting pigs with high porcine epidemic diarrhea virus resistance.

9. Use of the epegRNA primer pair of claim 1 or the detection reagent or kit of claim 2 or 3 in early prediction of porcine epidemic diarrhea virus resistance.

10. Use of the epegRNA primer pair of claim 1 or the detection reagent or kit of claim 2 or 3 in molecular marker assisted breeding related to porcine epidemic diarrhea virus resistance.

Images