Formula and application of petroleum hydrocarbon degradation complex microbial inoculant

Abstract

The invention discloses a formula and application of a petroleum hydrocarbon degradation complex microbial inoculant, and relates to the technical field of petroleum processing. The invention creatively embodies that three aspects of a degradation strain screened from petroleum hydrocarbon polluted soil, a petroleum hydrocarbon degradation microbial inoculum for the petroleum hydrocarbon polluted soil and an engineering technology for repairing the petroleum hydrocarbon polluted soil are improved, and the ecological construction method of the multifunctional composite microbial inoculum relates to strain selection, functional collocation and ecological benefit consideration of the strain selection, the functional collocation and the ecological benefit consideration of the multifunctional composite microbial inoculum. Corresponding functional strains need to be selected in combination with the functions of the strains, and the complex microbial inoculant is constructed by applying an ecological analysis method.

Description

Technical Field

[0001] This invention relates to the field of petroleum processing technology, and in particular to a biological extraction method for heavy oil resource extraction or recovery. Background Technology

[0002] Petroleum has high viscosity and adhesion, and is hydrophobic. Therefore, when petroleum leaks into soil, it easily adheres to the soil, clogging soil particles and reducing soil permeability and aeration, altering soil physical properties, and promoting soil salinization and compaction. In petroleum-contaminated soil, petroleum hydrocarbons can also damage plant growth, forming a sticky film on plant roots, reducing root respiration, nutrient transport and absorption, and in severe cases, even causing root rot and plant death. Simultaneously, the sudden increase in organic carbon content in petroleum-contaminated soil can disrupt the soil microbial community structure, destroy the diversity of native microbial populations, and cause significant damage to the soil microenvironment. The main pollutant is a mixture of multiple organic compounds called total petroleum hydrocarbons, including n-alkanes, branched alkanes, cycloalkanes, aromatics, and small amounts of other organic matter. Remediation of petroleum-contaminated soil mainly includes physical, chemical, and biological remediation methods. Physical methods, including using porous materials to absorb and enrich petroleum hydrocarbons to reduce the petroleum hydrocarbon content in soil, are not yet widely used due to high costs and low treatment efficiency. Chemical methods use chemical agents to degrade petroleum hydrocarbon pollutants in contaminated soil; however, this method often results in secondary pollution and unsatisfactory remediation effects. Bioremediation, a more popular petroleum hydrocarbon degradation and remediation technology in recent years, involves introducing microbial agents capable of degrading petroleum hydrocarbons into contaminated soil. The microbial strains utilize their biological characteristics to gradually decompose multi-carbon chain hydrocarbons, which are difficult to degrade naturally, into smaller carbon-containing compounds, thereby reducing petroleum hydrocarbon pollution in the soil. Currently, domestic and international research reports indicate that the main microorganisms capable of degrading petroleum hydrocarbons include: *Pseudomonas*, *Acinetobacter*, *Rhodococcus*, *Actinomyces*, *Rhodotorula*, *Fusarium*, *Chlorella vulgaris*, *Bacillus*, and *Achromatobacteria*. In recent years, research on petroleum hydrocarbon-degrading bacteria has focused on two main themes: surfactant production by the strains and petroleum hydrocarbon degradation efficiency. Biosurfactants are biodegradable surfactants produced by microorganisms, belonging to the secondary metabolites of microorganisms, including glycolipids, polyglycolipids, lipopeptides, or neutral lipid derivatives. Biosurfactants not only possess the common properties of surfactants such as solubilization, emulsification, wetting, foaming, dispersion, and surface tension reduction, but also have advantages over surfactants produced through chemical synthesis or petroleum refining, such as low toxicity, biodegradability, and ecological safety. Biosurfactants can emulsify petroleum into smaller particles, thereby increasing the contact area between petroleum and degrading bacteria and improving petroleum degradation efficiency.Furthermore, thanks to the green and environmentally friendly characteristics of biosurfactants, there is no need to worry about secondary pollution caused by biodegradation methods. Biosurfactants and petroleum hydrocarbon-degrading microbial agents are commonly used remediation materials in current microbial remediation technologies. Compound microbial agent remediation technology: Compound microbial agents are microbial preparations made from two or more non-antagonistic microbial strains. Compared to microbial agents prepared from a single strain, compound microbial agents have a more significant degradation efficiency for petroleum hydrocarbons. Researchers have conducted simulation experiments on petroleum hydrocarbon-contaminated soil using five isolated petroleum-degrading bacteria and their compound microbial agents. Laboratory simulation results and on-site remediation studies show that the petroleum degradation rate of the compound microbial agent treatment group is as high as 84%, significantly higher than that of the single-strain treatment group. Further research shows that the compound microbial agent treatment group is significantly higher than the single-strain treatment group in terms of dehydrogenase activity, soil microbial quantity, and oil reduction rate. Saturated hydrocarbons and aromatic hydrocarbons in petroleum compounds exhibit significant degradation. Most petroleum hydrocarbons contain nonpolar C-C and CH bonds, have relatively low overall molecular weight, strong hydrophobic dispersion interactions between molecules, and low water solubility. Microbial degradation of petroleum mainly occurs at the water-oil interface in soil. Using amphiphilic biosurfactants can reduce the surface tension of oils, emulsify oils, and enhance the hydrophobicity of microbial surfaces. Recent studies have shown that the alk gene cluster encoding alkanemonooxygenases participates in the alkane oxidation metabolic pathway. For example, AlkB1 and AlkB2 are membrane-integrated proteins containing non-heme iron that can bind to Fe2+ and catalyze the oxidation of alkanes to alcohols via electron transfer, thus degrading alkane compounds. PCR analysis of these functional genes can effectively accelerate the screening and identification of petroleum hydrocarbon-degrading bacteria and optimize degradation conditions. Different petroleum hydrocarbon-degrading bacteria have different functions and different preferences for different petroleum hydrocarbon compounds. Using composite strains for the remediation of petroleum hydrocarbon-contaminated soil can produce more efficient synergistic degradation effects. For example, various types of Bacillus can transform and degrade aromatics, alkanes, asphaltenes, as well as organosulfur and organochlorine compounds. Several strains of Pseudomonas, such as *Pseudomonas aeruginosa* and *Pseudomonas fluorescens*, can secrete various biosurfactants, including rhamnolipids and mannose erythritol esters, which can emulsify and degrade petroleum pollutants. Facultative anaerobic cocci can produce extracellular proteases capable of decomposing polycyclic aromatic hydrocarbons in vitro through their own secretory systems. When the other two types of aerobic bacteria are used in combination, a better remediation effect can be achieved.

[0003] Therefore, using compound microbial agents for the remediation of petroleum-contaminated soil often yields better remediation results. However, inhibitory effects can exist between different bacterial strains. Therefore, the interactions and ecological effects between strains need to be considered when constructing compound microbial agents to achieve the best degradation and remediation effect. This technology proposes an ecological construction method for compound microbial agents that can efficiently degrade petroleum pollutants in soil and oil sludge. The method was validated under laboratory simulation conditions and in field engineering cases, achieving significant petroleum removal effects. Summary of the Invention

[0004] In view of this, the purpose of this invention is to propose a formulation and application of a petroleum hydrocarbon degradation compound microbial agent. Improvements are made in three aspects: degrading strains screened from petroleum hydrocarbon-contaminated soil, petroleum hydrocarbon degradation microbial agents specifically for petroleum hydrocarbon-contaminated soil, and engineering technologies for remediating petroleum hydrocarbon-contaminated soil. The ecological construction method of the multifunctional compound microbial agent involves strain selection, functional matching, and consideration of its ecological benefits. It is necessary to select corresponding functional strains based on their functions and construct the compound microbial agent using ecological analysis methods.

[0005] To achieve the above objectives, the specific technical solution is as follows:

[0006] Petroleum hydrocarbons: a mixture of various hydrocarbons (n-alkanes, branched alkanes, cycloalkanes, aromatics) and small amounts of other organic compounds, such as sulfides, nitrides, cycloalkanoates, etc. In this technology, it specifically refers to C10-C40 petroleum hydrocarbons.

[0007] Microbial remediation: a remediation technology that utilizes native or artificially domesticated exogenous microorganisms with specific functions to reduce the activity of harmful pollutants in soil or degrade them into harmless substances through microbial action in a suitable environment created by artificial measures.

[0008] Petroleum hydrocarbon degrading microorganisms: refers to microorganisms capable of degrading petroleum hydrocarbons (C6H2O). 10 -C 40 Functional microorganisms, mostly bacteria.

[0009] Compound microbial agents: Microbial preparations made from two or more non-antagonistic microbial strains. These agents generally have the advantages of being comprehensive in variety, rationally formulated, highly functional, and economically efficient.

[0010] A formulation for a petroleum hydrocarbon degradation compound microbial agent,

[0011] Based on parts by weight, it comprises the following components:

[0012] 5-10 samples of Pseudomonas aeruginosa;

[0013] 5-10 parts of Bacillus subtilis;

[0014] 10-20 parts rhamnolipid solution;

[0015] The rhamnolipin solution contains 0.1%-1.0% by mass.

[0016] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0017] Based on parts by weight, it comprises the following components:

[0018] 6-8 samples of Pseudomonas aeruginosa;

[0019] 6-8 parts of Bacillus subtilis;

[0020] 12-16 parts of rhamnolipid solution;

[0021] The rhamnolipin solution contains 0.3%-0.7% by mass.

[0022] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0023] Based on parts by weight, it comprises the following components:

[0024] Seven samples of Pseudomonas aeruginosa;

[0025] 7 samples of Bacillus subtilis;

[0026] 15 parts of rhamnolipid solution;

[0027] The rhamnolipin solution contains 0.5% by mass.

[0028] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0029] The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa*, and its formulation is a fermentation broth with a concentration of OD0.05. 600 =2.0;

[0030] The Bacillus subtilis mentioned is in the form of a fermentation broth with a concentration of OD0.05. 600 =2.0.

[0031] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0032] The preparation method of the rhamnolipid solution is as follows:

[0033] Includes the following steps:

[0034] (1) Flocculation and sedimentation solid-liquid separation: After the rhamnolipin fermentation production is completed, the pH value of the rhamnolipin fermentation broth is adjusted, and flocculant is added and stirred evenly. Then, flocculation and sedimentation treatment is carried out, and finally, the broth is filtered to separate the solid and liquid and obtain the separated liquid.

[0035] (2) Decolorization: Activated carbon is added to the separated liquid after solid-liquid separation in step (1) to obtain a decolorized liquid. The temperature and pH value of the decolorized liquid are controlled, and finally decolorization is performed to obtain a solution.

[0036] (3) Clarification: The solution after decolorization in step (2) is clarified by using a filter membrane to obtain the finished product.

[0037] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0038] The pH range of the rhamnolipin fermentation broth described in step (1) is 7.9-8.2;

[0039] The flocculant mentioned in step (1) is a mixture of diatomaceous earth, sodium bentonite, and polyaluminum sulfate, with a mass ratio of (1-4):(7-10):(2-8).

[0040] The concentration range of the flocculant mentioned in step (1) is 100 pm-1000 ppm;

[0041] The temperature range for the flocculation and sedimentation treatment of the flocculant mentioned in step (1) is 55℃-65℃;

[0042] The flocculation and sedimentation treatment time of the flocculant mentioned in step (1) is 6h-8h;

[0043] The filtration equipment mentioned in step (1) is a plate and frame filter press, wherein the pore size range of the plate and frame filter press is 800 mesh-1000 mesh.

[0044] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0045] The weight-to-volume ratio of the activated carbon in step (2) to the separated liquid after solid-liquid separation in step (1) is in the range of 0.8%-1.6%.

[0046] The activated carbon mentioned in step (2) is ammonia-modified activated carbon, and its preparation method is as follows:

[0047] Heat a 33% (w / w) ammonia solution to 55°C, immerse activated carbon in the ammonia solution for 3 hours, and then dry it at a low temperature after immersion.

[0048] The temperature range of the decolorizing solution mentioned in step (2) is 68℃-80℃;

[0049] The pH range of the decolorizing solution described in step (2) is 6.5-7.5;

[0050] The decolorization process described in step (2) takes 1-2 hours.

[0051] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0052] The filter membrane mentioned in step (3) is a hydrophilic polypropylene filter membrane;

[0053] The pore size range of the filter membrane mentioned in step (3) is 0.05μm-0.2μm;

[0054] The temperature range for the clarification treatment described in step (3) is 45℃-55℃;

[0055] The pH value of the clarification treatment described in step (3) is adjusted within the range of 4.5-5.5.

[0056] A formulation of a petroleum hydrocarbon degradation compound microbial agent is applied in the degradation of petroleum hydrocarbons.

[0057] The formulation and application of the petroleum hydrocarbon degradation compound microbial agent provided by the above technical solution have the following beneficial effects:

[0058] Existing methods include: Thermal treatment / incineration: Requires specialized equipment, high energy consumption, low calorific value, high cost, and carries the risk of resource waste and secondary pollution. Isolation / landfill: Treats the symptoms but not the root cause, does not eradicate pollutants, and carries the risk of pollution spread. Chemical treatment: Requires specialized chemical equipment, consumes huge amounts of chemical agents, is incomplete, fails to meet standards, and generates large amounts of waste residue and oily wastewater, easily causing secondary pollution. Compound microbial agent remediation technology: Simple to operate, low cost, low energy consumption, resource recycling, and can achieve harmless and thorough treatment. The technology is green and environmentally friendly, with no secondary pollution. It is the most promising remediation technology.

[0059] In this application, the ecological construction method of the multifunctional compound microbial agent involves the selection of strains, functional matching, and consideration of ecological benefits. It requires selecting corresponding functional strains based on their functions and constructing the compound microbial agent using ecological analysis methods. The dosage and ratio of each component in the culture medium are optimized schemes explored through multiple different formulations, which can effectively reduce the antagonistic effects between different strains and greatly enhance the synergistic degradation effect of different petroleum hydrocarbon degrading bacteria. The compound microbial agent has a degradation and removal efficiency of up to 90% for pollutants in stubborn oil sludge. In practical applications, it is simple to operate, time-saving, fast-acting, and low-cost, making it suitable for the remediation of various types of petroleum pollution. In-situ remediation can be achieved in contaminated soil without the need to relocate the contaminated soil for centralized treatment, avoiding the risk of further pollution such as oil spills during the transfer process. The strains used in this invention are fast-growing aerobic strains that grow rapidly in novel liquid culture media, saving time in large-scale cultivation; maximum concentration can be reached in just one or two days. Furthermore, there is almost no antagonistic or inhibitory effect between different strains, maximizing the degradation efficiency of the compound microbial agent. The three bacterial strains of this invention exhibit different preferences for various petroleum hydrocarbons, effectively degrading petroleum hydrocarbons with different carbon chains and converting them into nutrients for soil microorganisms and even plants. This promotes the diversity and stability of the soil ecological environment, maximizing ecological benefits. Furthermore, the compound bacterial agent is low-cost and easy to operate. Simply mix the different bacterial agents from the expanded culture with a demulsifier—rhamnolipid—in a certain proportion to create a compound bacterial agent that can degrade petroleum hydrocarbons. All the formulations are biodegradable compounds, eliminating the risk of secondary pollution. Within 25-35 days, only periodic turning and aeration are needed to ensure the strains degrade petroleum hydrocarbon pollutants under aerobic conditions, achieving harmless bioremediation. Compared to physical heating and chemical reagent methods, this invention has a shorter cycle, faster results, lower cost, and wider applicability. Especially for soils long-term contaminated with petroleum hydrocarbons and petroleum sludge that is difficult to eradicate using physical / chemical methods, the oil removal rate is over 95%, ultimately achieving in-situ remediation. Meanwhile, the basic provisions of the "Technical Specification for Microbial Remediation of Chemically Contaminated Soil HG / T 20719-2021" specify that for remediation projects, microbial methods should be selected if the degradation rate of organic pollutants by microorganisms reaches more than 50% within one month during the feasibility verification process. Judging from the application effect of this technology, the composite microbial agent for the efficient degradation of petroleum hydrocarbons can achieve this standard in a short period. Furthermore, the microbial agent is screened from pristine soil, and NS-01 and NS-03 will not have harmful effects on human and animal health, nor will they pose any potential secondary pollution hazard to the environment. Therefore, this technology is the most suitable for the current situation regarding petroleum hydrocarbon (C) degradation. 10 -C 40 Remediation technologies for contaminated sites. Attached Figure Description

[0060] Figure 1This is a diagram of the bacterial strains screened from petroleum hydrocarbon-contaminated soil in this invention;

[0061] Figure 2 This is a PCR verification diagram of the functional genes (alkB1 and alkB2) of NS-01, NS-02, NS-03 and NS-04 in this invention;

[0062] Figure 3 This is a 16S rDNA PCR amplification diagram of NS-01 and NS-03 in this invention;

[0063] Figure 4 This is a diagram showing the soil petroleum hydrocarbon content in this invention;

[0064] Figure 5 The graph shows the petroleum hydrocarbon removal rates of NS-01 and NS-03 on the original soil DT-1 and DT-2 in this invention.

[0065] Figure 6 This is a flowchart illustrating the preparation process of the compound microbial agent in this invention.

[0066] Figure 7 This is a diagram showing the layout of sampling points in this invention;

[0067] Figure 8 This is a flowchart of the repair technology in this invention. Detailed Implementation

[0068] The present invention will be described in detail below through specific embodiments. However, the uses and purposes of these exemplary embodiments are only for illustrating the present invention and do not constitute any limitation on the actual protection scope of the present invention, nor are they intended to limit the protection scope of the present invention to this.

[0069] Unless otherwise specified, all percentages used in the formulations of the following examples are by weight.

[0070] In addition, the following prior art is also a major reference in the design of this application, in order to better improve this patent.

[0071] Wei Yang. Analysis of the hazards and current status of soil petroleum pollution [J]. China Resources Comprehensive Utilization, 2020, 38(4):120-122.

[0072] Hui Yunfang, Wang Hongfei. Research progress on bioremediation of petroleum-contaminated soil [J]. Northwest Agriculture Journal, 2018, 27(4):451-458.

[0073] Chen Li, Wan Li, Zhang Fawang, et al. Experimental study on in-situ remediation of petroleum-contaminated soil by indigenous microorganisms [J]. Journal of Ecology and Environment, 2010, 19(7):1686-1690.

[0074] Luo Xiaofang, Chen Lihua, Wang Dongmei, Li Yingjuan, Ma Li. Remediation of petroleum-contaminated soil by compound microbial agents [J]. Journal of Ecology, 2013, 32(09):2433-2438.

[0075] Li Yan, Li Hong, Wang Fan, Qu Chengtun. Construction of efficient petroleum-degrading bacteria and study on their salt tolerance [J]. Modern Chemical Industry, 2021, 41(05):114-119.

[0076] Wang Weiqiang, Wu Shangshu, Cui Jing, Bao Tianyu, Zhang Haijuan, Zhang Zhengyi. Dewaxing and viscosity-reducing properties of Pseudomonas aeruginosa in crude oil [J]. Acta Petrolei Sinica (Petroleum Processing), 2021, 37(01):168-175.

[0077] Lu Guoman, Liu Hongyu, Zeng Guangming, et al. Screening and optimization of fermentation conditions for biosurfactant-producing fungus Absidia orchidis [J]. Journal of Environmental Science, 2006(9): 1426-1432.

[0078] van Beilen J B.,Wubbolts M G.,Witholt B.Genetics of alkane oxidation by Pseudomonas oleovorans[J].Biodegradation.1994,5:161-174.

[0079] The following are similar inventions:

[0080] Hu Xiaoke, Chen Weiwei, Li Junde. Invention Patent: A Highly Efficient Marine Petroleum Degrading Composite Bacterial Agent and Its Preparation Method and Application. 201910614569.X;

[0081] Bao Hongxu, Jiang Dazhan, Wang Litao, et al., Invention Patent: A method for the combined remediation of petroleum-contaminated soil using plant-bacteria-fungi-rhamnolipid combination. 202010371166.X.

[0082] It should be noted that the screening and identification process for Pseudomonas aeruginosa and Bacillus is as follows:

[0083] like Figure 1As shown, soil samples DT-1 and DT-2 were collected from petroleum hydrocarbon contaminated sites and serially diluted with sterile water. 100 μL of each of the 10⁴ and 10⁵ dilutions was plated onto nutrient agar to enrich dominant bacteria. Four morphologically distinct single colonies were selected from the resulting colonies for streak purification. After four streak purifications, four morphologically different bacterial strains were obtained and named NS-01, NS-02, NS-03, and NS-04. Single colonies were inoculated into sterile LB medium (each 1 L of medium contains 10.0 g peptone, 5.0 g yeast extract, 10.0 g sodium chloride, pH = 7.0), and the genome was extracted. Specific primers were used to amplify the petroleum hydrocarbon degradation functional gene (alkane monooxygenase) for PCR verification of the functional genes alkB1 and alkB2. The functional genes alkB1 and alkB2 were detected in both the NS-01 and NS-03 genomes (e.g., ...). Figure 2 and Figure 3 (As shown). The 16S rDNA of these two bacterial strains was amplified and sequenced for comparison using universal primers 27F (5'AGAGTTTGATCCTGGCTCAG3') and 1492R (5'TACGGCTACCTTGTTACGACTT3'). NS-01 was identified as Pseudomonas aeruginosa, and NS-03 as Bacillus subtilis.

[0084] PCR system and procedure for functional genes alkB1 and alkB2:

[0085] PCR system: PCR procedure:

[0086]

[0087] PCR system and procedure for 16S rDNA:

[0088] PCR system: PCR procedure:

[0089]

[0090] Example 1

[0091] The formulation of a petroleum hydrocarbon degradation compound microbial agent.

[0092] Based on parts by weight, it comprises the following components:

[0093] Five samples of Pseudomonas aeruginosa;

[0094] 10 samples of Bacillus subtilis;

[0095] 10 parts of rhamnolipid solution;

[0096] The rhamnolipin solution contains 0.1% by mass.

[0097] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0098] The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa*, and its formulation is a fermentation broth with a concentration of OD0.05. 600 =2.0;

[0099] The Bacillus subtilis mentioned is in the form of a fermentation broth with a concentration of OD0.05. 600 =2.0.

[0100] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0101] The preparation method of the rhamnolipid solution is as follows:

[0102] Includes the following steps:

[0103] (1) Flocculation and sedimentation solid-liquid separation: After the rhamnolipin fermentation production is completed, the pH value of the rhamnolipin fermentation broth is adjusted, and flocculant is added and stirred evenly. Then, flocculation and sedimentation treatment is carried out, and finally, the broth is filtered to separate the solid and liquid and obtain the separated liquid.

[0104] (2) Decolorization: Activated carbon is added to the separated liquid after solid-liquid separation in step (1) to obtain a decolorized liquid. The temperature and pH value of the decolorized liquid are controlled, and finally decolorization is performed to obtain a solution.

[0105] (3) Clarification: The solution after decolorization in step (2) is clarified by using a filter membrane to obtain the finished product.

[0106] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0107] The pH of the rhamnolipin fermentation broth described in step (1) was adjusted to 7.9;

[0108] The flocculant mentioned in step (1) is a mixture of diatomaceous earth, sodium bentonite, and polyaluminum sulfate, with a mass ratio of 1:10:2.

[0109] The concentration of the flocculant mentioned in step (1) is 100 pm;

[0110] The temperature for flocculation and sedimentation treatment of the flocculant mentioned in step (1) is 55℃;

[0111] The flocculation and sedimentation treatment time of the flocculant mentioned in step (1) is 6 hours;

[0112] The filtration equipment mentioned in step (1) is a plate and frame filter press, wherein the pore size of the plate and frame filter press is 800 mesh.

[0113] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0114] The weight-to-volume ratio of the activated carbon in step (2) to the separated liquid after solid-liquid separation in step (1) is 0.8%.

[0115] The activated carbon mentioned in step (2) is ammonia-modified activated carbon, and its preparation method is as follows:

[0116] Heat a 33% (w / w) ammonia solution to 55°C, immerse activated carbon in the ammonia solution for 3 hours, and then dry it at a low temperature after immersion.

[0117] The temperature of the decolorizing solution mentioned in step (2) is 68°C;

[0118] The pH value of the decolorizing solution described in step (2) is adjusted to 6.5;

[0119] The decolorization process described in step (2) takes 1 hour.

[0120] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0121] The filter membrane mentioned in step (3) is a hydrophilic polypropylene filter membrane;

[0122] The pore size of the filter membrane mentioned in step (3) is 0.05 μm;

[0123] The clarification process described in step (3) is carried out at a temperature of 45°C.

[0124] The pH value of the clarification treatment described in step (3) is adjusted to 4.5.

[0125] Example 2

[0126] The formulation of a petroleum hydrocarbon degradation compound microbial agent.

[0127] Based on parts by weight, it comprises the following components:

[0128] 10 samples of Pseudomonas aeruginosa;

[0129] 5 samples of Bacillus subtilis;

[0130] 20 parts of rhamnolipid solution;

[0131] The rhamnolipin solution contains 0.1% by mass.

[0132] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0133] The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa*, and its formulation is a fermentation broth with a concentration of OD0.05. 600 =2.0;

[0134] The Bacillus subtilis mentioned is in the form of a fermentation broth with a concentration of OD0.05. 600 =2.0.

[0135] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0136] The preparation method of the rhamnolipid solution is as follows:

[0137] Includes the following steps:

[0138] (1) Flocculation and sedimentation solid-liquid separation: After the rhamnolipin fermentation production is completed, the pH value of the rhamnolipin fermentation broth is adjusted, and flocculant is added and stirred evenly. Then, flocculation and sedimentation treatment is carried out, and finally, the broth is filtered to separate the solid and liquid and obtain the separated liquid.

[0139] (2) Decolorization: Activated carbon is added to the separated liquid after solid-liquid separation in step (1) to obtain a decolorized liquid. The temperature and pH value of the decolorized liquid are controlled, and finally decolorization is performed to obtain a solution.

[0140] (3) Clarification: The solution after decolorization in step (2) is clarified by using a filter membrane to obtain the finished product.

[0141] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0142] The pH of the rhamnolipin fermentation broth described in step (1) was adjusted to 8.2;

[0143] The flocculant mentioned in step (1) is a mixture of diatomaceous earth, sodium bentonite, and polyaluminum sulfate, with a mass ratio of 4:7:8.

[0144] The concentration of the flocculant mentioned in step (1) is 1000 ppm;

[0145] The temperature for flocculation and sedimentation treatment of the flocculant mentioned in step (1) is 65℃;

[0146] The flocculation and sedimentation treatment time of the flocculant mentioned in step (1) is 8 hours;

[0147] The filtration equipment mentioned in step (1) is a plate and frame filter press, wherein the pore size of the plate and frame filter press is 1000 mesh.

[0148] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0149] The weight-to-volume ratio of the activated carbon in step (2) to the separated liquid after solid-liquid separation in step (1) is 1.6%.

[0150] The activated carbon mentioned in step (2) is ammonia-modified activated carbon, and its preparation method is as follows:

[0151] Heat a 33% (w / w) ammonia solution to 55°C, immerse activated carbon in the ammonia solution for 3 hours, and then dry it at a low temperature after immersion.

[0152] The temperature of the decolorizing solution mentioned in step (2) is 80°C;

[0153] The pH value of the decolorizing solution described in step (2) is adjusted to 7.5;

[0154] The decolorization process described in step (2) takes 2 hours.

[0155] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0156] The filter membrane mentioned in step (3) is a hydrophilic polypropylene filter membrane;

[0157] The pore size of the filter membrane mentioned in step (3) is 0.2 μm;

[0158] The clarification process described in step (3) is carried out at a temperature of 55°C.

[0159] The pH value of the clarification treatment described in step (3) is adjusted to 5.5.

[0160] Example 3

[0161] The formulation of a petroleum hydrocarbon degradation compound microbial agent.

[0162] Based on parts by weight, it comprises the following components:

[0163] Six samples of Pseudomonas aeruginosa;

[0164] 8 samples of Bacillus subtilis;

[0165] 12 parts of rhamnolipid solution;

[0166] The rhamnolipin solution contains 0.7% by mass.

[0167] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0168] The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa*, and its formulation is a fermentation broth with a concentration of OD0.05. 600 =2.0;

[0169] The Bacillus subtilis mentioned is in the form of a fermentation broth with a concentration of OD0.05. 600 =2.0.

[0170] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0171] The preparation method of the rhamnolipid solution is as follows:

[0172] Includes the following steps:

[0173] (1) Flocculation and sedimentation solid-liquid separation: After the rhamnolipin fermentation production is completed, the pH value of the rhamnolipin fermentation broth is adjusted, and flocculant is added and stirred evenly. Then, flocculation and sedimentation treatment is carried out, and finally, the broth is filtered to separate the solid and liquid and obtain the separated liquid.

[0174] (2) Decolorization: Activated carbon is added to the separated liquid after solid-liquid separation in step (1) to obtain a decolorized liquid. The temperature and pH value of the decolorized liquid are controlled, and finally decolorization is performed to obtain a solution.

[0175] (3) Clarification: The solution after decolorization in step (2) is clarified by using a filter membrane to obtain the finished product.

[0176] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0177] The pH of the rhamnolipin fermentation broth described in step (1) was adjusted to 7.9;

[0178] The flocculant mentioned in step (1) is a mixture of diatomaceous earth, sodium bentonite, and polyaluminum sulfate, with a mass ratio of 1:10:2.

[0179] The concentration of the flocculant mentioned in step (1) is 100 pm;

[0180] The temperature for flocculation and sedimentation treatment of the flocculant mentioned in step (1) is 55℃;

[0181] The flocculation and sedimentation treatment time of the flocculant mentioned in step (1) is 6 hours;

[0182] The filtration equipment mentioned in step (1) is a plate and frame filter press, wherein the pore size of the plate and frame filter press is 800 mesh.

[0183] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0184] The weight-to-volume ratio of the activated carbon in step (2) to the separated liquid after solid-liquid separation in step (1) is 0.8%.

[0185] The activated carbon mentioned in step (2) is ammonia-modified activated carbon, and its preparation method is as follows:

[0186] Heat a 33% (w / w) ammonia solution to 55°C, immerse activated carbon in the ammonia solution for 3 hours, and then dry it at a low temperature after immersion.

[0187] The temperature of the decolorizing solution mentioned in step (2) is 68°C;

[0188] The pH value of the decolorizing solution described in step (2) is adjusted to 6.5;

[0189] The decolorization process described in step (2) takes 1 hour.

[0190] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0191] The filter membrane mentioned in step (3) is a hydrophilic polypropylene filter membrane;

[0192] The pore size of the filter membrane mentioned in step (3) is 0.05 μm;

[0193] The clarification process described in step (3) is carried out at a temperature of 45°C.

[0194] The pH value of the clarification treatment described in step (3) is adjusted to 4.5.

[0195] Example 4

[0196] The formulation of a petroleum hydrocarbon degradation compound microbial agent.

[0197] Based on parts by weight, it comprises the following components:

[0198] Eight samples of Pseudomonas aeruginosa;

[0199] 6 samples of Bacillus subtilis;

[0200] 16 parts of rhamnolipid solution;

[0201] The rhamnolipin solution has a mass percentage of 0.3%.

[0202] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0203] The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa*, and its formulation is a fermentation broth with a concentration of OD0.05. 600 =2.0;

[0204] The Bacillus subtilis mentioned is in the form of a fermentation broth with a concentration of OD0.05. 600 =2.0.

[0205] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0206] The preparation method of the rhamnolipid solution is as follows:

[0207] Includes the following steps:

[0208] (1) Flocculation and sedimentation solid-liquid separation: After the rhamnolipin fermentation production is completed, the pH value of the rhamnolipin fermentation broth is adjusted, and flocculant is added and stirred evenly. Then, flocculation and sedimentation treatment is carried out, and finally, the broth is filtered to separate the solid and liquid and obtain the separated liquid.

[0209] (2) Decolorization: Activated carbon is added to the separated liquid after solid-liquid separation in step (1) to obtain a decolorized liquid. The temperature and pH value of the decolorized liquid are controlled, and finally decolorization is performed to obtain a solution.

[0210] (3) Clarification: The solution after decolorization in step (2) is clarified by using a filter membrane to obtain the finished product.

[0211] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0212] The pH of the rhamnolipin fermentation broth described in step (1) was adjusted to 8.2;

[0213] The flocculant mentioned in step (1) is a mixture of diatomaceous earth, sodium bentonite, and polyaluminum sulfate, with a mass ratio of 4:7:8.

[0214] The concentration of the flocculant mentioned in step (1) is 1000 ppm;

[0215] The temperature for flocculation and sedimentation treatment of the flocculant mentioned in step (1) is 65℃;

[0216] The flocculation and sedimentation treatment time of the flocculant mentioned in step (1) is 8 hours;

[0217] The filtration equipment mentioned in step (1) is a plate and frame filter press, wherein the pore size of the plate and frame filter press is 1000 mesh.

[0218] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0219] The weight-to-volume ratio of the activated carbon in step (2) to the separated liquid after solid-liquid separation in step (1) is 1.6%.

[0220] The activated carbon mentioned in step (2) is ammonia-modified activated carbon, and its preparation method is as follows:

[0221] Heat a 33% (w / w) ammonia solution to 55°C, immerse activated carbon in the ammonia solution for 3 hours, and then dry it at a low temperature after immersion.

[0222] The temperature of the decolorizing solution mentioned in step (2) is 80°C;

[0223] The pH value of the decolorizing solution described in step (2) is adjusted to 7.5;

[0224] The decolorization process described in step (2) takes 2 hours.

[0225] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0226] The filter membrane mentioned in step (3) is a hydrophilic polypropylene filter membrane;

[0227] The pore size of the filter membrane mentioned in step (3) is 0.2 μm;

[0228] The clarification process described in step (3) is carried out at a temperature of 55°C.

[0229] The pH value of the clarification treatment described in step (3) is adjusted to 5.5.

[0230] Example 5

[0231] The formulation of a petroleum hydrocarbon degradation compound microbial agent.

[0232] Based on parts by weight, it comprises the following components:

[0233] Seven samples of Pseudomonas aeruginosa;

[0234] 7 samples of Bacillus subtilis;

[0235] 15 parts of rhamnolipid solution;

[0236] The rhamnolipin solution contains 0.5% by mass.

[0237] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0238] The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa*, and its formulation is a fermentation broth with a concentration of OD0.05. 600 =2.0;

[0239] The Bacillus subtilis mentioned is in the form of a fermentation broth with a concentration of OD0.05. 600 =2.0.

[0240] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0241] The preparation method of the rhamnolipid solution is as follows:

[0242] Includes the following steps:

[0243] (1) Flocculation and sedimentation solid-liquid separation: After the rhamnolipin fermentation production is completed, the pH value of the rhamnolipin fermentation broth is adjusted, and flocculant is added and stirred evenly. Then, flocculation and sedimentation treatment is carried out, and finally, the broth is filtered to separate the solid and liquid and obtain the separated liquid.

[0244] (2) Decolorization: Activated carbon is added to the separated liquid after solid-liquid separation in step (1) to obtain a decolorized liquid. The temperature and pH value of the decolorized liquid are controlled, and finally decolorization is performed to obtain a solution.

[0245] (3) Clarification: The solution after decolorization in step (2) is clarified by using a filter membrane to obtain the finished product.

[0246] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0247] The pH of the rhamnolipin fermentation broth described in step (1) was adjusted to 8.2;

[0248] The flocculant mentioned in step (1) is a mixture of diatomaceous earth, sodium bentonite, and polyaluminum sulfate, with a mass ratio of 2:9:7.

[0249] The concentration of the flocculant mentioned in step (1) is 1000 ppm;

[0250] The temperature for flocculation and sedimentation treatment of the flocculant mentioned in step (1) is 65℃;

[0251] The flocculation and sedimentation treatment time of the flocculant mentioned in step (1) is 6 hours;

[0252] The filtration equipment mentioned in step (1) is a plate and frame filter press, wherein the pore size of the plate and frame filter press is 1000 mesh.

[0253] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0254] The weight-to-volume ratio of the activated carbon in step (2) to the separated liquid after solid-liquid separation in step (1) is 1.6%.

[0255] The activated carbon mentioned in step (2) is ammonia-modified activated carbon, and its preparation method is as follows:

[0256] Heat a 33% (w / w) ammonia solution to 55°C, immerse activated carbon in the ammonia solution for 3 hours, and then dry it at a low temperature after immersion.

[0257] The temperature of the decolorizing solution mentioned in step (2) is 70°C;

[0258] The pH value of the decolorizing solution described in step (2) is adjusted to 7.5;

[0259] The decolorization process described in step (2) takes 1.5 hours.

[0260] The above-mentioned formula for the petroleum hydrocarbon degradation compound microbial agent,

[0261] The filter membrane mentioned in step (3) is a hydrophilic polypropylene filter membrane;

[0262] The pore size of the filter membrane mentioned in step (3) is 0.2 μm;

[0263] The clarification process described in step (3) is carried out at a temperature of 50°C.

[0264] The pH value of the clarification treatment described in step (3) is adjusted to 5.

[0265] The products prepared in Examples 1-5 had rhamnolipin purities of 92.2%, 92.4%, 92.9%, 93.7%, and 94.1%, respectively. However, in the absence of flocculant or activated carbon, the purity decreased by 12.6% and 22.7%, respectively.

[0266] Application Examples

[0267] Taking the product prepared in Example 5 as an example,

[0268] Indoor simulation restoration:

[0269] Simulated Repair Experiment 1:

[0270] Soil samples were collected from undisturbed plots, air-dried, and sieved through a 20-mesh sieve. 1000g of soil samples were weighed into 20cm x 20cm plastic containers. 10.0g of crude oil was accurately weighed and dissolved in 100mL of petroleum ether. The diluted solution was thoroughly mixed with the soil and air-dried in a fume hood until no petroleum ether residue remained, simulating petroleum-contaminated soil (petroleum hydrocarbon concentration 10,000mg / kg air-dried soil). Fermented bacterial solution (OD600 = 2.0) was mixed with 0.5% rhamnolipin solution at a 1:1 (v / v) ratio. 100mL of the mixture was added to each sample, and the soil was tilled twice daily. Samples were taken every 7 days, approximately 10g each time. Five samples were taken from each container, with 10.0g of soil collected from each sample point. The soil samples from the five points were thoroughly mixed, and the petroleum concentration in the samples was measured.

[0271] Extraction and quantitative analysis of petroleum hydrocarbons in soil: 10g sample was placed in a ground-glass stoppered bottle, 23mL of dichloromethane and 2mL of methanol were added, and the mixture was stirred thoroughly. Extraction was then performed in an ultrasonic cleaner. The ultrasonic power was 100% and the ultrasonic time was 15min. The supernatant was collected. Another 23mL of dichloromethane and 2mL of methanol were added to the sample for repeated extraction. The supernatants from both extractions were combined and concentrated to 1mL by rotary evaporation (or nitrogen blowing). The magnesium silicate column was then activated with 10mL of n-hexane-dichloromethane mixed solvent and 10mL of n-hexane. When the n-hexane on the column was nearly dry, the concentrate was transferred to the purification column. The eluent was collected, and the eluent was washed with approximately 2mL of n-hexane. The eluent was then transferred to the purification column, and the column was rinsed with 12mL of n-hexane. The eluent was collected and combined with the eluent, then concentrated to 1.0mL. The sample was stored at -20℃ for later analysis. A certain amount of sample was taken and the petroleum hydrocarbon content in the sample was determined by GC. The detection method was based on HJ 1021-2019 "Determination of Petroleum Hydrocarbons (C10-C40) in Soils and Sediments by Gas Chromatography". The initial content of petroleum hydrocarbons (C10-C40) in the soil of the basin was 10,000 mg / kg.

[0272] like Figure 4 As shown, three treatments were set up: a blank control group (CK) without bacterial treatment, and three soil samples with bacterial agents NS-01 and NS-03, with three soil samples in each treatment. The results showed that compared with the CK, the petroleum hydrocarbon content in the soil of the NS-01 and NS-03 treatment groups was significantly reduced, indicating that these two strains of bacteria have the ability to degrade petroleum hydrocarbons.

[0273] Simulated Repair Experiment 2:

[0274] Soil contaminated with petroleum hydrocarbons was collected from plots DT-1 and DT-2 to be remediated. After passing through a 20-mesh sieve, 1000g of soil was weighed into 20cm×20cm plastic containers. The fermented bacterial solution (OD600 = 2.0) was mixed with a 0.5% rhamnolipin solution at a ratio of 1:1 (v / v). 100mL of the mixture was added to each sample, and the soil was tilled twice daily. Samples were taken every 7 days, approximately 10g each time. Five samples were taken from each container, with 10.0g of soil collected from each sample point. The soil samples from the five points were thoroughly mixed, and the petroleum hydrocarbon concentration was measured using the same method as above. The petroleum hydrocarbon (C10-C40) content in the DT-1 soil was 17100mg / kg, and the petroleum hydrocarbon (C10-C40) content in the DT-2 soil was 8030mg / kg. Three pots of soil were set up for each treatment: a blank control group (CK) without bacteria, a bacterial agent group (NS-01), a bacterial agent group (NS-03), and a compound bacterial agent group.

[0275] like Figure 5As shown, the results indicate that after 4 weeks, the removal rates of petroleum hydrocarbons in soil samples DT-1 and DT-2 were: CK > NS-03 > NS-01 > compound microbial agent, with the compound microbial agent exhibiting the best degradation effect. Based on the simulation experiment results, when treating petroleum hydrocarbon-contaminated soil with the compound microbial agent, an additional spraying of the bacterial solution should be performed every two weeks. Furthermore, since both strains are aerobic, the frequency of soil aeration needs to be increased to ensure the propagation of both strains in the soil and their degradation of petroleum hydrocarbons.

[0276] It should be noted that the preparation and scale-up culture of the compound microbial agent seed liquid are as follows: Preparation of Microbial Seed Liquid 1: Two strains, NS-01 and NS-03, were transferred from glycerol tubes to nutrient agar plates for activation and cultured at 27℃ for 12-24 hours. Then, single colonies were picked and inoculated into 100mL LB medium and cultured in a shaker at 27℃ for 24 hours. Subsequently, 100mL of the bacterial solution was transferred to a fermenter containing 10L of medium for further culture. After 24 hours, the preparation of Seed Liquid 2 was completed. Microbial Scale-up Culture 2: Formula for scale-up culture of the microbial agent (per 1000L) – 10kg peptone, 5kg yeast powder, 10kg sodium chloride, trace elements (400g magnesium sulfate heptahydrate, 10g anhydrous calcium chloride, 72g ferrous sulfate heptahydrate, 12g zinc sulfate heptahydrate, 12g manganese sulfate dihydrate), 10L soybean oil. During preparation, first add water to 500L, then add the ingredients according to the calculated ratio, and add appropriate amounts of defoamer and activator according to the specific fermentation conditions. After stirring evenly, add water to 1000L. After inoculating with 10L of newly cultured seed liquid, aerate and stir, and continue culturing for 18-24 hours (pH > 6.8), not exceeding 72 hours. Each time the agent is sprayed, leave approximately 50L of inoculum at the bottom of the tank for the next inoculum expansion and strain testing. Both strains NS-01 and NS-03 were prepared and scaled up using the same culture medium and method. Microbial seed liquid refers to the primary high-activity liquid culture obtained by activating preserved strains and then inoculating them into a liquid culture medium. Microbial scale-up culture refers to the method of activating and progressively multiplying preserved strains to provide a sufficient number of metabolically active microbial cells (seeds) that meet certain physiological requirements for fermentation production. Furthermore, the flowchart for the preparation of the compound inoculum is shown below. Figure 6 As shown.

[0277] Application Case of Petroleum Hydrocarbon Degradation Compound Microbial Agent:

[0278] The contaminated site, primarily the oil depot area, requires proper disposal. Two soil piles have been placed on-site. Each pile occupies approximately 100 square meters. 2 The average height of the soil mound on the north side is about 1.5 meters, and the average height of the soil mound on the east side is 1 meter, estimated at 250m. 3The excavated soil has been removed. Furthermore, an emergency investigation completed on June 7th identified a total of four locations exceeding the standard, with a preliminary assessment indicating approximately 50m of soil above the standard. 3 The contaminated soil has not yet been excavated. Due to disturbance, some areas in the backfilled area west of the original foundation pit still exceed the permitted levels. A supplementary investigation conducted on June 21st revealed localized oil contamination in area TB15. The investigation estimated that the area requiring treatment in this region to be approximately 75 square meters... 2 Conservatively estimating a contamination depth of 3 meters, the area is expected to have a contamination depth of approximately 225 meters. 3 The contaminated soil has not yet been excavated. Therefore, the total volume of soil requiring treatment is approximately 525 cubic meters. 3 .

[0279] The secondary excavation area is approximately 450m² 2 The excavation depth varied, ranging from 2m to 4.5m. After adjustment, the dimensions of the upper rectangle were approximately 8.7*20 meters, the lower rectangle approximately 12*22 meters, and the height of the trapezoid was approximately 2.6 meters. Based on the formula for calculating the volume of a trapezoid, the calculated volume of the pile was approximately 569 m³. 3 After confirmation by the supervising party, the final earthwork volume was determined to be 522m³. 3 For the amount of disposal.

[0280] In summary, this project involves soil remediation in two phases, with the first phase involving approximately 525 cubic meters of earthwork. 3 The second phase of earthwork disposal involved approximately 522 cubic meters of earth. 3 The total volume of earthwork disposed of in the two phases was approximately 1047 cubic meters. 3 .

[0281] Target pollutants and remediation targets

[0282] The site remediation pollutant is petroleum hydrocarbons (C). 10 -C 40 According to relevant regulations and the requirements of the construction unit, the remediation pollutant for this project site is petroleum hydrocarbons (C). 10 -C 40 The target value is 826 mg / kg.

[0283] Compound bacterial agent spraying and mixing

[0284] The effectiveness of contaminated soil remediation depends on the degree of mixing between the contaminated soil and the microbial agent. In this project, an excavator was used to mix the pre-treated contaminated soil with the microbial agent. Layers of soil were applied and sprayed onto the contaminated soil (the excavator dug the soil, spraying each bucket, and then piling it up). This mixing was repeated 2-3 times to ensure thorough and uniform mixing of the soil and the microbial agent. After thorough mixing, the soil was piled for curing. The moisture content of the contaminated soil after mixing with the microbial agent was controlled at approximately 20-30%. The soil was turned over every 2-4 days and piled for curing in the treatment area for approximately 30 days.

[0285] Sampling and petroleum hydrocarbon degradation effects of contaminated site remediation

[0286] According to the "Technical Guidelines for Environmental Investigation, Remediation and Effect Evaluation of Industrial Enterprise Sites in Guangzhou" (Sui Huan Ban

[2018] No. 173), the bottom of the foundation pit should be divided into blocks, and the maximum area of ​​a single block should not exceed 400m². 2 For the monitoring points of petroleum hydrocarbon organic matter in this project, the sampling should be carried out by following the diagonal method, with no less than 4 soil samples in each sampling unit.

[0287] Soil sampling methods, on-site quality control, on-site quality assurance, and sample preservation and transportation methods shall be carried out in accordance with relevant specifications and requirements.

[0288] Soil sampling steps: Divide the sampling area / segment → Collect soil samples → On-site sample preservation and information recording → Testing. Site contaminant remediation: The contaminant is petroleum hydrocarbons (C). 10 -C 40 Sampling and testing primarily target the effectiveness of the remediated soil treatment; the testing indicator is petroleum hydrocarbons (C). 10 -C 40 The detection method is based on HJ 1021-2019 "Petroleum Hydrocarbons (C) in Soils and Sediments". 10 -C 40 Determination of ) by gas chromatography.

[0289] Soil testing was conducted in two phases. Four soil monitoring points were set up at the soil mound. A mixed sample was collected at each point using a diagonal sampling method, resulting in four soil samples sent to the laboratory for testing. Two petroleum hydrocarbon (C) tests were performed. 10 -C 40 The test results are shown in Tables 1 and 2. Both test results were lower than the target values ​​for repair.

[0290] After the soil passed inspection, the qualified soil was transported and backfilled within the plant, with a total backfill volume of approximately 1120 cubic meters. 3 The backfill area is located in the vacant orchard area to the north of the original contaminated site. After backfilling, the area was leveled using an excavator. A schematic diagram of the sampling points is shown below. Figure 7 As shown.

[0291] Table 1. Statistical Table of Soil Testing Results in Phase I

[0292]

[0293] Table 2. Statistical Table of Soil Testing Results in Phase II

[0294]

[0295]

[0296] Soil pollution risk assessment of remediation sites

[0297] Combination Figure 8 Following soil backfilling, and referring to the "Technical Review Guidelines for Soil Pollution Status Investigation, Risk Assessment and Effectiveness Assessment Reports for Construction Land in Guangdong Province (Trial)" and the "Technical Guidelines for Risk Control and Soil Remediation Effectiveness Assessment of Contaminated Sites" (HJ 25.5-2018), sampling points were selected using a combination of professional judgment and systematic sampling methods. The sampling quantity was implemented according to Table 3 of the guidelines. For a 1000m² sampling point... 2 > Area ≥ 100m² 2 In this situation, three sampling points were used, collecting soil samples from the top 0-20cm layer. The areas for the first and second phases of treatment were 250m² respectively. 2 and 260m 2 Therefore, three sampling points were set up on the transportation route and three sampling points were set up on the transportation route.

[0298] The concentrations of petroleum hydrocarbons (C10-C40) in the nine soil samples ranged from 20 to 49 mg / kg, all below the screening values ​​for Class I land use in the "Soil Environmental Quality Standard for Construction Land Soil Pollution Risk Control (Trial)" (GB 36600-2018). 10 -C 40 The pollution risk is negligible, indicating that the construction did not cause secondary pollution to the treatment area and roads along the route.

[0299] Table 3 Evaluation of Soil Petroleum Hydrocarbon (C10-C40) Secondary Pollution Detection Results

[0300] Sample number Test results (mg / kg) Screening values ​​for Category I land use (mg / kg) Does it meet the standard? S1 20 826 yes S2 20 826 yes S3 49 826 yes S4 36 826 yes S5 34 826 yes S6 36 826 yes S7 42 826 yes S8 40 826 yes S9 26 826 yes

[0301] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and substitutions can be made without departing from the technical principles of the present invention, and these improvements and substitutions should also be considered within the scope of protection of the present invention.

Claims

1. A formula of a petroleum hydrocarbon degradation composite microbial agent, characterized in that: comprising the following components in parts by weight: Pseudomonas aeruginosa 5-10 parts; Bacillus 5-10 parts; and a rhamnolipid solution 10-20 parts; wherein the mass percentage of the rhamnolipid solution is 0.1-1.0%. 2.The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 1, characterized in that: comprising the following components in parts by weight: Pseudomonas aeruginosa 6-8 parts; Bacillus 6-8 parts; and a rhamnolipid solution 12-16 parts; wherein the mass percentage of the rhamnolipid solution is 0.3-0.7%. 3.The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 2, characterized in that: comprising the following components in parts by weight: Pseudomonas aeruginosa 7 parts; Bacillus 7 parts; and a rhamnolipid solution 15 parts; wherein the mass percentage of the rhamnolipid solution is 0.5%. 4.The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 3, characterized in that: 5.The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 3, characterized in that: the preparation method of the rhamnolipid solution is as follows: comprising the following steps: (1) flocculation and sedimentation for solid-liquid separation: after the production of rhamnolipid fermentation is completed, the pH value of the rhamnolipid fermentation broth is adjusted, a flocculating agent is added and stirred to be uniform, then flocculation and sedimentation treatment is performed, and finally filtration is performed for solid-liquid separation to obtain a separated liquid; (2) decolorization: activated carbon is added to the separated liquid after the solid-liquid separation in step (1) to obtain a decolorized liquid, and the temperature and pH value of the decolorized liquid are controlled, and finally decolorization treatment is performed to obtain a solution; (3) clarification: the solution after decolorization in step (2) is subjected to clarification treatment by using a filter membrane to obtain a finished product. 6.The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 3, characterized in that: in step (1), the pH value of the rhamnolipid fermentation broth is adjusted to a range of 7.9-8.2; in step (1), the flocculating agent is a mixture of diatomite, sodium-based bentonite and polyaluminum sulfate, and the mass ratio among the three is (1-4) : (7-10) : (2-8); in step (1), the concentration of the flocculating agent is in a range of 100 pm-1000 ppm; in step (1), the temperature for flocculation and sedimentation treatment of the flocculating agent is in a range of 55-65℃; in step (1), the time for flocculation and sedimentation treatment of the flocculating agent is in a range of 6-8 h; and in step (1), the filtration equipment is a plate-and-frame filter press, and the pore size of the plate-and-frame filter press is in a range of 800-1000 mesh. 7.The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 3, characterized in that: in step (2), the weight-to-volume ratio of the activated carbon to the separated liquid after the solid-liquid separation in step (1) is in a range of 0.8%-1.6%; and in step (2), the activated carbon is ammonia-modified activated carbon, and the preparation method thereof is as follows: ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ The Pseudomonas aeruginosa is Pseudomonas aeruginosa, its dosage form is fermented bacteria liquid, its concentration is OD 600 = 2.0; The Bacillus is Bacillus subtilis, the dosage form is fermentation broth, the concentration is OD 600 = 2.

0. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ The 33% ammonia solution is heated to 55℃, and the activated carbon is soaked in the ammonia solution for 3 hours, and then dried at low temperature; The temperature of the decolorizing solution in step (2) is in the range of 68-80℃; The pH value of the decolorizing solution in step (2) is adjusted to be in the range of 6.5-7.5; The decolorizing treatment in step (2) is performed for 1-2 hours.

8. The formula of the petroleum hydrocarbon degradation composite microbial agent according to claim 3, characterized in that: The filter membrane in step (3) is a hydrophilic polypropylene filter membrane; The pore size of the filter membrane in step (3) is in the range of 0.05-0.2 μm; The temperature of the clarification treatment in step (3) is in the range of 45-55℃; The pH value of the clarification treatment in step (3) is adjusted to be in the range of 4.5-5.

5.

9. The formula of the petroleum hydrocarbon degradation composite microbial agent in the application of petroleum hydrocarbon degradation.

Images