Two gst family genes linked to herbicide tolerance and uses thereof
By expressing the GST family genes GLGST4 and GLGST5 in Escherichia coli and rice, the problem of resistance of Galium aparine to diflubenzuron has been solved, enabling the improvement of herbicide resistance and the breeding of herbicide-resistant crop varieties, and supporting the scientific use of pesticides and the development of new herbicides.
Patent Information
- Application Number
- CN202511794289.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-12-02
AI Technical Summary
In the existing technology, the broadleaf weed *Galium affine* has developed resistance to ALS inhibitor herbicides, and there is a lack of effective herbicide-tolerant gene resources, which limits the development of broad-spectrum herbicides and the breeding of herbicide-tolerant crop varieties.
We provided two GST family genes, GLGST4 and GLGST5, linked to herbicide resistance. By expressing these genes in Escherichia coli and rice callus, we enhanced resistance to diflubenzuron. Molecular docking analysis revealed their high binding affinity to diflubenzuron, promoting detoxification metabolism.
It has achieved resistance of Escherichia coli and rice to diflubenzuron, and provided genetic resources for the breeding of crop varieties resistant to ALS inhibitor herbicides and herbicide-degrading engineered bacteria, supporting scientific guidance on pesticide use and the design of novel herbicides.
Smart Images

Figure CN121227752B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of herbicide resistance genes, and in particular to two GST family genes linked to herbicide resistance and their applications. Background Technology
[0002] Herbicide resistance in weeds refers to the ability of weeds that were previously effectively controlled with certain doses of herbicides to survive and reproduce even with the same or higher doses of the same herbicide. The continuous evolution of herbicide resistance in weeds is influenced by various factors, such as herbicide type, weed type, and pollination method. According to statistics from the Global Resistant Weeds Network (www.weedscience.org), as of September 2025, 273 weed species worldwide have developed resistance to 168 herbicides with 21 different mechanisms of action. The most serious problem is resistance to acetolactate synthase (ALS, EC 4.1.3.18) inhibitors, with 176 weed species already resistant to these inhibitors. Furthermore, in agricultural production, due to the lack of timely and precise scientific guidance on pesticide application, producers often blindly increase the dosage of pesticides and mix them indiscriminately. This further exacerbates the selection pressure on herbicides, leading to a vicious cycle of accelerated resistance evolution and causing problems such as crop damage, environmental pollution, and food safety. Therefore, the creation and optimization of new herbicides and the breeding of herbicide-tolerant crops have become major scientific and technological needs, and the discovery and application of herbicide-resistant / tolerant genes are currently a hot topic in related research fields.
[0003] Acetolactate synthase (ALS) or AHAS (Acetohydroxyacid synthase) is a crucial enzyme in the biosynthesis of branched-chain amino acids. ALS is a key enzyme in the first stage of the biochemical reactions necessary for plant life processes, specifically the synthesis of isoleucine, leucine, and valine. ALS inhibitor herbicides bind to the pathway through which the substrate enters the catalytic reaction center, inhibiting the synthesis of branched-chain amino acids by blocking the substrate's access to the enzyme's reaction site. This leads to the inhibition of related protein synthesis, ultimately interfering with normal plant cell mitosis, causing plant growth to cease and eventually resulting in death. ALS inhibitor herbicides have a broad spectrum of weed control and strong crop selectivity, and have long dominated the global herbicide market.
[0004] Biflusulfanil is a widely used ALS-inhibiting herbicide and a representative herbicide for controlling various broadleaf weeds such as cleavers, chickweed, shepherd's purse, and shepherd's purse. Currently, genes resistant to ALS-inhibiting herbicides have been discovered in various grass weeds, but the vast majority of these genes belong to the cytochrome P450 (CYP450) gene family; herbicide-resistant / tolerant genes are rarely found in broadleaf weeds. This limits the development of broad-spectrum herbicides and the breeding of herbicide-tolerant crop varieties.
[0005] Pig calamus ( Galium aparine *Galium affine* (Galium aparine) is an annual or biennial broadleaf weed belonging to the Rubiaceae family. It has wide adaptability and easily forms dominant populations. Its growth cycle coincides with summer-ripening crops such as wheat and rapeseed, making it one of the major harmful weeds affecting these crops and non-arable land. In pursuit of better control, farmers have blindly increased herbicide usage (repeatedly using the same type of herbicide). *Galium affine* has evolved varying degrees of resistance to herbicides with different mechanisms of action, and its damage has increased year by year in recent years.
[0006] Identifying the functional genes responsible for herbicide resistance in *Galium affine* can clarify the resistance mechanism to diflubenzuron, providing a theoretical basis for the scientific and rational control of resistant *Galium affine* through chemical means, and offering potential genetic resources for transgenic crop breeding. Furthermore, analyzing the molecular interactions between the detoxification proteins encoded by resistance genes and herbicides provides valuable insights for herbicide structure optimization and the design of novel herbicides. Summary of the Invention
[0007] The purpose of this invention is to provide two GST family genes linked to herbicide resistance and their applications, providing candidate genes for research on the mechanism of cleavers' resistance to diflubenzuron, the breeding of herbicide-resistant crop varieties, and the construction and optimization of herbicide-degrading engineered bacteria, thus contributing to the effective control of cleavers, the green and sustainable development of agriculture, and food security.
[0008] To achieve the above objectives, on the one hand, the present invention provides two GST family genes linked to herbicide tolerance, the two GST family genes being... GLGST4 and GLGST5 , GLGST4 The CDS sequence is shown in SEQ ID NO.1. GLGST5 The CDS sequence is shown in SEQ ID NO.4.
[0009] Preferred expression GLGST4 , GLGST5 Genes can increase resistance to ALS inhibitor herbicides.
[0010] On the other hand, the present invention provides the application of the above-mentioned two GST family genes linked to herbicide resistance in the detection of resistance of Galium aparine to diflubenzuron.
[0011] On the other hand, the present invention provides an application of the above two GST family genes linked to herbicide tolerance in the selection and dosage of herbicides for the control of cleavers. The application is to detect whether cleavers are suitable for control with diflubenzuron and to determine the effective dosage of diflubenzuron for control.
[0012] On the other hand, the present invention provides the application of the above two GST family genes linked to herbicide tolerance in the breeding of herbicide-tolerant crop varieties, wherein the herbicide is an ALS inhibitor herbicide.
[0013] On the other hand, the present invention provides an application of the above two GST family genes linked to herbicide resistance in the construction and optimization of herbicide-degrading engineered bacteria, wherein the herbicide is an ALS inhibitor herbicide.
[0014] Therefore, the two herbicide-resistant GST family genes linked to herbicide-resistant genes in this invention and their applications have the following beneficial effects:
[0015] (1) This invention discloses for the first time the cleavers. GLGST4 , GLGST5 CDS sequence of the gene GLGST4 , GLGST5 All genes belong to the GST family;
[0016] (2) This invention is the first to discover expression in Escherichia coli. GLGST4 , GLGST5 Genes can enable transgenic E. coli to acquire resistance to diflubenzuron;
[0017] (3) This invention is the first to discover the expression of [the substance] in rice callus tissue. GLGST4 , GLGST5 This can induce rice to develop resistance to diflubenzuron;
[0018] (4) By GLGST4 , GLGST5 Molecular docking analysis of the gene with diflubenzuron showed that... GLGST4 , GLGST5 The genes all have a stable high binding force with diflubenzuron, which can conjugate reduced glutathione and herbicide molecules, and have a certain promoting effect on detoxification metabolism.
[0019] (6) The present invention provides GLGST4 , GLGST5The gene can be used for the breeding of crop varieties resistant to ALS inhibitor herbicides, the construction and optimization of herbicide-degrading engineered bacteria, and provides two candidate genes for the study of the mechanism of resistance of cleavers to ALS inhibitor herbicides, the detection of cleaver resistance, and the determination of application time and dosage.
[0020] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 for GLGST4 , GLGST5 Gene electrophoresis diagram;
[0023] Figure 2 Under solid culture conditions, transfer GLGST4 , GLGST5 Sensitivity of *E. coli* to diflubenzuron;
[0024] Figure 3 Under liquid culture conditions, transfer GLGST4 , GLGST5 Sensitivity of *E. coli* to diflubenzuron;
[0025] Figure 4 For the transfer GLGST4 , GLGST5 Sensitivity of genetically modified rice callus to diflubenzuron;
[0026] Figure 5 For diflubenzuron and GLGST4 Molecular docking results; where A is GLGST4 3D structural diagram of the binding of diflubenzuron to the active site, B is... GLGST4 The specific binding site of diflubenzuron at its active center, C is 2D structural diagram of the interaction force with diflubenzuron;
[0027] For diflubenzuron and Molecular docking results; where A is 3D structural diagram of the binding of diflubenzuron to the active site, B is... The specific binding site of diflubenzuron at its active center, C is 2D structural diagram of the interaction force with diflubenzuron. Detailed Implementation
[0028] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0029] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0030] The instruments, equipment, reagents, and materials used in the examples were all obtained commercially.
[0031] Example 1
[0032] Cloned pig cleaver Genes, the specific steps are as follows:
[0033] S11. Transcriptome sequencing yielded glutathione S-transferase. Full-length CDS of the gene sequence The CDS sequence of the gene is shown in SEQ ID NO.1.
[0034] SEQ ID NO.1:
[0035] ATGAAAGAGACGCTCCCCCCTGCTCTTGGTTCTTCTTCGCAGGCACCGCCCATCTTTGATGGGACCCCCAAGTTGTACATATCATATGCCTGCCCGTATGCACAACGTGTATGGATTACAATGAACTGTAAGGGTTTGCAAGATGAAATAAAATTGATCCCCATTGATCTAAAAGATAGGCCAGCTTGGTACAAGGAGAAAGTATACCCACCAAACAAGGTGCCATCACTAGAACATAACAATGAAGTTAAAGGGGAGTCTCTTGACCTAATGAAATACCTGAACGATAACTTTGAGGGACCTTCTCTATTCCCTGAGGATCCGGCTAAGAAAGAGTTTGGTGAAGAGTTGCTGTCCTATTGTGGCTCCTTCCATAAAGGCGTGACTGCATCTTTCAAGGGAGATGGACTAACTGAAGCTGGTACTTCCTTGGATCACATTGAGATGGCGCTTGGGAAATTCAACAATGGTCCATTCTTCCTTGGAGCTTTCAGCTTGGTTGATATAGCTTATGCTCCATTTATTGAAAGATACGAACCCTTTCTATTGGATGTAATGAAGTATGAAATAACGAAGGGGAGACCGAAGCTTGCAGGATGGATTGAG。
[0036] Amplification The primer sequences for amplifying the gene are shown in SEQ ID NO.2 and SEQ ID NO.3:
[0037] SEQ ID NO.2: ATGAAAGAGACGCTCCCC;
[0038] SEQ ID NO.3: GCTTGCAGGATGGATTGAG。
[0039] S12. Select uniform and plump seeds of the resistant population HN21-11 *Galium aparine*, soak them in warm water at 30-40℃ for 12 hours, then transfer them to 9cm petri dishes lined with double-layered filter paper. Add appropriate amounts of deionized water to the petri dishes to keep the filter paper moist, and then transfer the petri dishes to a light incubator for germination. The incubator conditions are set as follows: 25 / 20℃ (day / night), alternating light and dark for 12 hours. When the seeds germinate to about 0.5cm, select germinating seeds of uniform growth and place them in 12cm diameter plastic seedling pots. The soil used for plant cultivation is soil from the Shandong Agricultural University teaching and experimental base farm that has no history of herbicide application. The sowing rate is 10 plants per pot. When the seedlings reach the 2-leaf stage, retain 5 uniformly growing plants per pot.
[0040] Using FastPure ® Total RNA was extracted from the leaves of *Galium aparine* using the Plant Total RNA Isolation Mini Kit. A 1 μL sample of the extracted total RNA was then measured using an ultra-micro spectrophotometer to determine its OD value. 260 and OD 280 The ratio; take 2 μL of total RNA extracted from Galium clematis and mix it with 2 μL of 10× DNA loading buffer, add ddH2O to make up to 20 μL, and detect the integrity of the extracted RNA by agarose gel electrophoresis.
[0041] Following the instructions of the All-in-One First-Strand Synthesis MasterMix kit, the obtained high-quality RNA was reverse transcribed into cDNA: using 1 µg of total RNA as a template and Oligo(dT)20VN as a primer, the reaction system was prepared. The reaction was incubated at 37°C for 2 min, then at 55°C for 5 min. After the reaction, the obtained cDNA was immediately placed on ice and stored at -20°C for later use.
[0042] S13. Using the obtained cDNA as a template and the primers synthesized in step S1 as primers, use Phanta... ® Max Super-Fidelity DNA Polymerase amplifies the full-length gene. The total volume of the amplification reaction system is 50 μL, including: 25 μL 2×Phanta Max Master Mix (Dye Plus), 2 μL upstream primer (10 μmol·L⁻¹). -1 ), 2 μL of downstream primer (10 μmol·L -14 μL template DNA, 17 μL ddH2O. PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 65℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 34 cycles; final extension at 72℃ for 5 min.
[0043] S14. After the PCR reaction, the amplification product was detected by 1% agarose gel electrophoresis. The 681bp band was observed using a UV gel imaging system and purified using a gel extraction kit. The electrophoresis results are as follows: As shown, the purified target fragment was quantified using a NanoDrop One spectrophotometer for the construction of the cloning vector.
[0044] Example 2
[0045] Cloned glutathione-S-transferase from cleavers The gene, and the specific steps are exactly the same as in Example 1, except that... The CDS sequence of the gene is shown in SEQ ID NO.4, amplified. Gene.
[0046] SEQ ID NO.4:
[0047] ATGGGCAACGACGACGTGCAGCTGATCGGTGCATGGCCGAGTCCCTTCGTGATGAGGGCTCGGATCGCACTCAATCTCAAATCCGTGAAATACGATTTCCTCGAGGAAAAAATCGGCACCAAAAGTGAGCTCCTTCTCAAATCAAACCCTGTTCACAAG AAAATCCCAGTTCTGATTCATGATGCCAAACCCATCTCTGAATCCTTGATCATCGTTCAATACATCGACGAGGCTTGACCTCCGGCGCTTTGATTCTCCCCTCGGATCCTTATGACCGCTCCATTGCACGCTTCTGGGCTGCCTATCTTGATGATAAG.
[0048] The primer sequences for gene amplification are shown in SEQ ID NO.5 and SEQ ID NO.6:
[0049] SEQ ID NO.5: ATGGGCAACGACGACGTG;
[0050] SEQ ID NO. 6: CTTATCATCAAGATAGGCAGCC.
[0051] Gene electrophoresis diagram as shown As shown.
[0052] Example 3
[0053] Constructing a structure containing galangal , The specific steps for creating a recombinant cloning vector for a gene are as follows:
[0054] S31. The purified products from Examples 1 and 2 were used to ligate the target gene into the cloning vector TA / Blunt-Zero using the TA / Blunt-Zero Cloning Kit. The ligation reaction mixture consisted of 1 μL 5× TA / Blunt-Zero Cloning Mix, 2 μL target gene, purified product, and 2 μL ddH2O. The ligation reaction conditions were 25°C for 5 min. After the reaction, the centrifuge tubes were placed on ice for later use.
[0055] S32. Thaw DH5α competent cells on ice. When the cells are in an ice-water mixture, add 10 μL of the ligation product obtained from S31 and gently tap the bottom of the centrifuge tube to mix. Incubate on ice for 25 min. Heat shock at 42°C for 45 s, then quickly place on ice and incubate for 2 min. Add 700 μL of antibiotic-free LB sterile medium, mix well, and shake at 37°C and 200 rpm for 60 min. Centrifuge the incubated culture at 5000 rpm for 1 min, discard 900 μL of supernatant, gently pipette the remaining culture to resuspend it, and spread it onto a plate containing 50 mg·L⁻¹ of iodine. -1 Place ampicillin on LB sterile solid medium plates, invert the plates and incubate overnight at 37°C.
[0056] After bacterial colonies have grown on the plate, single colonies are picked for PCR verification. The PCR primers, reaction system, and amplification conditions are the same as in Example 1, S13. The verified positive clones are then inoculated onto a plate containing 50 mg·L⁻¹ of [a specific solution / concentration]. -1 The bacteria were cultured in sterile LB broth containing ampicillin; 1 mL of the overnight culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing results were compared with NCBI online BLAST. Alignment analysis with the NCBI database showed that the GST gene of *Galium affine* was successfully cloned, and this gene is annotated as... , The positive bacterial cultures identified by sequencing were preserved for the construction of expression vectors.
[0057] Example 4
[0058] Construct separate structures containing galangal , The specific steps for using the E. coli recombinant expression vector for the gene are as follows:
[0059] S41. Using the bacterial culture with correct sequencing from Example 3 as a template, amplify using Phanta® Max Super-Fidelity DNAPolymerase. , The full-length gene was used, and the reaction system and amplification conditions were the same as in S13 of Example 1. The PCR products were subjected to agarose gel electrophoresis, and the target fragment was recovered using a gel extraction kit and quantified using a NanoDrop One spectrophotometer.
[0060] S42. The recovered product of the target gene is processed according to... The expression vector was constructed according to the instructions of the Blunt E1 Expression Kit. The reaction system consisted of 1 μL of PCR product and 1 μL of... -Blunt E1 Expression Vector, 3 μL ddH2O. The blank control group is the EControl Template included in the kit. Mix gently and react at 25°C for 10 min. After the reaction, place the centrifuge tubes on ice.
[0061] Example 5
[0062] The ligation product obtained in Example 4 was transformed into Escherichia coli ROSSETTA(DE3) using the following specific steps:
[0063] Take two tubes of Escherichia coli ROSSETTA (DE3) competent cells and thaw them on ice. When the cells are in an ice-water mixture, add 5 μL of the solution successfully constructed in Example 4 to each tube. , The recombinant expression vector of the gene was prepared by manually tapping the bottom of the centrifuge tube to mix it thoroughly, and then incubated on ice for 25 min. The tube was then incubated in a 42°C water bath for 90 s, immediately returned to ice, and incubated for 2 min. 700 μL of antibiotic-free LB sterile medium was added to the centrifuge tube, mixed well, and then incubated at 37°C, 200 rpm for 60 min. After incubation, the bacterial culture was centrifuged at 5000 rpm for 1 min, 900 μL of supernatant was discarded, and the remaining bacterial culture was gently resuspended by pipetting and spread onto a medium containing 50 mg / L of [unspecified medium]. -1 Ampicillin was cultured on LB sterile solid agar plates, which were then inverted and incubated overnight at 37°C. Once bacterial colonies appeared, single colonies were picked for PCR verification. Validated positive clones were inoculated onto a medium containing 50 mg / L of ampicillin. -1The culture was prepared in LB sterile liquid medium containing ampicillin. One mL of the overnight culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing verification. The sequencing results were analyzed by sequence alignment using UGENE 50.0 software. The results showed successful transformation.
[0064] Example 6
[0065] Examining the transfer in Example 5 , The sensitivity of the gene-modified *E. coli* ROSSETA(DE3) to diflubenzuron is determined through the following steps:
[0066] S61. Accurately weigh 106 mg of diflubenzuron technical grade, dissolve it in 10 mL of acetone, and then add it to chromatographic grade acetonitrile to prepare a solution of 1000 mg·L⁻¹. -1 The mother liquor is then diluted with acetonitrile to the required concentration.
[0067] S62. Solid Culture: Spread ROSSETA (DE3) bacterial suspension onto the surface of LB solid medium, pick a single colony and inoculate it into 1 mL of LB liquid medium. Incubate the bacterial suspension at 37°C and 200 rpm until OD reaches 100°C. 600 After reaching 0.6, the bacterial culture was diluted to OD. 600 =0.1, take 0.5 μL of bacterial suspension and evenly drop it onto solid LB medium (sterilized and supplemented with 100 mg / L ampicillin) containing different concentrations of diflubenzuron (1 mM, 5 mM) and 1 mM IPTG. Incubate at 37℃ for two days upside down, observing colony growth. Use DE3 strain transgenic with the BluntE1 empty vector as a control to compare the growth of the empty vector and the transgenic E. coli. The results are as follows. As shown.
[0068] Liquid culture: Spread ROSSETA (DE3) bacterial suspension onto the surface of LB solid medium, pick a single colony and inoculate it into 1 mL of LB liquid medium. Incubate the bacterial suspension at 37°C and 200 rpm until OD reaches 100%. 600 After reaching 0.6, the bacterial culture was diluted to OD. 600 =0.1, pipette 190 μL of the diluted bacterial culture into a sterile 96-well microplate with a cap, add 10 μL of 2 mM diflubenzuron solution, and incubate on a constant temperature shaker at 37°C and 200 rpm. OD is measured every hour. 600 The DE3 strain transgenic with the BluntE1 empty vector was used as a control to compare the growth of the empty vector and the transgenic E. coli. The results are as follows: As shown.
[0069] Depend on It can be seen that when the concentration of diflubenzuron in the solid culture medium is ≥5 mM, the growth of *E. coli* DE3 transformed with the empty vector is significantly inhibited. , The growth of *E. coli* was not significantly affected by the gene. It can be seen from the liquid culture results that, when the concentration of diflubenzuron was 2 mM, the OD values of E. coli transfected with the empty vector and the target gene showed a trend of first increasing and then decreasing over time. , The OD value of the target gene in E. coli was higher than that in the control treatment, reaching its maximum value within 2 hours, and then decreasing, indicating that the target gene... , The expression of this substance enhanced the resistance of Escherichia coli ROSSETTA(DE3) to diflubenzuron.
[0070] Example 7
[0071] Construct separate structures containing galangal , The specific steps for Agrobacterium-mediated recombinant expression of genes are as follows:
[0072] S71. Single enzyme digestion was used to prepare the linearized vector of pcambia1390. The enzyme digestion site is... I. The target fragment was obtained using primers from the homologous arms of the pcambia1390 vector. The forward homologous arm primer sequence is shown in SEQ ID NO.7, and the reverse homologous arm primer sequence is shown in SEQ ID NO.8; The forward homologous arm primer sequence is shown in SEQ ID NO.9, and the reverse homologous arm primer sequence is shown in SEQ ID NO.10.
[0073] SEQ ID NO. 7: tacaattacagtcgacTACCCACGAAATCTTAAGCTCCCACTCAACCTTTCAACATATTCTGCAC.
[0074] SEQ ID NO. 8: atcctctagagtcgacCTCAATCCATCCTGCAAGCTTCGGTCTCCCCTTCG.
[0075] SEQ ID NO. 9: tacaattacagtcgacATGGGCAACGACGACGTGCAGCTGATCG.
[0076] SEQ ID NO. 10: atcctcttagagtcgacCTTATCATCAAGATAGGCAGCCCAGAAGCGTGCAATGGAGCG.
[0077] S72. Homologous recombination was performed using the ClonExpress® II One Step Cloning Kit (C112). The recombinant plasmid was transformed into the plant expression strain EHA105. 100 μL of EHA105 competent cells were thawed on ice, and 10 μL of the recombinant plasmid was added. The mixture was gently stirred at the bottom of the tube and incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 28°C water bath for 5 min, and in an ice bath for 5 min. 700 μL of antibiotic-free LB broth was added, and the mixture was incubated at 28°C with shaking for 2-3 hours. The cells were harvested by centrifugation at 6000 rpm for 1 min, and the resulting plating (including RIF and KAN) was inverted and incubated at 28°C for 2-3 days.
[0078] Single colonies were picked from each transgenic plate for PCR verification and then sent for bacterial sequencing. DNAMAN software was used to assemble and compare the sequencing files. Strains with correct sequencing were stored in glycerol at -80℃ and used for subsequent functional verification.
[0079] Example 8
[0080] The recombinant plasmid obtained in Example 7 was transformed into the plant expression strain EHA105 and then used to infect and transform rice callus tissue. The specific steps are as follows:
[0081] S81. Thaw 100 μL of EHA105 competent cells on ice, add 10 μL of recombinant plasmid, gently stir the bottom of the tube to mix, and then place the tube in the following order: stand on ice for 5 min, liquid nitrogen for 5 min, water bath at 28°C for 5 min, and ice bath for 5 min. Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2-3 hours. Centrifuge at 6000 rpm for 1 min to collect the bacteria, spread the plating (including RIF and KAN) upside down in an incubator at 28°C for 2-3 days.
[0082] S82. Take samples from the Agrobacterium-positive culture medium, spread them evenly on the surface of LB solid medium, and select colonies to inoculate into AAS solution containing AS. Next, use this solution to inoculate callus tissue with a glossy surface, golden color, loose texture, and small granular structure, for 1 minute with continuous shaking. Then, transfer the callus tissue to empty petri dishes lined with filter paper to remove excess culture medium, disperse it on co-culture medium NA, seal the dish, and incubate at 28°C in the dark for 3 days. After incubation, wash the callus tissue 3 to 5 times with sterile water containing 500 mg / L carbenicillin antibiotic, and then thoroughly blot dry with filter paper. Next, inoculate these callus tissues sequentially onto first-sieve medium. After 2 weeks of incubation, transfer the callus tissue with good growth to second-sieve medium. After one week, the selected callus tissues were placed on a medium containing 200 μM diflubenzuron for sensitivity testing to observe the specific effects of diflubenzuron on the differentiation process of rice callus tissues. Callus tissues transgenic with an empty GFP vector were used as a control to compare the growth differences between GFP-transgenic and transgenic callus tissues on the drug-containing medium.
[0083] The results are as follows As shown, at a treatment dose of 200 μM diflubenzuron, GFP growth was significantly inhibited. , None of them were significantly suppressed, which shows that the conversion , Rice has developed strong resistance to diflubenzuron.
[0084] Example 9
[0085] right , The specific steps for analyzing the physicochemical properties of genes are as follows:
[0086] (1) Use Expasy ProtParam to calculate physicochemical parameters.
[0087] The results showed that The predicted molecular weight is 25.34 kDa; the theoretical isoelectric point is 5.50; and the extinction coefficient at 280 nm is 34505 M. -1 ·cm -1 The results indicate that it can be analyzed by ultraviolet spectroscopy; the instability index is 47.91, indicating that it is a stable protein; the lipophilicity index is 81.28, indicating that it can maintain its temperature over a wide temperature range; the total average hydrophilicity is -0.293, indicating that it is a hydrophilic protein.
[0088] The predicted molecular weight is 20.18 kDa; the theoretical isoelectric point is 6.07; and the extinction coefficient at 280 nm is 22460 M.-1 ·cm -1 The results indicate that it can be analyzed by ultraviolet spectroscopy; the instability index is 32.09, indicating that it is a stable protein; the lipophilicity index is 109.53, indicating that it can maintain its temperature over a wide temperature range; and the total average hydrophilicity is -0.062, indicating that it is a hydrophilic protein.
[0089] (2) Diflubenzuron and Molecular docking results as follows As shown, the docking results indicate that SWISS-MODEL predicted... It forms a suitable spatial complement to diflubenzuron. The lowest binding energy with diflubenzuron is -7.3 kcal / mol, indicating a high binding affinity. It can form three hydrogen bonds with diflubenzuron: LYS131, GSH300, and GLU140. Molecular docking results, to some extent, illustrate... It can conjugate reduced glutathione with herbicide molecules, thus promoting detoxification and metabolism.
[0090] The structure was modeled using 4pqh.1 as a template, with a GMQE value of 0.83. The template protein and... The proteins are highly similar, belonging to the lambda subfamily of the GST family. The lambda GST family is a class of GSTs with a special structure that plays an important role in plant secondary metabolism.
[0091] (3) Herbicide diflubenzuron and Molecular docking results as follows As shown, the docking results indicate that SWISS-MODEL predicted... It forms a suitable spatial complement to diflubenzuron. The lowest binding energy with diflubenzuron is -8.0 kcal / mol, and a binding energy less than -7 kcal / mol indicates a high binding capacity. It can form two hydrogen bonds with diflubenzuron, namely LEU69 and ILE70.
[0092] Using SWISS-Model For homology modeling, 5kej.1.A was selected as the template protein, which is highly similar to the target protein and has a GMQE value of 0.89.
[0093] Therefore, this invention discloses *Callicarpa salsa* for the first time. , The CDS sequence of the gene was obtained; for the first time, the expression of GLGST4 and GLGST5 genes in Escherichia coli and rice callus was discovered, which can induce transgenic Escherichia coli and rice to acquire resistance to diflubenzuron, providing two new diflubenzuron-resistant GST family genes derived from Galium cleavers; , These genes can be used for the breeding of crop varieties resistant to ALS inhibitor herbicides, the construction and optimization of herbicide-degrading engineered bacteria, and to provide two marker genes for the study of the mechanism of resistance of cleavers to ALS inhibitor herbicides, the detection of cleaver resistance, and the determination of application time and dosage.
[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Use of two GST family genes linked to herbicide tolerance in the breeding of herbicide tolerant crop varieties, characterized in that: The CDS sequence of two GST family genes is shown as SEQ ID NO. 1, GLGST4 and GLGST5 , GLGST4 The CDS sequence of two GST family genes is shown as SEQ ID NO. 1, GLGST5 The CDS sequence of two GST family genes is shown as SEQ ID NO. 1, the herbicide is florasulam and the crop variety is rice; Rice, trans GLGST4 Rice, trans GLGST5 Rice has resistance to florasulam.
2. The use of two GST family genes linked to herbicide resistance in the construction and modification of herbicide resistant engineered bacteria, as claimed in claim 1, characterized in that: The herbicide is diflubenzuron, and the engineered bacteria is Escherichia coli. GLGST4 , GLGST5 The expression of this substance enhanced the resistance of Escherichia coli to diflubenzuron.
Citation Information
Patent Citations
Two polypogon fugax herbicide-resistant genes and application thereof
CN119592590A
IbGSTL2 protein and application thereof in regulation and control of starch synthesis
CN119592611A