A Penaeus monodon NFAT5 gene and its application

Abstract

This invention discloses a Penaeus monodon NFAT5 gene and its application. The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the NFAT5 gene is shown in SEQ ID NO:2. This invention also discloses a recombinant expression vector containing the Penaeus monodon NFAT5 gene, a host cell containing the recombinant expression vector, and the use of the Penaeus monodon NFAT5 gene, protein, recombinant expression vector containing the gene, or host cell containing the expression vector in the preparation of gene preparations or feed additives for improving the low salt tolerance of Penaeus monodon.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and aquaculture genetic improvement technology, specifically relating to a species of tiger prawn (Penaeus monodon). Penaeus monodon The NFAT5 (Nuclear Factor of Activated T-cells 5) gene, its encoded protein, and the application of this gene or its encoded protein in improving the low-salt tolerance of Penaeus monodon. Background Technology

[0002] tiger prawn ( P. monodon The shrimp is one of the most widely farmed marine shrimp in tropical and subtropical regions worldwide. Its sensitivity to salinity directly determines the survival rate and growth rate during the seedling and adult stages. While low-salinity or desalination farming can reduce the cost of seawater and expand inland farming areas, it can also cause osmotic pressure imbalance, energy distribution disorder, and decreased immunity, resulting in slowed growth or even large-scale mortality.

[0003] NFAT5 (Nuclear Factor of Activated T-cells 5, also known as TonEBP) is a transcription factor known to directly sense changes in intracellular osmotic pressure and activate downstream osmotic protection gene networks. Its protein contains a Rel homologous DNA binding domain, a nuclear localization signal, and a transcriptional activation region regulated by p38-MAPK phosphorylation. It can upregulate genes involved in the synthesis and transport of organic osmotic substances such as inositol / betaine (SLC5A3, SLC6A12) and stress proteins such as HSP70, thereby restoring volume and ion-organic osmotic balance during rapid cellular dehydration (low or high salt).

[0004] Although the function of NFAT5, a key transcription factor regulating osmotic response, has been extensively studied in mammals, related research in crustaceans remains lacking. To date, no published literature reports the full-length cDNA sequence, tissue expression characteristics, or functional verification of the NFAT5 gene in the giant tiger shrimp in response to low salt stress, severely limiting its application and development in germplasm improvement and molecular breeding. Summary of the Invention

[0005] The purpose of this invention is to provide the NFAT5 gene of Penaeus monodon and the protein it encodes.

[0006] Another objective of this invention is to provide a method for improving the tolerance of tiger prawns to low-salt environments.

[0007] The final object of the present invention is to provide the use of the above-mentioned Penaeus monodon NFAT5 gene, the protein, a recombinant expression vector containing the gene, or a host cell containing the expression vector in the preparation of gene preparations or feed additives for improving the low salt tolerance of Penaeus monodon, as well as the use of Penaeus monodon in improving its low salt tolerance or in molecular breeding of low salt tolerance in Penaeus monodon.

[0008] The first objective of the present invention can be achieved by the following technical solution: a Penaeus monodon NFAT5 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0009] The present invention further includes a homology of not less than 95% and retains the functions of the NFAT5 transcription factor RHD homologous DNA binding domain and transcription activation region.

[0010] The amino acid sequence of the protein encoded by the NFAT5 gene or its functional fragment is shown in SEQ ID NO:2.

[0011] This invention is the first to clone the complete cDNA sequence of the NFAT5 gene in Penaeus monodon, predicting that its protein contains a typical RHD conserved domain and a transcriptional activation region related to osmotic pressure response. qRT-PCR results show that the gene is most strongly expressed in the hepatopancreas, followed by the heart, intestine and oculomotor nerve, moderately expressed in the gills and stomach, and weakly expressed in tissues such as muscle and ovary, showing a clear enrichment pattern of osmotic regulation-related tissues.

[0012] The present invention also provides a recombinant expression vector containing the NFAT5 gene of the tiger prawn.

[0013] The recombinant expression vector is further functionally connected to a promoter element.

[0014] The present invention further provides a host cell comprising the recombinant expression vector described above.

[0015] The second objective of the present invention can be achieved by the following technical solution: a method for improving the tolerance of Penaeus monodon to low-salt environments, comprising introducing the nucleotide sequence of the Penaeus monodon NFAT5 gene into the Penaeus monodon body, thereby overexpressing the Penaeus monodon NFAT5 gene in the Penaeus monodon.

[0016] Preferably, the introduction is performed by transferring genes into the fertilized egg through microinjection or nanoparticle delivery.

[0017] Preferably, the introduction is performed by integrating the exogenous NFAT5 gene at a safe site via CRISPR / Cas9 homologous arm knock-in.

[0018] This invention constructs a functional expression vector for the NFAT5 gene and introduces it into *Litopenaeus monodon*, achieving sustained high expression of the gene at the individual level. Experimental results show that under the same low-salt stress conditions, the apoptosis rate in the NFAT5-overexpressing group of *Litopenaeus monodon* was significantly lower than that in the control group, and the expression of osmolarity-regulating factors in its hepatopancreatic tissue was also significantly enhanced. This demonstrates that the NFAT5 gene plays a functional role in the low-salt stress response of *Litopenaeus monodon* and can be used as a key target gene for regulating low-salt tolerance traits in molecular breeding practices.

[0019] The present invention also provides a transgenic tiger prawn, wherein the tiger prawn genome contains the exogenous tiger prawn NFAT5 gene and is able to stably express the gene.

[0020] The final objective of this invention can be achieved through the following technical solutions: the application of the above-mentioned Penaeus monodon NFAT5 gene, the protein, the recombinant expression vector containing the gene, or the host cell containing the expression vector in the preparation of gene preparations or feed additives for improving the low salt tolerance of Penaeus monodon, as well as the application of Penaeus monodon in improving its low salt tolerance or in molecular breeding of low salt tolerance in Penaeus monodon.

[0021] This invention analyzes the expression changes of the NFAT5 gene in various tissues under low-salt stress conditions and finds that its expression is upregulated in osmotic regulation-related tissues such as gills and hepatopancreas. This suggests that NFAT5 may mediate cellular osmotic regulation through transcriptional regulation in low-salt environments, which plays a positive role in maintaining osmotic homeostasis in Penaeus monodon and thus improving its survival ability in low-salt environments.

[0022] This invention constructs a functional expression vector for the NFAT5 gene and introduces it into *Litopenaeus monodon*, achieving sustained high expression of the gene at the individual level. Experimental results show that under the same low-salt stress conditions, the apoptosis rate in the NFAT5-overexpressing group of *Litopenaeus monodon* was significantly lower than that in the control group, and the expression of osmolarity-regulating factors in its hepatopancreatic tissue was also significantly enhanced. This demonstrates that the NFAT5 gene plays a functional role in the low-salt stress response of *Litopenaeus monodon* and can be used as a key target gene for regulating low-salt tolerance traits in molecular breeding practices.

[0023] This invention experimentally revealed that under acute low-salt stress (salinity decreasing from 30 to 5), NFAT5 expression levels were significantly upregulated, peaking within 12-24 hours. Furthermore, a TNP nanoparticle-mediated in vivo transfection system was constructed, achieving stable overexpression of the NFAT5 gene in nauplius larvae. Experimental results showed that the NFAT5 overexpression group exhibited significantly reduced apoptosis within 24 hours of low-salt stress, indicating that this gene enhances the low-salt tolerance of Litopenaeus monodon. This research not only fills a gap in crustacean NFAT5 research but also provides an important target gene and effective technical means for molecular breeding of low-salt tolerant Litopenaeus monodon.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] (1) The full-length cDNA sequence of the NFAT5 gene of Penaeus monodon was cloned and obtained for the first time, and its protein structure, functional regions and physicochemical properties were systematically predicted and analyzed, filling the gap in basic research on this gene in this species.

[0026] (2) This invention uses RACE technology and bioinformatics analysis to determine that the gene has a typical osmotic pressure regulatory domain, which provides an important molecular basis for studying the osmotic pressure regulation mechanism of Penaeus monodon.

[0027] (3) This invention provides an effective means and practical path for future molecular breeding strategies based on NFAT5 by constructing an NFAT5 gene overexpression system and verifying its function in enhancing the survival rate of Penaeus monodon under low salt stress. Attached Figure Description

[0028] Figure 1 shows the Sanger sequencing results and amino acid translation sequence comparison of the full-length cDNA of the NFAT5 gene in Penaeus monodon in Example 1.

[0029] Figure 2 shows the alignment of RACE sequencing with the predicted sequence of the NCBI LOC119595622 gene in Example 1;

[0030] Figure 3 shows the expression profile of the NFAT5 gene in different tissues of Penaeus monodon in Example 1.

[0031] Figure 4 shows the gene expression level analysis of NFAT5 under low salt stress in Example 1;

[0032] Figure 5 shows the results of in vivo overexpression of the full-length NFAT5 gene in nauplius dwarf shrimp under low salt stress and verification by fluorescent probe labeling in Example 1. Detailed Implementation

[0033] The application method of the present invention is further illustrated below with reference to specific embodiments. The following embodiments and accompanying drawings are for illustrative purposes only and should not be construed as limiting the present invention. Unless otherwise specified, the reagents used in the following embodiments are commercially available biological reagents, and the experimental instruments used are standard laboratory instruments. Unless otherwise specified, the methods and equipment used in the following embodiments are methods and equipment conventionally used in the art.

[0034] Example 1: Obtaining the NFAT5 gene from Penaeus monodon

[0035] 1. Experimental Materials

[0036] 1.1 Laboratory Animals

[0037] The tiger prawns were taken from the Shenzhen experimental base of the South China Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences. Prawns with a body length of 9.14±0.79cm and a body weight of 13.42±0.52g were selected and temporarily raised in natural seawater cement ponds with full aeration. The culture temperature was controlled at 28±2℃. The materials used in the experiment were screened to confirm that they were healthy and not in the molting period.

[0038] 1.2 Experimental Instruments and Reagents

[0039] The reagents used in this experiment, including TransScript® 5' / 3' RACE Kit, 2×Magic Green Taq SuperMix, SYBR Green Pro Taq HS Premixed qPCR Kit II, SteadyPure Universal RNA Extraction Kit II, and Evo M-MLV Reverse Transcription Premixed Kit (containing gDNA removal reagent for qPCR) Ver.2, were purchased from companies such as Acrel, TransGen, and Tolo Harbour. Electrophoresis apparatus, PCR amplification instrument, NanoDrop 2000 spectrophotometer, and gel imaging system were standard laboratory equipment.

[0040] 2. Experimental Methods

[0041] 2.1 Total RNA extraction and cDNA library construction

[0042] Samples were taken from the gills, hepatopancreas, intestines, stomach, heart, muscle, and eyestalks of Penaeus monodon. Total RNA was extracted using the SteadyPure Universal RNA Extraction Kit II. RNA purity was determined using NanoDrop 2000. After examining the integrity of the 28S / 18S bands by electrophoresis, cDNA libraries were constructed using the Evo M-MLV Reverse Transcription Premix Kit for subsequent cloning and expression detection.

[0043] 2.2 NFAT5 cDNA Cloning and Sequence Analysis

[0044] After obtaining RNA from various tissues and assessing its quality, RNA samples with high purity and integrity from hepatopancreatic tissues were selected. The 5′ / 3′ ends of the NFAT5 gene in *Litopenaeus monodon* were amplified using the TransScript® 5′ / 3′ RACE Kit (TransGen Biotech). First, using 2 μg of total RNA as a template, 5′-RACE and 3′-RACE-specific cDNAs were constructed via reverse transcription. Subsequently, nested PCR was used for specific amplification. The GSP1 / GSP2 primers (GSP-1-NFAT5-3F, GSP-1-NFAT5-5R, GSP-2-NFAT5-3F, GSP-2-NFAT5-5R) were designed based on the core transcript sequence and optimized using gradient PCR with Magic Green Taq. SuperMix achieves high-fidelity amplification reactions; the amplification reaction system and procedure were strictly performed according to the manufacturer's recommended conditions. The 5′-RACE fragment was approximately 1.2 kb, and the 3′-RACE fragment was approximately 1.6 kb. Agarose gel electrophoresis showed clear bands with good specificity. The PCR-purified products were sent for Sanger sequencing, and the final assembly yielded the full-length cDNA sequence of NFAT5. See details... Figure 1 The final spliced ​​NFAT5 cDNA full-length sequence was 2427 bp, with a 5′UTR of 72 bp, a 3′UTR of 312 bp (including a typical poly(A) tail of about 30 bp), and an open reading frame (ORF) of 1740 bp (SEQ ID NO: 1), encoding 580 amino acids (SEQ ID NO: 2).

[0045] in:

[0046] The nucleotide sequence of the NFAT5 gene in Penaeus monodon:

[0047]

[0048] Amino acid sequence of the protein encoded by the Penaeus monodon NFAT5 gene:

[0049] MWYNICLCIMADCCMVQRFLGWKQSLASGCSSIFTQVVESKVTVNGKRLHVDINGDEAQELPASKGTSSTPPIPPLISFRDVSLLSSIQAFQGNNTSTSLLCVDGTPQPCNRNTKVLRQTISQGNPPLTAQLSSLSSDGKVELSLVLQPEEQHRARYQTEGSRGAVKDRSGLGHPTVKLFGYNKATTLQVFVGSDSGKTGPHMFYQVCRVSGKNSTPCKERRIDGTAIIEAQLEPENDMTMSCDCVGILKERNVDVEHRFKAVVSRGRKKSTKCRLVFRTCITLSNGAQETLQVVSQPIACTQPPGVPEISRKSLEKCPVTGGEEMFIFGKNFLKDTIVTFQQNGAKSQPIWEEKVSPDPETLQPIHLIVTVPKYYDQNITEEVTVQMLVSSGGKVSEPHSLTYYPLVTKKELPPPEPLEEKTLPKGVSPSALQLNLQYAETRSLPVLMPEAPGPAVVSQSSPIKISQASTSPVPGPAVMQQTMRVSRFPVNSAAGKKPISRPQRSSARIPKGKVSPGRTSMLGGGVSVQPESVLSSVPSAESNDMDVKEEETYIDENGSKMTLQKQSVSRHSQPRELS* (SEQ ID NO:2);

[0050] GSP-1-NFAT5-3F: gtgttccgtacctgcattaccctcagca, as shown in SEQ ID NO: 3;

[0051] GSP-1-NFAT5-5R: gcagtcagaggagggttcccctgagata, as shown in SEQ ID NO: 4;

[0052] GSP-2-NFAT5-3F: gccgcaagaagagtaccaagtgccgtc, as shown in SEQ ID NO: 5;

[0053] GSP-2-NFAT5-5R: caccttgccatcagaggacagcgatgac, as shown in SEQ ID NO: 6.

[0054] Using the ExPASy ProtParam tool, the theoretical molecular weight of this protein is predicted to be 142.94 kDa, and the theoretical isoelectric point (pI) is 4.94. The domain predictions from SMART and INTERPRO are consistent: amino acid positions 123 to 306 of the NFAT5 protein constitute a highly conserved Rel Homology Domain (RHD) with a typical β-sheet-α-helix-β-sheet structure, which mediates the protein's DNA binding and nuclear localization functions; amino acid positions 306 to 404 constitute an osmotic pressure-responsive transcriptional activation region (IPTMEGA2), rich in serine, threonine, and acidic residues; a total of 10 phosphorylation sites located at serine / threonine residues were predicted in the NFAT5 protein sequence, along with two low-complexity structural regions, whose domain distribution is shown below. Figure 1 As shown, multiple sequence alignment revealed that the RHD domain in the Penaeus monodon NFAT5 protein shares 81.9% sequence identity with the corresponding region in the previously reported mouse NFAT5 protein, indicating that this domain is highly conserved during evolution and may play a key role in regulating osmotic pressure response.

[0055] Figure 2 The image shows the alignment results between the cDNA sequence of the NFAT5 gene in *Litopenaeus monodon* obtained by RACE technology in this invention and the predicted sequence of the LOC119595622 gene in the NCBI database. The alignment shows that there are significant differences between the two at multiple base sites, manifested as multiple single nucleotide variants (SNPs), such as A / G and A / C types. Some mutation sites involve coding regions and may cause changes in amino acid residues. At the same time, the prediction sequence in the database also has deviations in the definition of transcription start and termination positions. The predicted transcript length does not match the open reading frame cDNA sequence (1740 bp) obtained by this invention through 5′ / 3′ RACE experiments. This further verifies the experimental accuracy and species specificity of the full-length NFAT5 sequence obtained by this invention.

[0056] 2.3 NFAT5 gene expression profile analysis

[0057] In the tissue expression profile analysis of the NFAT5 gene in Penaeus monodon, multiple tissues including gills, hepatopancreas, intestine, stomach, heart, muscle, and stalk nerve were collected. The mRNA expression level of NFAT5 was detected by qRT-PCR. The SYBR Green method was used for relative quantification, with EF-1α and β-Actin as internal controls. All samples were tested in triplicate.

[0058] in:

[0059] The primers used for qRT-PCR are:

[0060] NFAT5-F: ttgtgactgtgttggcatcc, SEQ ID NO: 7;

[0061] NFAT5-R: tacatgcaattggctgtgag, SEQ ID NO: 8.

[0062] The results show (see) Figure 3 NFAT5 is expressed in multiple tissues of Penaeus monodon, exhibiting significant tissue specificity. The highest expression level of NFAT5 was observed in the hepatopancreas, significantly higher than in other tissues, suggesting a potential important role in osmolarity regulation and metabolism. Moderate expression was also observed in the intestine, while expression was relatively low in the gonads and muscle. These results indicate that NFAT5 possesses high transcriptional activity in tissues related to osmolarity regulation and immune responses. (See details...) Figure 3 .

[0063] 2.4 NFAT5 gene expression under low salt stress

[0064] In a low-salt stress experiment, *Litopenaeus monodon* was randomly divided into two groups: a salinity of 30 (control) and 5 (stress group). Gills and hepatopancreas were collected at 0, 6, 12, 24, 48, and 60 hours. qPCR was used to determine the expression trend of NFAT5 (primers were the same as NFAT5-F and NFAT5-R in section 2.3). The experiment showed that NFAT5 expression in the low-salt group rapidly increased from 6 hours, reaching a peak at 12-24 hours, and then gradually decreased. (See details below.) Figure 4 .

[0065] In the study of the response mechanism to low salt stress, further transcriptomic expression profiling was conducted. Hepatocellular and pancreatic tissues were selected, and total RNA was extracted under salinity conditions of 5 and 30, respectively. Transcriptome libraries were constructed and sequenced. The results of differential expression analysis are as follows: Figure 4As shown, under salinity 5, the NFAT5 gene was significantly upregulated, with a significance level of P<0.01. Several known osmolar response genes that were co-regulated with NFAT5 (such as AQP1, AQP9, and members of the SLC family) also showed a synergistic upregulation trend, suggesting that NFAT5 may act as an upstream regulator, participating in the regulation of the expression of aquaporins and electrolyte transport-related genes, thereby mediating the adaptive response of Penaeus monodon to acute low salinity environments.

[0066] Therefore, the qPCR validation data showed that NFAT5 expression is not only time-dependent, responding rapidly in the early stages of low-salt stress and maintaining high expression levels for 12-24 hours, but may also participate in the transcriptional network that regulates cellular osmotic homeostasis by activating a series of target genes. These results collectively demonstrate the crucial role of NFAT5 in the low-salt stress of Penaeus monodon, laying a molecular foundation for subsequent functional validation and breeding applications.

[0067] 2.5 In vivo overexpression and visualization validation of the full-length NFAT5 gene in nauplius nauplius of Penaeus monodon under low salt stress conditions.

[0068] To further verify the expression ability and biocompatibility of the NFAT5 gene under low-salt stress conditions in Litopenaeus monodon, a eukaryotic expression plasmid (pCMV-NFAT5::EGFP) carrying the NFAT5 open reading frame (ORF) and fused with the EGFP reporter gene was constructed. Figure 5 The plasmid was delivered using TNP nanoparticles (patent number: ZL202411826906.9). In plasmid construction, the NFAT5 coding region was placed downstream of the CMV strong promoter, and the EGFP tag was located at the C-terminus to facilitate protein localization observation and expression efficiency evaluation. The transfection system used nanoparticle transfection to deliver the plasmid into Penaeus monodon fertilized eggs. The transfection time was set to 12 hours, followed by culture at a salinity of 15 for 24 hours.

[0069] Observation was performed using a fluorescence microscope after transfection. Figure 5 The results showed that clear green fluorescent signals were visible in multiple tissues, including the head, thorax, appendages, abdomen, and body cavity, in individuals overexpressing NFAT5. The EGFP reporter gene was stably expressed, indicating that the full-length NFAT5 mRNA was successfully transcribed and translated in multiple in vivo tissues. Further fluorescence images showed that the signal was mainly distributed in the cytoplasm and specific tissue regions, and no silencing or expression disorder was observed, indicating that the recombinant plasmid has good transcriptional stability and tissue penetration.

[0070] To assess the biocompatibility and cell integrity of NFAT5 overexpression under low-salt stress, PI (red) fluorescent dye was used to label cell nuclei and damaged cell membranes during the experiment, while observing expression efficiency. In the overexpression group larvae, PI staining signal was not enhanced in most tissues, indicating good cell membrane integrity and the absence of widespread cell damage or programmed apoptosis. These results demonstrate that in vivo expression of the full-length NFAT5 gene under low-salt stress did not significantly interfere with or cause toxicity to individual cell physiology (see details). Figure 5 ).

[0071] This invention achieves sustained high expression of the NFAT5 gene at the individual level by constructing a functional expression vector for the NFAT5 gene and introducing it into *Litopenaeus monodon*. Under the same low-salt stress conditions, compared with the wild-type control group, the survival rate of *Litopenaeus monodon* larvae in the NFAT5 overexpression group significantly increased from 60.33±0.88% to 80.00±2.08%, while the PI fluorescence intensity significantly decreased from 223.35±0.27 to 13.21±0.91, indicating a significant reduction in cell death / apoptosis levels (see...). Figure 5 This indicates that NFAT5 can alleviate cell damage, thereby improving the tolerance of Penaeus monodon to low-salt environments. This invention demonstrates that the NFAT5 gene has a clear functional role in the low-salt stress response of Penaeus monodon, and can be applied in the preparation of gene preparations or feed additives to improve the low-salt tolerance of Penaeus monodon. Furthermore, it can be used as a key target gene for regulating low-salt tolerance traits in molecular breeding practices.

[0072] Although the invention has been described in conjunction with preferred embodiments, it should be understood that the scope of protection of the invention is not limited to the embodiments described herein. Other embodiments of the invention will be readily conceived and understood by those skilled in the art in light of the description and practice of the invention disclosed herein. The description and embodiments are to be considered exemplary only, and the true scope and spirit of the invention are defined by the claims.

Claims

1. A method of improving the tolerance of Penaeus monodon to low salinity environment, characterized by, The nucleotide sequence of the Penaeus monodon NFAT5 gene introduced into the body of the Penaeus monodon, so that the Penaeus monodon NFAT5 gene is overexpressed in the Penaeus monodon, the nucleotide sequence of the Penaeus monodon NFAT5 gene is shown as SEQ ID NO: 1, and the protein encoded by the Penaeus monodon NFAT5 gene has an amino acid sequence shown as SEQ ID NO:

2.

2. Application of the Penaeus monodon NFAT5 gene, the protein encoded by the Penaeus monodon NFAT5 gene, the recombinant expression vector containing the Penaeus monodon NFAT5 gene or the host cell in improving the low salt tolerance of the Penaeus monodon, the nucleotide sequence of the Penaeus monodon NFAT5 gene is shown as SEQ ID NO: 1, and the protein encoded by the Penaeus monodon NFAT5 gene has an amino acid sequence shown as SEQ ID NO: 2.

Images