Method for identifying authenticity of DNA degradation type bulbus fritillariae cirrhosae based on digital PCR (Polymerase Chain Reaction) technology

Abstract

The invention discloses a method for identifying authenticity of DNA (Deoxyribose Nucleic Acid) degradation type bulbus fritillariae cirrhosae based on a digital PCR (Polymerase Chain Reaction) technology. The method comprises the following specific steps: S1, extracting DNA of a sample to be detected; s2, by taking the DNA as a template, carrying out digital PCR amplification reaction by utilizing a specific primer pair and a probe designed in an ITS2 region; and S3, according to the result of the digital PCR, identifying the fritillaria species of the sample to be detected. The invention provides a method which is high in sensitivity and strong in specificity, can directly and qualitatively detect the degradation of the DNA of the bulbus fritillariae cirrhosae, and can be used for quickly and accurately identifying the authenticity of the bulbus fritillariae cirrhosae.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of traditional Chinese medicinal material molecular identification, and particularly relates to a DNA degradation type Fritillaria cirrhosa D.Don identification method based on digital PCR technology. BACKGROUND

[0002] Fritillaria is a genus of the Liliaceae family, with about 140 species, mainly distributed in the temperate regions of the northern hemisphere. There are about 24 species of Fritillaria in China, the most common of which are Fritillaria cirrhosa D.Don, Fritillaria thunbergii Miq., Fritillaria delavayi Franch., Fritillaria walujewii Prokh., Fritillaria hupehensis Hsiao, etc. Among them, Fritillaria cirrhosa D.Don is one of the traditional Chinese herbal medicines, with a long history of medicinal use and significant clinical efficacy, and has been called "cough-relieving saint" in Chinese history. According to the 2020 edition of Chinese Pharmacopoeia, Fritillaria cirrhosa D.Don is the dried bulb of Fritillaria delavayi Franch., Fritillaria walujewii Prokh., Fritillaria thunbergii Miq., Fritillaria cirrhosa D.Don, Fritillaria walujewii Prokh., and Fritillaria walujewii Prokh., with the functions of clearing heat and moistening lung, resolving phlegm and relieving cough, and resolving mass and eliminating abscess. However, due to the scarcity of wild resources and long growth cycle, the price is relatively high. Counterfeit products are rampant in the market, which not only seriously disrupts the market order, but also affects the clinical efficacy. Therefore, it is crucial to accurately distinguish Fritillaria cirrhosa D.Don and its adulterants. Fritillaria cirrhosa

[0003] Traditional identification methods of Fritillaria cirrhosa D.Don include morphological identification, microscopic identification, physicochemical experiments, chromatographic and spectral analysis, etc. At the same time, molecular techniques are increasingly widely used in the field of traditional Chinese medicinal material identification due to their high accuracy and specificity. Ordinary PCR reaction, nested PCR reaction, real-time fluorescent quantitative PCR, etc. are common molecular level identification techniques. These techniques have been successfully applied to the identification of many traditional Chinese medicinal materials such as Dendrobium, Paris, Salvia miltiorrhiza, and Arnebia. However, for those medicinal materials that have been placed for a long time and whose DNA has been degraded due to poor storage conditions, conventional molecular identification techniques may fail to identify them. In addition, although nested PCR has certain advantages in identification, its operation process is relatively complex, and contamination problems are likely to occur during the experiment, which to some extent limits its widespread application. Therefore, for medicinal materials that do not have complete morphological appearance and whose DNA is severely degraded, there is an urgent need for a rapid, simple, accurate and highly sensitive identification method.

[0004] ​At present, the method for identifying the authenticity of Fritillaria cirrhosa is mostly to use conventional PCR method for molecular identification, for example, patent CN118667995A discloses a multiplex PCR primer, method and application for identifying and adulteration detection of Fritillaria cirrhosa, the primer for identifying Fritillaria cirrhosa can quickly and accurately identify Fritillaria cirrhosa, distinguish it from common adulterants such as Fritillaria thunbergii, Fritillaria delavayi, Fritillaria iliensis, Fritillaria walujewii and Fritillaria hupehensis, and can effectively detect adulterated samples of Fritillaria cirrhosa, and the identification and adulteration detection of Fritillaria cirrhosa can be realized through PCR process; CN108265122A discloses a primer for identifying the authenticity of Fritillaria cirrhosa and its application in identifying the authenticity of Fritillaria cirrhosa, and the prior art mostly uses conventional PCR method to molecularly identify the authenticity of Fritillaria cirrhosa, and due to the problems of sample pollution and complicated detection in conventional PCR technology, the application of the conventional PCR technology in Fritillaria cirrhosa detection may cause inaccurate inspection results, especially for degraded Fritillaria cirrhosa, which increases the difficulty of identification.

[0005] And digital PCR (dPCR) as a new molecular detection technology in the field of disease diagnosis, transgenic detection and food safety supervision. The technology is to divide the sample and the amplification reaction system into a large number of small compartments, such as droplets or micropores, and to analyze each compartment independently after the amplification reaction is completed. A small amount of DNA in the droplet can also be amplified and detected. dPCR is considered to have high sensitivity and can detect and quantify low copy number target nucleic acids. Moreover, the design of probes and primers for target DNA increases the specificity of the method. Therefore, based on its high sensitivity and accuracy, it has attracted more and more attention, but no researcher has applied digital PCR technology to the authenticity identification technology of degraded Fritillaria cirrhosa.

[0006] In summary, it is urgent to establish a method for identifying the authenticity of DNA-degraded Fritillaria cirrhosa, breaking through the bottleneck of the prior art, and providing an effective technical means for accurate identification of DNA-degraded samples. SUMMARY

[0007] The present application aims to overcome the shortcomings of the prior art, and provide a method for directly and qualitatively detecting the degradation of Fritillaria cirrhosa DNA, which has high sensitivity and specificity, and can quickly and accurately identify the authenticity of Fritillaria cirrhosa.

[0008] The purpose of the present application is achieved by the following technical solutions: The method for identifying the authenticity of DNA-degraded Fritillaria cirrhosa based on digital PCR technology, the specific steps comprising: S1. Extracting the DNA of the sample to be tested; S2. Using the specific primer pair and probe designed for the ITS2 region to perform the digital PCR amplification reaction with the DNA as the template; S3. Identifying the Fritillaria species of the sample to be tested according to the result of the digital PCR; The sample to be tested includes Fritillaria samples with long storage time and degraded DNA due to poor storage conditions.

[0009] Specifically, the universal primer includes: Upstream primer: ITS2-F: 5'-ATGCGATACTTGGTGTGA-3'; Downstream primer: ITS2-R: 5'-GACGCTTCTCCAGACTACAAT-3'; Upstream primer: Mini-1F: 5'-TCACGCCTTGTTTCGCT-3'; Downstream primer: Mini-1R: 5'-CGACAGCCCGCGCTTAA-3'; Upstream primer: Mini-2F: 5'-TCCCGTGAACCATCGAG-3'; Downstream primer: Mini-2R: 5'-CACTCGTCGTGCCCAT-3'; The specific primer includes: C-P26: CACTATGCCCGCCCTACC; C-RP2: AGTCGTATGGATAGAGAGCGAACGC; Specifically, the probe is: Probe: TZ: FAM-CCGCAGAGGCGTTGACGTGCGT-BHQ1; Specifically, the reaction procedure of the digital PCR amplification reaction in S2 includes: 95℃ pre-denaturation for 90 s; then 40 cycles of amplification, each cycle including 94℃ denaturation for 30 s, annealing at 61℃ for 30 s, annealing at 60℃ for 30 s, annealing at 59℃ for 30 s, and annealing at 58℃ for 30 s; Specifically, the concentration of the primer pair in the reaction system in S2 is 0.4-1.0 μmol / L; Specifically, the concentration of the probe in the reaction system in S2 is 0.1-0.4 μmol / L; Preferably, the concentration of the primer pair in the reaction system is 0.6 μmol / L, and the concentration of the probe in the reaction system is 0.2 μmol / L; Specifically, the reaction system of the digital PCR amplification reaction in step S2 is 30 muL, including: 6 muL HiTaqMix (23027)-A, 1.5 muL HiTaq Mix (23027)-B, the primer with a concentration of 0.4-1.0 mu mol / L, the probe with a concentration of 0.1-0.4 mu mol / L and 1 muL DNA extraction solution.

[0010] Specifically, the primer pair and the probe in step S2 are designed based on the ITS2 sequences of Fritillaria cirrhosa, Fritillaria atropurpurea, Fritillaria przewalskii, Fritillaria unibracteata, Fritillaria taipaiensis, Fritillaria walujewii, Fritillaria iliensis, Fritillaria delavayi, Fritillaria thunbergii and Fritillaria hupehensis after alignment, and can distinguish different Fritillaria species; Specifically, the primer pair and the probe are designed for the ITS2 region of Fritillaria plants, and the design method comprises: Obtaining ITS2 sequences of a plurality of Fritillaria species, the Fritillaria species including Fritillaria cirrhosa, Fritillaria atropurpurea, Fritillaria przewalskii, Fritillaria unibracteata, Fritillaria taipaiensis, Fritillaria walujewii, Fritillaria iliensis, Fritillaria delavayi, Fritillaria thunbergii and Fritillaria hupehensis; Aligning the ITS2 sequences using SnapGene software; According to the sequence difference, a universal primer, a specific primer and a probe capable of distinguishing different Fritillaria species are designed.

[0011] On the other hand, the application is applied to the identification of degraded Fritillaria cirrhosa, species identification or quality control of traditional Chinese medicinal materials.

[0012] The beneficial effects of the application are: (1) High specificity: the specific primer is used to directly and simply identify Fritillaria cirrhosa medicinal materials, and the specificity of the dPCR detection method is evaluated.

[0013] (2) High sensitivity: the dPCR technology can divide the reaction system into tens of thousands of independent microdroplets, each microdroplet corresponds to an independent PCR reaction unit, and the qualitative detection of trace nucleic acids can be realized.

[0014] (3) Simple operation: the method is more simple in technical operation, in order to overcome the shortcomings of complex operation and easy pollution of nested PCR. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The images of the 25 test samples in examples 1-5 are shown in the following table: Figure 2Establishment of microdroplet digital PCR system in Example 3 (a: investigation of annealing temperature; b: investigation of primer and probe concentration; the primer concentration of A-D is 0.4 μmol / L, and the probe concentration is 0.1, 0.2, 0.3, and 0.4 μmol / L, respectively; the primer concentration of E-H is 0.6 μmol / L, and the probe concentration is 0.1, 0.2, 0.3, and 0.4 μmol / L, respectively; the primer concentration of I-L is 0.8 μmol / L, and the probe concentration is 0.1, 0.2, 0.3, and 0.4 μmol / L, respectively; the primer concentration of M-P is 1.0 μmol / L, and the probe concentration is 0.1, 0.2, 0.3, and 0.4 μmol / L, respectively; NOPD is the abbreviation of the number of positive droplets); Figure 3 Scatter plot of microdroplets for 25-sample-specific analysis in Example 4; Figure 4 Agarose gel electrophoresis diagram of 25-sample amplification by conventional PCR in Example 5 (a, b, and c are agarose gel electrophoresis diagrams of 500-base-pair DNA fragments; d, e, and f are agarose gel electrophoresis diagrams of 100-base-pair DNA fragments); Figure 5 Sequencing results of the 5 experimental samples in Example 5. DETAILED DESCRIPTION

[0016] The technical solutions of the present application will be described in further detail below with reference to the accompanying drawings, but the scope of protection of the present application is not limited to the following description.

[0017] Example 1: Extraction of DNA from the sample to be tested The steps for extracting DNA from the sample to be tested include: (1) Sample grinding: grind the dried bulb sample of Fritillaria cirrhosa into fine powder.

[0018] (2) Cell lysis: use lysis solution to destroy cell walls and cell membranes and release DNA.

[0019] (3) Removal of impurities: remove interfering substances such as proteins, polysaccharides, and pigments by centrifugation or column purification.

[0020] (4) DNA washing and elution: wash the DNA with washing solution, and finally dissolve the purified DNA with elution solution or sterile water.

[0021] Example 2: Design and synthesis of primers and probes The ITS2 regions of the following fritillaria species were downloaded from the NCBI database: Fritillaria cirrhosa (KF906207.1), Fritillaria thunbergii (HQ448866.1), Fritillaria cirrhosa (KF906210.1), Fritillaria thunbergii (GQ205130.1), Fritillaria taibaiense (HM045470.1), Fritillaria wabuense (GQ205131.1), Fritillaria yiliense (HQ010405.1), Fritillaria pingsense (DQ191622.1), Fritillaria thunbergii (HQ448863.1), and Fritillaria hupehensis (KF906203.1). Sequence alignment was performed using SnapGene software. Based on the sequence differences, the following primer and probe sequences were designed and obtained: Table 1 Primer and probe sequences Example 3: Establishment and Optimization of Digital PCR System In the establishment of digital PCR, this application first designed a pair of specific primers (C-P26 / C-RP2) and a probe (TZ), and conducted preliminary explorations using real-time quantitative PCR at temperatures calculated by SnapGene software to ensure the feasibility and specificity of the primers and probe. Based on this, a digital PCR amplification system was established. To determine the annealing temperature for digital PCR, this experiment optimized the annealing temperature by comparing the number and distribution of positive droplets generated by dPCR, as well as the fluorescence signal intensity, while maintaining a fixed reaction system and other amplification conditions. The results showed that ( Figure 2 a) When the annealing temperature was set to 58℃ and 59℃, the amplification efficiency was good, with positive droplet counts reaching 3180 and 3248 respectively, which was relatively high. After determining the annealing temperature, 16 sets of primer and probe combinations with different concentrations were further set up, and dPCR amplification experiments were conducted to investigate the primer and probe concentrations. The results showed that ( Figure 2 (b) Two combinations of primer concentrations of 0.4 μmol / L and probe concentrations of 0.4 μmol / L, and primer concentrations of 0.6 μmol / L and probe concentrations of 0.4 μmol / L, showed good amplification efficiency. The reaction program included pre-denaturation at 95℃ for 90 s, followed by 40 cycles of amplification, each cycle including denaturation at 94℃ for 30 s, and annealing for 30 s at four temperature gradients of 58℃, 59℃, 60℃, and 61℃. The reaction system was 30 μL, containing 6 μL HiTaq Mix (23027)-A, 1.5 μL HiTaq Mix (23027)-B, 1 μL DNA extraction buffer, primers, and probes.

[0022] Example 4: Identification of 25 samples based on microdroplet digital PCR In this study, the extremely high sensitivity of digital PCR was fully utilized for sample identification, with a focus on qualitative results. From Figure 3 As can be seen, no positive droplets were detected in samples 13 and 22, as well as the negative control (NC), indicating that these samples are not Fritillaria cirrhosa. The remaining 23 samples all showed varying numbers of positive droplets. This indicates that even DNA templates that had undergone varying degrees of degradation successfully bound to the specific primers and probes and were amplified. Therefore, these samples can be qualitatively identified as Fritillaria cirrhosa. These positive samples included old samples with long storage times and severely degraded DNA, yet this method was still able to detect them effectively. This demonstrates that this specific primer, probe, and digital PCR system has good detection specificity for Fritillaria cirrhosa with degraded DNA.

[0023] Example 5: Validation of Conventional PCR Depend on Figure 4 As shown, all samples exhibited bright and single amplified bands on agarose gels. Sequencing results revealed that sample 13 was *Fritillaria yiliense*, sample 22 was *Fritillaria pingshen*, and the rest were *Fritillaria chuanxiong*. Figure 5 The results are consistent with those obtained using digital PCR in our previous study. Samples 13 and 22, which were negative by digital PCR (no positive droplets), were confirmed by sequencing to be non-target species (Fritillaria yiliense and Fritillaria pingsense); while the remaining samples that were positive by digital PCR (with positive droplets) were confirmed to be Fritillaria chuanxiong. This one-to-one correspondence confirms the accuracy of the digital PCR method in species-specific identification. The comparative results show that the qualitative discrimination results of the digital PCR detection system based on specific primers / probes are as reliable as those of sequencing identification based on DNA barcoding, verifying the high specificity of the designed primers and probes, and proving that the digital PCR method can achieve or even surpass the identification accuracy of conventional molecular identification techniques when dealing with DNA-degraded samples. The verification results of conventional PCR and sequencing fully confirm the accuracy and reliability of the digital PCR method established in this study for identifying DNA-degraded Fritillaria chuanxiong, providing data support for its application in practical identification work.

[0024] The above description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or related technologies or knowledge. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.

Claims

1. A method for identifying the authenticity of DNA-degraded Fritillaria cirrhosa based on digital PCR technology, characterized in that, The specific steps include: S1. Extract the DNA from the sample to be tested; S2. Using the DNA as a template, perform the digital PCR amplification reaction using primers and probes designed for the ITS2 region; S3. Based on the results of the digital PCR, identify the Fritillaria species of the sample to be tested; The samples to be tested include fritillaria samples that have been stored for a long time and whose DNA has degraded due to poor storage conditions.

2. The identification method according to claim 1, characterized in that, The primers include: universal primers and specific primers; The universal primers include: Upstream primer: ITS2-F: 5′-ATGCGATACTTGGTGTGA-3′; Downstream primer: ITS2-R: 5′-GACGCTTCTCCAGACTACAAT-3′; Upstream primer: Mini-1F: 5′-TCACGCCTTGTTTCGCT-3′; Downstream primer: Mini-1R: 5′-CGACAGCCCGCGCTTAA-3′; Upstream primer: Mini-2F: 5′-TCCCGTGAACCATCGAG-3′; Downstream primer: Mini-2R: 5′-CACTCGTCGTGCCCAT-3′; The upstream primer Mini-1F and the downstream primer Mini-1R are 106 bp in length; The specific primers include: C-P26: CACTATGCCCGCCCTACC; C-RP2: AGTCGTATGGATAGAGAGCGAACGC.

3. The identification method according to claim 1, characterized in that, The probe is: The probe: TZ: FAM-CCGCAGAGGCGTTGACGTGCGT-BHQ1.

4. The identification method according to claim 1, characterized in that: The reaction procedure for the digital PCR amplification reaction described in S2 includes: pre-denaturation at 95°C for 90 s; followed by 40 cycles of amplification, each cycle including denaturation at 94°C for 30 s, annealing at 61°C for 30 s, annealing at 60°C for 30 s, annealing at 59°C for 30 s, and annealing at 58°C for 30 s.

5. The identification method according to claim 1, characterized in that: The concentration of the primer pair described in S2 in the reaction system is 0.4-1.0 μmol / L.

6. The identification method according to claim 1, characterized in that, The concentration of the probe in the reaction system is 0.1-0.4 μmol / L.

7. The identification method according to claim 1, characterized in that: The reaction system for the digital PCR amplification reaction in step S2 is 30 μL, comprising: 6 μL HiTaq Mix (23027)-A, 1.5 μL HiTaq Mix (23027)-B, the primers at a concentration of 0.4-1.0 μmol / L, the probe at a concentration of 0.1-0.4 μmol / L, and 1 μL DNA extraction solution.

8. The identification method according to claim 1, characterized in that: The primer pairs and probes described in step S2 are designed based on the ITS2 sequences of Fritillaria cirrhosa, Fritillaria pumilum, Fritillaria gansuense, Fritillaria sambar formosana, Fritillaria taibaiensis, Fritillaria wabuensis, Fritillaria yiliensis, Fritillaria pingshen, Fritillaria thunbergii, and Fritillaria hupehensis.

9. The identification method according to claim 1, characterized in that: The ITS2 sequence was compared using SnapGene software in S2.

10. The application of the identification method according to any one of claims 1-9 in the identification of authenticity, species identification, or quality control of degradable Fritillaria cirrhosa in traditional Chinese medicine.

Images