LAMP (loop-mediated isothermal amplification) specific primer group for identifying corn cyst nematode and application of LAMP specific primer group

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) specific primer group for identifying corn cyst nematode and application of the LAMP specific primer group. The LAMP specific primer group can be used for identifying the corn cyst nematode. The method comprises the following steps: carrying out loop-mediated isothermal amplification by taking genome DNA (Deoxyribose Nucleic Acid) of a nematode to be detected as a template and adopting a specific LAMP primer group; after the reaction is finished, carrying out agarose gel electrophoresis on an amplification product, or carrying out SYBR Green I chromogenic reaction on an amplification reaction product, or carrying out lateral flow chromatography test strip reaction on the amplification reaction product, and then judging whether the nematode to be detected is the corn cyst nematode or not. According to the LAMP method, the corn cyst nematode can be quickly, simply, conveniently and directly detected according to the color of a reaction system and the number of indication lines of the lateral flow chromatography test strip. The primer group disclosed by the invention is strong in specificity and high in sensitivity, the detection threshold value of a single cyst of the corn cyst nematode is 1 * 10 <-4 > cyst, and the detection threshold value of a single larva is 1 * 10 <-3 > larva.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a LAMP specific primer set for identifying Globodera zeae and application thereof. BACKGROUND

[0002] Globodera is an important group of sedentary semi-endoparasitic nematodes that seriously harm various crops. Globodera zeae invades the root system of corn to establish a feeding site, hinders the transport of water and nutrients in the root system, and causes symptoms such as poor root development, slow growth, and yellowing of leaves. The nematode seriously threatens the yield and quality of corn and has an impact on multiple corn planting areas. Studies have shown that 5-6 larvae per gram of soil in Indian fields can cause a 21-29% decrease in corn yield, causing 1-15% economic loss to American corn, and has been listed as a nematode with high economic impact potential in the United States.

[0003] Globodera zeae has become an important pathogen of crops in tropical and subtropical regions. The distribution range of Globodera zeae in China is continuously advancing northward, from the original tropical and subtropical occurrence area to the Huanghuaihai and other temperate corn planting areas. Since traditional morphological detection of Globodera zeae is time-consuming and has limited accuracy, and traditional molecular detection requires professional equipment, it is urgent to establish a rapid and simple detection technology for Globodera zeae. Loop-mediated isothermal amplification (LAMP) is a new nucleic acid amplification method developed by Notomi et al. in 2000. This technology can achieve exponential amplification of target DNA at a constant temperature, and has the advantages of high efficiency, rapidness, and strong specificity. At the same time, LAMP has lower requirements for experimental equipment and does not require complex thermal cyclers, so it is particularly suitable for field detection and has broad application prospects in the field of rapid pathogen detection. SUMMARY

[0004] In view of the problems and deficiencies in the prior art, the purpose of the present application is to provide a specific primer for identifying Globodera zeae, which harms various crops, and application thereof.

[0005] To achieve the purpose of the application, the first aspect of the present application provides a LAMP specific primer set for identifying Globodera zeae, which consists of primer Hz-F3, primer Hz-B3, primer Hz-FIP, primer Hz-BIP, and primer Hz-LB. The nucleotide sequences of the primer Hz-F3, primer Hz-B3, primer Hz-FIP, primer Hz-BIP, and primer Hz-LB are as follows:

[0006] Primer Hz-F3: 5'-CGAAGAGATCAGTGTAGATGA-3', (SEQ ID No. 1)

[0007] Primer Hz-B3: 5'-CAATCAGTTGGCCTTCCG-3', (SEQ ID No. 2)

[0008] Primer Hz-FIP:

[0009] 5'-CGTCGAACAGAGTCGATTTTTTTGTCAACAGTTTATACATGGAATTTACG-3', (SEQ ID No. 3)

[0010] Primer Hz-BIP: 5'-AAGTGAAAGCCATTACTTTCACAGAGATGTCTGTGGTTGCTGG-3',

[0011] (SEQ ID No. 4)

[0012] Primer Hz-LB: 5'-AAAGCGCCACACGAAAAACAA-3'. (SEQ ID No. 5)

[0013] The 5' end of the primer Hz-FIP and the primer Hz-BIP is respectively added with a biotin modification and a fluorescent modification.

[0014] The 5' end of the primer Hz-FIP is added with a biotin label Biotin, and the 5' end of the primer Hz-BIP is added with a fluorescent label 6-FAM; and are respectively named as:

[0015] Primer Hz-FIP-P:

[0016] 5'-Biotin-CGTCGAACAGAGTCGATTTTTTTGTCAACAGTTTATACATGGAATTTACG-3',

[0017] Primer Hz-BIP-P:

[0018] 5'-6-FAM-AAGTGAAAGCCATTACTTTCACAGAGATGTCTGTGGTTGCTGG-3'.

[0019] The second aspect of the present application provides a kit containing the specific primer set.

[0020] According to the kit, preferably, the kit further contains a fluorescent color developing agent and a lateral flow chromatographic test strip.

[0021] More preferably, the fluorescent chromogenic agent is SYBR Green I, and the lateral flow chromatographic test strip is a Hybridetect test strip.

[0022] The molar ratio of the specific primer set in the kit: primer Hz-F3, primer Hz-B3, primer Hz-FIP, primer Hz-BIP and primer Hz-LB is 1:1:8:8:2.

[0023] The third aspect of the present application provides the use of the above-mentioned specific primer set or the above-mentioned kit in any one of the following:

[0024] (A1) in identifying or assisting in identifying the corn cyst nematode that can harm grain crops;

[0025] (A2) in the preparation of a product for identifying or assisting in identifying the corn cyst nematode;

[0026] (A3) in identifying or assisting in identifying whether the test nematode is a corn cyst nematode;

[0027] (A4) in the preparation of a product for identifying or assisting in identifying whether the test nematode is a corn cyst nematode;

[0028] (A5) in identifying or assisting in identifying whether the test sample contains a corn cyst nematode;

[0029] (A6) in the preparation of a product for identifying or assisting in identifying whether the test sample contains a corn cyst nematode;

[0030] (A7) in the prevention, monitoring and / or early warning of corn cyst nematode disease.

[0031] The fourth aspect of the present application provides a method for identifying or assisting in identifying whether the test nematode is a corn cyst nematode, comprising the following steps:

[0032] (1) extracting the genomic DNA of the test nematode;

[0033] (2) using the above-mentioned specific primer set to perform loop-mediated isothermal amplification reaction with the genomic DNA as the template;

[0034] (3) result determination: after the reaction is completed, whether the test nematode is a corn cyst nematode is determined by whether the amplification reaction product presents ladder-like bands after agarose gel electrophoresis; or whether the test nematode is a corn cyst nematode that can infect crops is determined by the color of the reaction system after the amplification reaction product is subjected to SYBR Green I chromogenic reaction; or whether the test nematode is a corn cyst nematode is determined by the number of lines presented after the amplification reaction product is subjected to Hybridetect lateral flow chromatographic test strip chromogenic reaction.

[0035] wherein whether the to-be-tested nematode is the corn cyst nematode is determined by whether ladder-like bands appear after agarose gel electrophoresis of the amplification reaction product, specifically: after the loop-mediated isothermal amplification reaction ends, 5 μL of the amplification product is loaded on a 1.5% agarose gel, 130 V, 30 min, and after electrophoresis, the gel is imaged to observe the bands. If the electrophoretic bands present ladder-like bands, the to-be-tested nematode is determined to be the corn cyst nematode, otherwise it is not the corn cyst nematode.

[0036] wherein whether the to-be-tested nematode is the corn cyst nematode is determined by the color of the reaction system after the amplification reaction product is subjected to SYBR Green I color development, specifically: after the loop-mediated isothermal amplification reaction ends, SYBR Green I is added to the amplification reaction system for color development. If the reaction system presents green or yellow-green color, the to-be-tested nematode is or is a candidate for the corn cyst nematode; if the reaction system presents orange color, the to-be-tested nematode is or is a candidate for the non-corn cyst nematode.

[0037] wherein whether the to-be-tested nematode is the corn cyst nematode is determined by the number of bands presented by the system after the amplification reaction product is subjected to Hybridetect lateral flow chromatography test strip color development, specifically: when the reaction system is configured, primers Hz-FIP-P and primers Hz-BIP-P are used instead of primers Hz-FIP and primers Hz-BIP; after the loop-mediated isothermal amplification reaction ends, 5 μL of the amplification reaction product is diluted 20 times and dropped on the lateral flow chromatography test strip. If the lateral flow chromatography test strip presents one quality control line and one detection line, the to-be-tested nematode is or is a candidate for the corn cyst nematode; if the lateral flow chromatography test strip presents one quality control line and no detection line, the to-be-tested nematode is or is a candidate for the non-corn cyst nematode.

[0038] According to the above method, preferably, the reaction reagents contained in the loop-mediated isothermal amplification reaction system are as follows: 10 x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+ 1.5 μL, 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP each 4.0 μL, 10 μmol / L Hz-F3 and Hz-B3 each 0.5 μL, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, ddH2O to 25 μL.

[0039] According to the method, preferably, the reaction temperature of the loop-mediated isothermal amplification reaction is 60-65 DEG C, and the reaction time is 30-60 min. More preferably, the reaction temperature is 63 DEG C, and the reaction time is 60 min.

[0040] According to the method, preferably, the SYBR Green I color development reaction is specifically performed as follows: after the loop-mediated isothermal amplification is completed, 1 μL of the SYBR Green I reagent is added to the amplification reaction system, and the system is shaken and mixed.

[0041] According to the method, preferably, the Hybridetect lateral flow test strip reaction is specifically performed as follows: when the reaction system is configured, the primers Hz-FIP-P and Hz-BIP-P are used instead of the primers Hz-FIP and Hz-BIP. After the loop-mediated isothermal amplification reaction is completed, 5 μL of the amplification reaction product is diluted by 20 times, and then dropped on the lateral flow chromatography test strip, and is left for 3 min.

[0042] The fifth aspect of the present application provides a method for detecting or assisting in detecting whether a sample to be tested contains corn cyst nematode, comprising the following steps:

[0043] (1) extracting genomic DNA of the sample to be tested;

[0044] (2) using the genomic DNA as a template, and performing loop-mediated isothermal amplification reaction by using the specific primer set;

[0045] (3) result determination: after the reaction is completed, whether the sample to be tested contains corn cyst nematode is determined by whether the amplification reaction product presents ladder-like bands after agarose gel electrophoresis, or whether the sample to be tested contains corn cyst nematode is determined by the color of the reaction system after the amplification reaction product is subjected to SYBR Green I color development reaction, or whether the sample to be tested contains corn cyst nematode is determined by the number of lines presented after the amplification reaction product is subjected to Hybridetect lateral flow chromatography test strip color development reaction;

[0046] In the method, whether the sample to be tested is corn cyst nematode is determined by whether the electrophoresis bands present ladder-like bands after the loop-mediated isothermal amplification reaction is completed, 5 μL of the amplification product is loaded on 1.5% agarose gel, 130 V, 30 min, and the bands are observed by taking a picture in a gel imager after the electrophoresis is completed. If the electrophoresis bands present ladder-like bands, it is determined that the sample to be tested contains corn cyst nematode, otherwise, the sample to be tested does not contain corn cyst nematode.

[0047] The color of the reaction system after the SYBR Green I color reaction of the amplification reaction product is used to determine whether the sample to be tested contains corn cyst nematode, and the specific method is as follows: after the loop-mediated isothermal amplification reaction is completed, 1 μL of SYBR Green I reagent is added to the amplification reaction system, and the system is shaken to mix.

[0048] The number of bands of the system after the lateral flow chromatographic test strip color reaction of the amplification reaction product is used to determine whether the sample to be tested contains corn cyst nematode, and the specific method is as follows: when the reaction system is configured, the primer Hz-FIP-P and the primer Hz-BIP-P are used instead of the primer Hz-FIP and the primer Hz-BIP. After the loop-mediated isothermal amplification reaction is completed, 5 μL of the amplification reaction product is diluted 20 times and then dropped on the lateral flow chromatographic test strip. If the lateral flow chromatographic test strip presents one quality control line and one detection line, the sample to be tested contains corn cyst nematode; if the lateral flow chromatographic test strip presents one quality control line and no detection line, the sample to be tested does not contain corn cyst nematode.

[0049] According to the above method, preferably, the reaction reagents contained in the loop-mediated isothermal amplification reaction system are as follows: 10 x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+ 1.5 μL, 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP each 4.0 μL, 10 μmol / L Hz-F3 and Hz-B3 each 0.5 μL, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, ddH2O to 25 μL.

[0050] According to the above method, preferably, the reaction temperature of the loop-mediated isothermal amplification reaction is 60-65°C, and the reaction time is 30-60 min. More preferably, the reaction temperature is 63°C, and the reaction time is 60 min.

[0051] According to the above method, preferably, the specific operation of the SYBR Green I color reaction is as follows: after the loop-mediated isothermal amplification is completed, 1 μL of SYBR Green I reagent is added to the amplification reaction system, and the system is shaken to mix.

[0052] According to the method, preferably, the Hybridetect lateral flow test strip reaction is specifically operated as follows: when the reaction system is configured, the primer Hz-FIP-P and the primer Hz-BIP-P are used instead of the primer Hz-FIP and the primer Hz-BIP. After the loop-mediated isothermal amplification reaction is completed, 5 μL of the amplification reaction product is diluted by 20 times, and then is dropped on the lateral flow chromatography test strip, and is left for 3 min.

[0053] According to the method, preferably, the sample to be detected is a soil sample or a plant sample.

[0054] The method is applied to the prevention, monitoring and / or early warning of corn cyst nematode disease.

[0055] Compared with the prior art, the application has the following beneficial effects:

[0056] (1) The application is based on the corn cyst nematode SCAR specific fragment, and a set of LAMP specific primer groups (consisting of the primer Hz-F3, the primer Hz-B3, the primer Hz-FIP, the primer Hz-BIP and the primer Hz-LB) are designed with the corn cyst nematode SCAR specific fragment as a target. The primer groups have high specificity, and only have specific amplification reactions for the corn cyst nematode, and have no amplification for the close relatives of the corn cyst nematode (the Philip cyst nematode, the cereal cyst nematode, the soybean cyst nematode, the sugar beet cyst nematode, the upland rice cyst nematode and the tobacco cyst nematode) and other common plant parasitic nematodes (the southern root-knot nematode, the northern root-knot nematode, the peanut root-knot nematode, the Java root-knot nematode, the elephant ear bean root-knot nematode, the coffee short nematode and the Scribner short nematode).

[0057] (2) The primer groups designed in the application have high sensitivity, and the detection threshold for a single cyst of the corn cyst nematode is 1×10 -4 spores, and the detection threshold for a single larva is 1×10 -3 larvae.

[0058] (3) The present application identifies corn cyst nematode through LAMP amplification reaction of primer Hz-F3, primer Hz-B3, primer Hz-FIP, primer Hz-BIP, primer Hz-LB, or primer Hz-FIP-P and primer Hz-BIP-P, which has short detection time, only 60 min, and can be completed after SYBR Green I color reaction or Hybridetect lateral flow chromatography test paper detection of amplification reaction product, and identification and detection of corn cyst nematode can be completed according to color change of color reaction system or number of display lines of test paper strip. Therefore, the present application has the characteristics of rapidity, high efficiency, simple operation and no need of expensive instruments in identification of corn cyst nematode through LAMP amplification reaction, and can be detected in production and laboratory conditions, and the technology can rapidly detect soil carrying corn cyst nematode and corn root tissue infected by corn cyst nematode, and provides theoretical basis and reference for early detection, early warning and prevention of corn cyst nematode, and has important practical value. BRIEF DESCRIPTION OF DRAWINGS

[0059] Figure 1 Figure 4 is a diagram of LAMP primer group screening results for corn cyst nematode,

[0060] A is agarose gel electrophoresis detection result, M: DL2000 DNA Marker, 1-5 are primer group 1, primer group 2, primer group 3, primer group 4 and primer group 5 respectively.

[0061] Figure 2 Figure 5 is a diagram of positive and negative detection results of LAMP amplification product,

[0062] A is agarose gel electrophoresis detection result, M: DL2000 DNA Marker, 1: positive result, with ladder-like band, 2: negative result, no amplification product.

[0063] B is detection result of fluorescent dye coloration method, 1: positive result, with yellow-green fluorescence, 2: negative result, orange color. C is detection result of Hybridetect lateral flow chromatography test paper, 1: positive result, quality control line and detection line appear, 2: negative result, quality control line appears.

[0064] Figure 3 Figure 6 is a diagram of amplification results of different Mg 2+ concentrations in LAMP amplification reaction system,

[0065] A is agarose gel electrophoresis detection result, M: DL2000 DNA Marker, 1-7 are Mg 2+Final concentration 2 mmol / L, 4 mmol / L, 6 mmol / L, 8 mmol / L, 10 mmol / L, 12 mmol / L and negative control.

[0066] B is the detection result of fluorescent dye colorimetric method, 1-7 are Mg 2+ Final concentration 2 mmol / L, 4 mmol / L, 6 mmol / L, 8 mmol / L, 10 mmol / L, 12 mmol / L and negative control.

[0067] Figure 4 It is the amplification result graph of LAMP amplification reaction of different reaction times,

[0068] A is the detection result of agarose gel electrophoresis, M: DL2000 DNA Marker, 1-7 are reaction time 20 min, 30 min, 40 min, 50 min, 60 min, 70 min and negative control.

[0069] B is the detection result of fluorescent dye colorimetric method, 1-7 are reaction time 20 min, 30 min, 40 min, 50 min, 60 min, 70 min and negative control.

[0070] Figure 5 It is the amplification result graph of LAMP amplification reaction of different reaction temperatures,

[0071] A is the detection result of agarose gel electrophoresis, M: DL2000 DNA Marker, 1-7 are reaction temperature 60℃, 61℃, 62℃, 63℃, 64℃, 65℃ and negative control.

[0072] B is the detection result of fluorescent dye colorimetric method, 1-7 are reaction temperature 60℃, 61℃, 62℃, 63℃, 64℃, 65℃ and negative control.

[0073] Figure 6 It is the specificity verification experiment result of the LAMP detection method for detecting corn cyst nematode, A is the detection result of agarose gel electrophoresis, M: DL2000 DNA Marker, 1: corn cyst nematode, 2-15: phillips cyst nematode, graminaceous cyst nematode, soybean cyst nematode, sugar beet cyst nematode, upland rice cyst nematode, tobacco cyst nematode, southern root-knot nematode, northern root-knot nematode, peanut root-knot nematode, javanica root-knot nematode, elephant-foot bean root-knot nematode, coffee short nematode and scribner short nematode and negative control.

[0074] B is the result of fluorescent dye colorimetric detection, 1: corn cyst nematode, 2-15: Philip cyst nematode, wheat cyst nematode, soybean cyst nematode, sugar beet cyst nematode, upland rice cyst nematode, tobacco cyst nematode, southern root-knot nematode, northern root-knot nematode, peanut root-knot nematode, Java root-knot nematode, elephant bean root-knot nematode, coffee short nematode and Scribner short nematode and negative control.

[0075] C is the result of lateral flow chromatography test paper detection, 1: corn cyst nematode, 2-15: Philip cyst nematode, wheat cyst nematode, soybean cyst nematode, sugar beet cyst nematode, upland rice cyst nematode, tobacco cyst nematode, southern root-knot nematode, northern root-knot nematode, peanut root-knot nematode, Java root-knot nematode, elephant bean root-knot nematode, coffee short nematode and Scribner short nematode and negative control.

[0076] Figure 7 It is the cyst sensitivity detection result of the LAMP detection method for detecting corn cyst nematode of the application, A is the result of agarose gel electrophoresis detection, M: DL2000 DNA Marker, 1-7: 1×10 0 , 1×10 -1 , 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 Cysts and negative control.

[0077] B is the result of fluorescent dye colorimetric detection, 1-7: 1×10 0 , 1×10 -1 , 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 Cysts and negative control.

[0078] C is the result of lateral flow chromatography test paper detection, 1-7: 1×10 0 , 1×10 -1 , 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 Cysts and negative control.

[0079] Figure 8 It is the larva sensitivity detection result of the LAMP detection method for detecting corn cyst nematode of the application, A is the result of agarose gel electrophoresis detection, M: DL2000 DNA Marker, 1-7: 1×10 0 , 1×10 -1 , 1×10 -21×10 -3 1×10 -4 1×10 -5 Larvae and negative control.

[0080] B represents the result of the fluorescent dye colorimetric method, 1-7: 1×10 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Larvae and negative control.

[0081] C represents the result of the lateral flow chromatography test strip, 1-7: 1×10 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Larvae and negative control.

[0082] Figure 9 The image shows the results of LAMP amplification and conventional PCR detection in soil samples.

[0083] Figure A shows the results of agarose gel electrophoresis. Figures 1-8 show the field maize rhizosphere soil samples and the positive control (maize cyst nematode genomic DNA).

[0084] B shows the results of the fluorescent dye colorimetric reaction. 1-8: Field maize rhizosphere soil samples and positive control (maize cyst nematode genomic DNA).

[0085] C shows the results of the lateral flow chromatography test strip. 1-8: Field maize rhizosphere soil samples and positive control (maize cyst nematode genomic DNA).

[0086] Figure D shows the results of agarose gel electrophoresis of conventional PCR amplification products. Figures 1-8 show field maize rhizosphere soil samples and positive controls (maize cyst nematode genomic DNA).

[0087] Figure 10 The image shows the results of LAMP amplification and conventional PCR detection of root samples.

[0088] A shows the results of agarose gel electrophoresis. 1-5: Diseased maize root samples artificially inoculated with maize cyst nematode larvae. 6: Healthy maize root samples not inoculated with maize cyst nematode larvae. 7: Negative control.

[0089] B is the result of the fluorescent dye color reaction detection chart, 1-5: artificially inoculated corn cyst nematode larvae of sick corn root system samples, 6: healthy corn root system samples without inoculating corn cyst nematode larvae, 7: negative control.

[0090] C is the result of the lateral flow chromatography test paper detection chart, 1-5: artificially inoculated corn cyst nematode larvae of sick corn root system samples, 6: healthy corn root system samples without inoculating corn cyst nematode larvae, 7: negative control. DETAILED DESCRIPTION

[0091] In order to make the purpose, technical scheme and advantages of the present application more clear, the technical scheme of the present application will be described in detail below.

[0092] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0093] The corn cyst nematode, phillip cyst nematode, graminaceous cyst nematode, soybean cyst nematode, beet cyst nematode, upland rice cyst nematode, tobacco cyst nematode, southern root-knot nematode, northern root-knot nematode, peanut root-knot nematode, javanica root-knot nematode, elephant-foot bean root-knot nematode, coffee short nematode and scribner short nematode used in the present application are all preserved in the laboratory of the present applicant and can be provided to the public free of charge. Main reagents: Taq DNA Polymerase was purchased from Kangwei Company; DL2000 DNA Marker was purchased from TaKaRa Company; primers were synthesized by Shanghai Shenguo Biotechnology Co., Ltd.;

[0094] Example 1: Design, screening of LAMP primer set for identifying corn cyst nematode and preparation of kit for identifying corn cyst nematode

[0095] 1. Design of LAMP primer set

[0096] The corn cyst nematode specific sequence with a length of 835 bp was amplified using corn cyst nematode specific primers (Hz-F / Hz-R). Based on this gene sequence, 5 groups of LAMP primers were designed using the online primer design software PrimerExplorer 5.0 (https: / / primerexplorer.eiken.co.jp / lampv5 / index.html), including two outer primers (Hz-F3, Hz-B3), two inner primers (Hz-FIP, Hz-BIP) and a loop primer (Hz-LB) for corn cyst nematode LAMP detection. The nucleotide sequences of the 5 groups of LAMP primers are shown in Table 1.

[0097] The nucleotide sequences of the maize cyst nematode-specific primers are as follows:

[0098] Hz-F: CCGGGCCTTATGTATGTATG

[0099] Hz-R: CTAACCCTGGCACTTATCAA

[0100] The nucleotide sequences of the specific regions selected for LAMP primer design in the maize cyst nematode are as follows:

[0101] CGAAGAGATCAGTGTAGATGATCAACAGTTTATACATGGAATTTACGAGAAGCTCAGAAAGGACAAAAAAATCGACTCTGTTCGACGCGGTAAATTGAAATCAAAAAGAAAGATTGTCAAAAATTAATAAGTGAAAGCCATTACTTTCACAGAAAAAGCGCCACACGAAAAACAACAGAGGGCCCAGCAACCACAGACATCAGCGGAAGGCCAACTGATTG

[0102] Table 1 shows the LAMP primer set and its nucleotide sequence designed in this invention.

[0103]

[0104] 2. Screening of LAMP primer sets for *Ceratocystis maize*

[0105] Genomic DNA was extracted from *Nematodeus maize*, and LAMP reactions were performed using the five primer sets listed in Table 1. After the reactions, agarose gel electrophoresis was used to detect the binding efficiency between the primer sets and the target DNA. The procedure for detecting and identifying the amplification products using agarose gel electrophoresis was as follows: 5 μL of the amplification product was electrophoresed on a 1.5% agarose gel, and the images were observed and photographed using a gel imaging system. The LAMP primer selection amplification electrophoresis diagram is shown below. Figure 1 As shown.

[0106] Depend on Figure 1 Gel electrophoresis results showed that primer sets 1, 2, 4, and 5 exhibited distinct step-like bands, while primer set 3 showed no band. Primer set 2 produced the brightest bands on electrophoresis, indicating the best results. Therefore, primer set 2 was selected as the primer set for LAMP detection of *Nematodeus maize*.

[0107] The 5' ends of primers Hz-FIP and Hz-BIP in primer set 2 were modified with biotin and 6' FAM, respectively, and named Hz-FIP-P and Hz-BIP-P (Table 2), and were used for detection by lateral flow chromatography test strips.

[0108] Table 2 Modification of primers for lateral flow chromatography test paper detection

[0109]

[0110] 3. Preparation of a kit for identifying Globodera rostochiensis

[0111] The kit for identifying Globodera rostochiensis contains the primer set described above. Further, the kit also contains positive control DNA or / and fluorescent color developing agent or / and lateral flow chromatography test paper, the fluorescent color developing agent being SYBR Green I, and the lateral flow chromatography test paper being Hybridetect test paper strip.

[0112] Example 2: Establishment of LAMP detection method for detecting Globodera rostochiensis and optimization of LAMP amplification reaction components and reaction conditions

[0113] 1. LAMP detection method for detecting whether the sample of the nematode to be tested is Globodera rostochiensis

[0114] Genomic DNA of the sample of the nematode to be tested is extracted, and the genomic DNA of the sample of the nematode to be tested obtained by extraction is used as a template to perform LAMP amplification reaction by using the primer set 2 designed in the above example 1, so as to obtain an amplification product.

[0115] The LAMP amplification reaction system is 25 μL, and contains the following reaction reagents: 10 x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+ 1.5 μL, 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP each 4.0 μL, 10 μmol / L Hz-F3 and Hz-B3 each 0.5 μL, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, ddH2O to 25 μL; when lateral flow chromatography test paper detection is used, Hz-FIP and Hz-FIP in the reaction system are replaced by Hz-FIP-P and Hz-BIP-P. The reaction condition is 65°C, 60 min. The LAMP amplification reaction has a positive control and a negative control, the positive control uses the genomic DNA of Globodera rostochiensis as a template, and the negative control uses ddH2O as a control.

[0116] After the LAMP amplification reaction is completed, agarose gel electrophoresis, SYBR Green I fluorescent color developing method and lateral flow chromatography test paper are used for detection and identification, respectively.

[0117] The operation of detecting and identifying the amplification reaction product by agarose gel electrophoresis is as follows: 5 μL of the amplification product is electrophoresed on a 1.5% agarose gel, observed and photographed under a gel imager, and when the positive control amplification reaction product agarose gel electrophoresis presents a typical ladder band and the negative control has no band, if the sample to be detected presents a typical ladder band (i.e. the detection result is positive), the sample to be detected is corn cyst nematode or contains corn cyst nematode; if the sample to be detected does not present a typical ladder band (e.g. no band, i.e. the detection result is negative), the sample to be detected is not corn cyst nematode or does not contain corn cyst nematode.

[0118] The specific operation of detecting and identifying by SYBR Green I fluorescence colorimetry is as follows: after the LAMP amplification reaction is completed, 1 μL of SYBR Green I reagent is added to the reaction system, shaken and mixed, and the color change of the reaction system is observed, and when the positive control reaction system is green or yellow-green and the negative control reaction system is orange, if the reaction system of the sample to be detected presents green or yellow-green (i.e. the detection result is positive), it indicates that the sample to be detected is corn cyst nematode or contains corn cyst nematode; if the reaction system of the sample to be detected presents orange (i.e. the detection result is negative), it indicates that the sample to be detected is not corn cyst nematode or does not contain corn cyst nematode.

[0119] The specific operation of detecting and identifying by lateral flow chromatography test paper is as follows: after the LAMP amplification reaction is completed, 5 μL of the reaction product is diluted 20 times and added dropwise to the lateral flow chromatography test paper, and the number of bands appearing on the test paper is observed, and if one quality control line and one detection line appear on the test paper, it indicates that the sample to be detected is corn cyst nematode or contains corn cyst nematode; if only one quality control line appears on the test paper, it indicates that the sample to be detected is not corn cyst nematode or does not contain corn cyst nematode.

[0120] The positive and negative detection results of LAMP amplification products detected and identified by agarose gel electrophoresis, SYBR Green I fluorescence colorimetry and lateral flow chromatography test paper are shown in Figure 2 .

[0121] 2, The Mg 2+ concentration in the LAMP amplification reaction system is optimized:

[0122] In order to study the influence of Mg 2+ concentration in the LAMP amplification reaction system on the detection of corn cyst nematode, the genomic DNA of corn cyst nematode is extracted, the genomic DNA of corn cyst nematode is used as a template, and the primer set 2 designed in the above example 1 is used for LAMP amplification reaction, and the Mg 2+The addition amount of each is set to 0.5 μL, 1.0 μL, 1.5 μL, 2.0 μL, 2.5 μL, 3.0 μL, for a total of six gradients, and the Mg 2+ The addition amount corresponds to the Mg 2+ The final concentration is 2.0 mmol / L, 4.0 mmol / L, 6.0 mmol / L, 8.0 mmol / L, 10.0 mmol / L, and 12.0 mmol / L, respectively.

[0123] The specific LAMP amplification reaction system is: 10x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+ (Mg 2+ The addition amount is added according to the above six gradient addition amounts), 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP each 4.0 μL, 10 μmol / L Hz-F3 and Hz-B3 each 0.5 μL, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, ddH2O to 25 μL; the LAMP amplification condition is 65°C, 60 min. Set up a negative control (using ddH2O as the template).

[0124] After the LAMP amplification reaction, the amplification reaction products are detected and identified by agarose gel electrophoresis and SYBR Green I fluorescence colorimetry, respectively, and the identification results are shown in Figure 3 .

[0125] From Figure 3 the gel electrophoresis detection results, when the final concentration of Mg 2+ When the final concentration is 6.0 mmol / L, 8.0 mmol / L, and 10.0 mmol / L, specific amplification bands can be observed; from Figure 3 the fluorescence colorimetry results, when the final concentration of Mg 2+ When the final concentration is 6.0 mmol / L, 8.0 mmol / L, and 10.0 mmol / L, the reaction system after the amplification reaction product colorimetric reaction presents yellow-green, which is consistent with the electrophoresis detection results. Therefore, in the LAMP reaction system, the Mg 2+ The concentration of 6.0 mmol / L is a significant low threshold, so the final concentration of Mg 2+ In the LAMP amplification reaction system, the final concentration of Mg

[0126] 3. Reaction time optimization of LAMP amplification reaction:

[0127] In order to study the influence of the reaction time of the LAMP amplification reaction in the LAMP detection method on the detection of the corn cyst nematode, the genomic DNA of the corn cyst nematode was extracted, and the genomic DNA of the corn cyst nematode was used as a template to perform the LAMP amplification reaction by using the primer set 2 designed in the above Example 1. The reaction time of the LAMP amplification reaction was set to 20 min, 30 min, 40 min, 50 min, 60 min and 70 min, respectively, for a total of 6 gradients.

[0128] The specific LAMP amplification system was as follows: 10x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+ 1.5 μL, 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP 4.0 μL each, 10 μmol / L Hz-F3 and Hz-B3 0.5 μL each, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, and ddH2O to 25 μL. The LAMP amplification conditions were as follows: 65°C, and the specific reaction time was set according to the above 6 gradients in turn. A negative control (using ddH2O as a template) was set.

[0129] After the LAMP amplification reaction, the amplification reaction products were detected and identified by agarose gel electrophoresis and SYBR Green I fluorescence colorimetry, respectively, and the identification results are shown in Figure 4 .

[0130] From the Figure 4 gel electrophoresis detection results, it can be seen that when the reaction time of the LAMP amplification reaction is 60 min, a clear specific amplification band can be observed; from the Figure 4 fluorescence colorimetry results, it can be seen that when the reaction time of the LAMP amplification reaction is 30 min, the color of the reaction system appears a weak change, and when the reaction time is 40 min, 50 min and 60 min, the reaction system presents a yellow-green color after the colorimetric reaction of the amplification reaction products. Therefore, according to the results of the agarose gel electrophoresis and the fluorescence colorimetry, in the LAMP reaction system, the amplification reaction occurs at 60 min, and a significant low threshold can be observed. Therefore, the reaction time of the LAMP amplification reaction is preferably 60 min.

[0131] 4. Temperature optimization of the LAMP amplification reaction:

[0132] In order to explore the influence of reaction temperature on the detection of corn cyst nematode in LAMP reaction, the genomic DNA of corn cyst nematode was extracted, and the genomic DNA of corn cyst nematode was used as a template to perform LAMP amplification reaction by using the primer set 2 designed in the above embodiment 1, and the reaction temperature of LAMP amplification reaction was set to 60℃, 61℃, 62℃, 63℃, 64℃ and 65℃, a total of 6 gradients.

[0133] The specific LAMP amplification reaction system is: 10x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+ 1.5 μL, 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP each 4.0 μL, 10 μmol / L Hz-F3 and Hz-B3 each 0.5 μL, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, ddH2O to 25 μL. The LAMP amplification condition is: 60 min, and the specific reaction temperature is set according to the above 6 gradients in turn. Set the negative control (use ddH2O as the template).

[0134] After the LAMP amplification reaction is completed, the amplification reaction product is detected and identified by agarose gel electrophoresis and SYBR Green I fluorescent colorimetric method, respectively, and the identification result is shown in Figure 5 .

[0135] From the Figure 5 gel electrophoresis detection result, it can be seen that when the reaction temperature of the LAMP amplification reaction is 63℃, the specific amplification band can be observed; from the Figure 5 fluorescent colorimetric reaction, it can be seen that when the reaction temperature of the LAMP amplification reaction is 60℃, 61℃, 62℃, 63℃ and 64℃, the reaction system presents yellow-green color after the amplification reaction product is colored. Therefore, in the LAMP reaction system, the amplification reaction time is preferably 60-64℃, and more preferably 63℃.

[0136] After the above LAMP amplification reaction system Mg 2+ concentration optimization, reaction time, reaction system optimization research can know that the LAMP detection method for detecting whether the detected nematode sample is corn cyst nematode in the LAMP detection method of the present application is preferably:

[0137] 10x Isothermal Amplification Buffer 2.5 μL, 100 mM Mg 2+1.5 μL, 10 mM dNTP 3.5 μL, 10 μmol / L Hz-FIP and Hz-BIP 4.0 μL, 10 μmol / L Hz-F3 and Hz-B3 each 0.5 μL, 10 μmol / L Hz-LB 1 μL, 8000 U / mL Bst 2.0 DNA Polymerase 1 μL, template DNA 1 μL, ddH2O up to 25 μL. The LAMP amplification conditions are: 63℃, 60 min.

[0138] Example 3: Specificity experiment of the LAMP detection method for detecting H. zeae constructed in the application

[0139] According to the LAMP detection method described in step 1 of Example 2, the genomic DNA of H. zeae, H. phillipinensis, H. graminicola, H. glycines, H. betae, H. oryzae, H. tabaci, M. incognita, M. hapla, M. arenaria, M. javanica, M. enterolobii, P. coffeae and P. scribneri was extracted respectively as a template, and the LAMP amplification was carried out according to the LAMP amplification reaction system and reaction conditions obtained in Example 2. The amplification results are shown in Figure 6 .

[0140] Figure 6 As shown in Fig. A, only H. zeae can amplify specific bands, and other nematodes cannot amplify bands; as shown in Fig. B, only the reaction product of H. zeae presents yellow-green color after color development; as shown in Fig. C, only the reaction product of H. zeae presents detection line and quality control line on the lateral flow chromatography test paper, and the reaction products of other nematodes only present quality control band on the test paper. The results of the three detection methods are consistent, indicating that the detection method constructed in the application has good specificity, and only specific amplification reaction occurs for H. zeae, and no amplification occurs for other nematodes of the genus Heterodera and other plant parasitic nematodes. Figure 6 Figure 6

[0141] Example 4: Sensitivity experiment of the LAMP detection method for detecting H. zeae constructed in the application

[0142] According to the genomic DNA extraction method described in Example 2, the genomic DNA of a single cyst of H. zeae was extracted, and the extracted DNA was diluted by ten times with ddH2O to obtain 1×10 0 , 1×10 -1 , 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 ​​DNA template of a single cyst. At each dilution concentration, 1 μL of the DNA template was subjected to LAMP amplification according to the LAMP amplification reaction system and reaction conditions optimized in Example 2, and the amplification results are shown in FIG. 6. Figure 7

[0143] As can be seen from FIG. 6, when the concentration of the genomic DNA of a single cyst of the corn cyst nematode was lower than 1 x 10 -4 -4 Therefore, the minimum detection limit of the LAMP detection method for the corn cyst nematode for a single cyst is 1 x 10 Figure 7

[0144] The genomic DNA of a single larva of the corn cyst nematode was extracted according to the genomic DNA extraction method described in Example 2, and the extracted DNA was diluted by 10 times with ddH2O to obtain 1 x 10 0 , 1 x 10 -1 , 1 x 10 -2 , 1 x 10 -3 , 1 x 10 -4 , 1 x 10 -5 DNA template of a single larva. At each dilution concentration, 1 μL of the DNA template was subjected to LAMP amplification according to the LAMP amplification reaction system and reaction conditions optimized in Example 2, and the amplification results are shown in FIG. 7. Figure 8

[0145] As can be seen from FIG. 7, when the concentration of the genomic DNA of a single larva of the corn cyst nematode was lower than 1 x 10 -3 -3 Therefore, the minimum detection limit of the LAMP detection method for the corn cyst nematode for a single larva is 1 x 10 Figure 8

[0146] Example 5: Application experiment of the LAMP detection method for detecting the corn cyst nematode constructed in the application

[0147] ​​​​​​Seven rhizosphere soil samples were collected from maize fields with natural disease and healthy plots. Total DNA was extracted from the seven soil samples using a soil DNA extraction kit (QIAGEN, 12888-100). The total DNA from each soil sample was used as the template for the amplification reaction, and maize cyst nematode genomic DNA was used as a positive control. 1 μL of the DNA template was used for LAMP amplification according to the optimized LAMP amplification reaction system and conditions described in Example 2. The detection accuracy was verified using Hz-F and Hz-R according to the standard PCR reaction system. The results are as follows: Figure 9 As shown.

[0148] Depend on Figure 9 It was found that among the 7 soil samples collected, 5 tested positive and 2 tested negative. The LAMP amplification reaction products showed consistent results across the three detection methods, and the consistency with the conventional PCR detection results was 100%. This indicates that the LAMP detection method constructed in this invention can directly detect corn cyst nematodes in soil, and also demonstrates that this method has high accuracy in detecting corn cyst nematodes in soil.

[0149] Five two-leaf stage maize seedlings were artificially inoculated with 500 second-instar larvae of the maize cyst nematode, with no second-instar larvae used as a control. Ten days after inoculation, the rhizosphere soil was flushed away with a slow-flowing stream, and maize root samples were collected. Plant root DNA was extracted using the FastPure Plant DNA Isolation Mini Kit (Vazyme, DC104-01). The maize cyst nematode LAMP detection method constructed in Example 2 of this invention was used to detect the DNA in each maize root sample, with ddH2O used as a negative control. The detection results are as follows: Figure 10 As shown.

[0150] Depend on Figure 10 As can be seen, maize root samples 1-5 were positive, showing stepwise bands in electrophoresis, green fluorescence in the fluorescence reaction, and detection and control lines on the lateral flow chromatography strip. Maize root sample 6 did not show the above positive results. This indicates that among the tested maize root samples, 5 were diseased maize root samples and 1 was a healthy maize root sample, consistent with the artificial inoculation protocol. This demonstrates that the detection method can directly detect whether plant roots are infected with maize cyst nematodes and has good applicability.

Claims

1. A LAMP-specific primer set for identifying maize cyst nematodes, comprising primers Hz-F3, Hz-B3, Hz-FIP, Hz-BIP, and Hz-LB, wherein the nucleotide sequences of primers Hz-F3, Hz-B3, Hz-FIP, Hz-BIP, and Hz-LB are as follows: Primer Hz-F3: 5'-CGAAGAGATCAGTGTAGATGA-3', Primer Hz-B3: 5'-CAATCAGTTGGCCTTCCG-3', Primer Hz-FIP: 5'-CGTCGAACAGAGTCGATTTTTTTGTCAACAGTTTATACATGGAATTTACG-3', Primer Hz-BIP: 5'-AAGTGAAAGCCATTACTTTCACAGAGATGTCTGTGGTTGCTGG-3', Primer Hz-LB: 5'-AAAGCGCCACACGAAAACAA-3'.

2. The LAMP-specific primer set according to claim 1, wherein the 5' ends of primer Hz-FIP and primer Hz-BIP are respectively modified with biotin and fluorescent dyes.

3. The LAMP-specific primer set according to claim 2, wherein the 5' end of primer Hz-FIP is supplemented with biotin, and the 5' end of primer Hz-BIP is supplemented with fluorescent label 6-FAM; named respectively: Primer Hz-FIP-P: 5'-Biotin-CGTCGAACAGAGTCGATTTTTTTGTCAACAGTTTATACATGGAATTTACG-3'. Primer Hz-BIP-P: 5'-6-FAM-AAGTGAAAGCCATTACTTTCACAGAGATGTCTGTGGTTGCTGG-3'.

4. A kit containing the LAMP-specific primer set according to any one of claims 1-3.

5. The kit according to claim 4 further comprises a fluorescent colorimetric reagent and / or a lateral flow chromatography test strip.

6. The kit according to claim 5, wherein the fluorescent reagent is SYBR Green I, and the lateral flow chromatography strip is a Hybridetect strip.

7. The kit according to any one of claims 4-6, wherein the molar ratio of primer Hz-F3, primer Hz-B3, primer Hz-FIP, primer Hz-BIP and primer Hz-LB in the LAMP-specific primer set is 1:1:8:8:

2.

8. The use of the LAMP-specific primer set according to claims 1-3 or the kit according to any one of claims 4-7 in any of the following: (A1) Application in the identification or auxiliary identification of maize cyst nematodes that can harm grain and cash crops; (A2) Application in the preparation of products for the identification or auxiliary identification of maize cyst nematodes; (A3) Application in identifying or assisting in the identification of whether the nematode to be tested is corn cyst nematode; (A4) Application in the preparation of products for identifying or assisting in the identification of whether the nematode to be tested is corn cyst nematode; (A5) Application in identifying or assisting in the identification of whether a sample contains maize cyst nematodes; (A6) Application in the preparation of products for identifying or assisting in the identification of whether a sample contains maize cyst nematode; (A7) Application in the prevention, monitoring and / or early warning of maize cyst nematode disease.

9. A LAMP method for identifying maize cyst nematodes, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; the sample to be tested is derived from soil sample, plant sample or nematode sample to be tested; (2) Using genomic DNA as a template, a loop-mediated isothermal amplification reaction was performed using the primer set described in claim 1. (3) Result determination: After the reaction is completed, the presence of corn cyst nematodes in the test sample can be determined by whether ladder-like bands appear after agarose gel electrophoresis of the amplification reaction products, or by the color of the reaction system after SYBR Green I colorimetric reaction of the amplification reaction products, or by the number of lines appearing after lateral flow chromatography test strip colorimetric reaction of the amplification reaction products. The method for determining whether a sample contains *C. corn cystis* by observing whether the amplification reaction products exhibit ladder-like bands after agarose gel electrophoresis is as follows: After the loop-mediated isothermal amplification reaction, 5 μL of the amplification product is loaded onto a 1.5% agarose gel, incubated at 130V for 30 min. After electrophoresis, the bands are photographed using a gel imaging system. If the electrophoretic bands exhibit a ladder-like pattern, the sample is determined to contain *C. corn cystis*; otherwise, the sample does not contain *C. corn cystis*. Specifically, determining whether a sample contains corn cyst nematodes by analyzing the color of the reaction system after amplification reaction products undergoing a SYBR Green I colorimetric reaction is as follows: After the loop-mediated isothermal amplification reaction is completed, SYBR Green I is added to the amplification reaction system for colorimetric reaction. If the reaction system appears green or yellowish-green, the sample contains corn cyst nematodes; if the reaction system appears orange, the sample does not contain non-corn cyst nematodes. The method of determining whether a sample contains *C. corn cystis* by analyzing the number of bands appearing in the system after a lateral flow chromatography test strip reaction of the amplification reaction product is as follows: When preparing the reaction system, primers Hz-FIP-P and Hz-BIP-P are used instead of primers Hz-FIP and Hz-BIP. After the loop-mediated isothermal amplification reaction, 5 μL of the amplification reaction product is diluted 20-fold and dropped onto the lateral flow chromatography test strip. If the lateral flow chromatography test strip shows one control line and one detection line, the sample contains *C. corn cystis*; if the lateral flow chromatography test strip shows one control line and no detection line, the sample does not contain *C. corn cystis*.

10. The method according to claim 9, characterized in that, The reaction reagents contained in the loop-mediated isothermal amplification reaction system are as follows: 2.5 μL of 10×Isothermal Amplification Buffer and 1.5 μL of Mg. 2+ The reaction mixture consisted of 100 mM dNTP, 3.5 μL dNTP (10 mM), 4.0 μL Hz-FIP (10 μM) and Hz-BIP (10 μM), 0.5 μL Hz-F3 (10 μM) and Hz-B3 (10 μM), 1 μL Hz-LB (10 μM), 1 μL Bst 2.0 DNA Polymerase (8000 U / mL), 1 μL template DNA, and ddH2O to a final volume of 25 μL. When using lateral flow chromatography strips to detect the reaction products, primers Hz-FIP-P and Hz-BIP-P were used instead of primers Hz-FIP and Hz-BIP in the reaction mixture. The loop-mediated isothermal amplification reaction was performed at a temperature of 63 °C for 60 min.

Images