AQP4-IgG detection method based on AQP4-M1 and M23 subtype combination
By simulating physiological conditions in AQP4-IgG detection by co-expressing AQP4-M1 and M23 subtypes to form an OAP, the problem of inaccurate detection results in existing technologies is solved, achieving high sensitivity and high specificity in detection, which is suitable for the diagnosis of neuromyelitis optica spectrum disorders.
Patent Information
- Application Number
- CN202511482611.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-16
- Publication Date
- 2026-01-09
AI Technical Summary
Existing AQP4-IgG detection technologies suffer from low sensitivity, insufficient standardization, and the risk of false positives and false negatives. In particular, the single M23 subtype cannot simulate the coexistence of M1 and M23 subtypes under physiological conditions, leading to inaccurate test results.
By mixing and expressing AQP4-M1 and M23 isotypes in a certain proportion to form heterotetramers and assembling them into an orthogonal array (OAP), the distribution of antigenic epitopes in cells under physiological conditions was simulated, and the CBA method was used for detection.
It significantly improves the specificity and sensitivity of the test, reduces the risk of false positives and false negatives, and enhances the accuracy and reliability of the test, making it suitable for large-scale clinical screening.
Smart Images

Figure CN121294541A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of antibody detection technology, specifically relating to a method for detecting AQP4-IgG based on a combination of AQP4-M1 and M23 subtypes. Background Technology
[0002] Since the discovery of specific autoantibodies in patients with neuromyelitis optica spectrum disorder (NMOSD) in 2004, aquaporin 4 (AQP4) has attracted much attention as a target for autoimmune diseases of the central nervous system. AQP4 is an important aquaporin, mainly expressed at the podocyte terminals of astrocytes, and plays an important role in maintaining the physiological functions of the central nervous system and participating in the pathological processes of various diseases.
[0003] AQP4 has two main isoforms: M1 and M23. The difference between the two isoforms lies in the presence of an additional 22 amino acids at the N-terminus of the M1 isoform. The smallest unit of AQP4 arrangement in the cell membrane is the tetramer. AQP4 tetramers further form supramolecular aggregates called orthogonal granule arrays (OAPs), with the M23 isoform readily forming OAPs. When M1 and M23 are expressed simultaneously, they randomly bind to form heterotetramers, which further contribute to OAP formation. The 22 amino acids at the N-terminus of M1 prevent OAP formation, and the expression ratio of M1 to M23 modulates the size of the array. Studies have shown that the regulatory mechanism between the two isoforms may depend on the cell type.
[0004] NMO-IgG is a group of antibodies that recognize different portions of the extracellular region of AQP4 and exists in patient plasma in a mixture of these regions. In most cases, NMO-IgG fails to recognize denatured AQP4; most NMO-IgG recognizes the three-dimensional structure of AQP4, making it difficult to identify its precise epitopes. Although the major sequences of the extracellular regions between M1 and M23 are identical, studies have demonstrated that most NMO-IgGs preferentially bind to AQP4 that forms the OAP.
[0005] AQP4-IgG testing is a core diagnostic criterion for neuromyelitis optica spectrum disorders (NMOSD). Currently, the most prevalent method is cell-based assay (CBA), which was recommended as the international gold standard in the 2015 international NMOSD diagnostic criteria. This method preserves the native conformation of AQP4 and can also detect different AQP4 isoforms. Other methods include tissue immunofluorescence assay (TBA), which was historically the gold standard but is highly subjective; ELISA, which is simple to perform but has low sensitivity; and flow cytometry (FACS), which provides quantitative results but requires sophisticated equipment.
[0006] While the current AQP4-IgG detection technology uses the CBA (Cellular Absorption Spectroscopy) as the gold standard, it still faces multiple challenges, including sensitivity, standardization, and accessibility. For example, sensitivity is limited; approximately 10%-20% of clinically diagnosed NMOSD patients have negative serum CBA, possibly related to low antibody titers or blood-brain barrier isolation (CSF positive but serum negative). Furthermore, the standardization of experimental procedures is insufficient; different laboratories differ in cell lines (HEK293T or CHO, etc.), AQP4 subtypes (M1 monomer or M23 multimer), and fixation methods (methanol may disrupt conformation), leading to poor comparability of results. In addition, there are technical limitations such as complexity and difficulty in dynamic monitoring. Future research should focus on optimizing the CBA standardization process and developing highly sensitive experimental techniques.
[0007] Currently, the cell-based assay (CBA) for detecting AQP4-IgG commonly uses the M23 subtype of AQP4, which is more likely to form an OAP. However, the single M23 subtype cannot simulate the state in which the M1 and M23 subtypes coexist and form an OAP in cells under normal physiological conditions, and therefore may have the risk of low sensitivity and missed diagnosis. Summary of the Invention
[0008] To address the shortcomings of existing technologies, this invention aims to provide a highly sensitive and specific AQP4-IgG antibody CBA detection system and its preparation method, significantly reducing the risk of false positives and false negatives. Its core innovation lies in the proportional mixing and expression of two protein isotypes, AQP4-M1 and M23, under simulated physiological conditions, forming heterotetramers which are then further assembled into an orthogonal array (OAP), thus completely preserving the antigen epitopes. The novel CBA detection method based on this OAP structure effectively overcomes the limitations of existing technologies, significantly improving detection specificity and sensitivity, thereby minimizing the incidence of false positives and false negatives.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] In a first aspect, the present invention provides a method for preparing AQP4-IgG detection materials, comprising the following steps: simultaneously transfecting 293T cells with plasmids overexpressing two subtypes, AQP4-M1 and AQP4-M23, and then fixing and washing the transfected cells to obtain the material.
[0011] Preferably, the construction steps for the plasmids overexpressing the two subtypes AQP4-M1 and AQP4-M23 are as follows: design specific PCR primers for the two subtypes AQP4-M1 and AQP4-M23, amplify the cDNA of AQP4-M1 and AQP4-M23 using the commercially available pCDNA3.1-EGFP-3×Linker-AQP4(human) plasmid as a template, and ligate the cDNA into the pLenti-CAG-T2A-GFP plasmid vector for transformation, amplification and extraction to obtain the pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids.
[0012] Preferably, the forward primer sequence of the AQP4-M1 specific PCR primer is: CCGCTCGAGATGAGTGACAGACCCACAG; the forward primer sequence of the AQP4-M23 specific PCR primer is: CCGCTCGAGATGGTGGCTTTCAAAGGG; the reverse primer sequences of the AQP4-M1 and AQP4-M23 specific PCR primers are the same, namely: TCCTCTGCCCTCTCGGCTAGCTCCTACTGAAGACAATACCTCT.
[0013] Preferably, the plasmids overexpressing AQP4-M1 and AQP4-M23 are simultaneously transfected into 293T cells at a mass ratio of 1:2-3.
[0014] Secondly, the present invention provides a detection material prepared according to the above preparation method, wherein the detection material is a cell spreader.
[0015] Thirdly, the present invention provides the application of the above-mentioned detection material in the preparation of products for the detection of AQP4-IgG by the CBA method.
[0016] Preferably, the product includes a detection reagent or a kit.
[0017] Fourthly, the present invention provides a CBA method detection kit, which contains the above-mentioned detection materials.
[0018] Fifthly, the present invention provides a method for detecting AQP4-IgG based on a combination of AQP4-M1 and M23 subtypes, comprising the following steps:
[0019] (1) Simultaneously transfect 293T cells with plasmids overexpressing both AQP4-M1 and AQP4-M23 isoforms;
[0020] (2) After fixing the transfected cells, wash them with PBS and block them at room temperature with goat serum blocking solution.
[0021] (3) Remove the blocking solution, add clinical serum diluted with PBS, and incubate overnight;
[0022] (4) Wash cells with PBST, add anti-human IgG-ALEXA FLUOR 568 fluorescent secondary antibody, and incubate at room temperature in the dark;
[0023] (5) Wash cells with PBST, mount with mounting medium containing Dapi, examine and photograph under a fluorescence microscope.
[0024] Preferably, the fixation in step (2) is performed using 4% paraformaldehyde at room temperature for 20 minutes.
[0025] Preferably, the sealing time in step (2) is 1 hour.
[0026] Preferably, the overnight incubation in step (3) is an overnight incubation at 4°C.
[0027] Preferably, the room temperature incubation in step (4) is a room temperature incubation in the dark for 1 hour.
[0028] The present invention has the following beneficial effects:
[0029] 1. Enhanced Detection Specificity and Sensitivity: The AQP4-M1 and M23 protein isoforms are expressed in a proportional mixture under simulated physiological conditions, forming heterotetramers that are further assembled into an orthogonal array (OAP). This preserves the antigenic epitopes, enabling AQP4-IgG antibodies to more accurately recognize and bind to the target protein. Compared to traditional single-isoform cell detection methods, this significantly reduces the incidence of false positives and false negatives, improving the reliability of clinical diagnosis.
[0030] 2. More realistic simulation of in vivo antigen distribution and simultaneous detection covering two subtypes, reducing the risk of misdiagnosis: The mixed expression of the two subtypes in different proportions can better simulate the abundance and distribution characteristics of the two subtypes of AQP4 antigen in vivo, making the test results more objectively reflect the correlation between the patient's AQP4-IgG antibody level and disease status; at the same time, the OAP structure composed of different heterotetramers can expose more antigenic epitopes, significantly improving the specificity of antibody binding and reducing the risk of false positives / false negatives due to insufficient detection sensitivity or non-specific binding.
[0031] 3. Suitable for large-scale clinical screening: The advantages of rapid preparation and stable expression using transiently transformed cell lines enable mass production and standardized operation, meeting the needs of clinical laboratories for high-throughput, rapid, and reliable testing. Attached Figure Description
[0032] Figure 1This is a schematic diagram of staining 293T cells transiently transfected with pLenti-CAG-AQP4-M1-T2A-GFP plasmid according to an embodiment of the present invention.
[0033] Figure 2 This is a schematic diagram of staining AQP4-IgG serum on 293T cells transiently transfected with pLenti-CAG-AQP4-M23-T2A-GFP plasmid, as described in an embodiment of the present invention.
[0034] Figure 3 This is a schematic diagram illustrating the staining of 293T cells with AQP4-IgG serum at a mass ratio of 1:1 for the transfection of pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids, as described in the embodiments of the present invention.
[0035] Figure 4 This is a schematic diagram illustrating the staining of 293T cells with AQP4-IgG serum at a mass ratio of 1:2 for the transfection of pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids, as described in the embodiments of the present invention.
[0036] Figure 5 This is a schematic diagram illustrating the staining of 293T cells with AQP4-IgG serum at a mass ratio of 1:3 for the transfection of pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids, as described in an embodiment of the present invention.
[0037] Figure 6 This is a schematic diagram illustrating the staining of 293T cells with AQP4-IgG serum at a mass ratio of 2:1 for the transient transfection of pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids, as described in the embodiments of the present invention.
[0038] Figure 7 This is a schematic diagram illustrating the staining of 293T cells with AQP4-IgG serum at a mass ratio of 3:1 for the transfection of pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids, as described in an embodiment of the present invention. Detailed Implementation
[0039] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0040] Example 1: Construction of pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids
[0041] (1) Design specific PCR primers for the two subtypes of AQP4. Use commercially available AQP4-M1 and AQP4-M23 plasmids as templates. The commercial plasmids were purchased from the Miaoling Plasmid Platform, catalog number P14907, and the plasmid name is pCDNA3.1-EGFP-3×Linker-AQP4(human). AQP4-M1 and AQP4-M23 cDNA fragments were amplified. The specific PCR primers for AQP4-M1 and AQP4-M23 are shown in Table 1.
[0042] (2) The amplified cDNA fragments of AQP4-M1 and AQP4-M23 were cloned and ligated into the pLenti-CAG-T2A-GFP lentiviral plasmid vector.
[0043] (3) Then the constructed plasmids were transformed, cultured PCR was performed, sequencing was performed, and culture was shaken. The plasmids were then amplified and extracted to obtain pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids.
[0044] The construction steps of plasmid pLenti-CAG-T2A-GFP are as follows:
[0045] ① Design specific PCR primers for T2A-GFP. Using the CAG-Z-IRES-EGFP plasmid (Source: Jolien Perneel, et al. Increased TMEM106B levels lead to lysosomal dysfunction whichaffects synaptic signaling and neuronal health[J]. Mol Neurodegener. 2025 Apr23;20(1):45.) as a template, perform two PCR amplifications to obtain the T2A-GFP cDNA fragment. The specific primers for the first and second PCRs of T2A-GFP are shown in Table 1.
[0046] ② The amplified T2A-GFP cDNA fragment and CAG-Z-IRES-EGFP plasmid were digested with EcoRI and NotI restriction endonucleases, respectively, followed by agarose gel electrophoresis, gel recovery, ligation, transformation, bacterial PCR, sequencing, and shaking for amplification and extraction to obtain the pLenti-CAG-T2A-GFP vector plasmid.
[0047] Table 1 Primer Information
[0048] information Primer information Forward primers for amplifying AQP4-M1 CCGCTCGAGATGAGTGACAGACCCACAG (SEQ ID NO.1) Reverse primers for amplifying AQP4-M1 TCCTCTGCCCTCTCGGCTAGCTCCTACTGAAGACAATACCTCT (SEQ ID NO.2) Forward primers for amplifying AQP4-M23 CCGCTCGAGATGGTGGCTTTCAAAGGG (SEQ ID NO.3) Reverse primers for amplifying AQP4-M23 TCCTCTGCCCTCTCGGCTAGCTCCTACTGAAGACAATACCTCT (SEQ ID NO.4) Forward primers for amplifying T2A-GFP (one round) AGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGTGAGCAAGGGCGA (SEQ ID NO.5) Reverse primers for amplifying T2A-GFP (one round) ATAGTTTAGCGGCCGCTTTACTTGTACAGCTCGTC (SEQ ID NO.6) Forward primers for amplifying T2A-GFP (second round) ACCGCATGTTAGCAGACTTCCTCTGCCCTCTCGGCTAGCTCCCTCGAGGTTAACGAATTCTTT (SEQ ID NO.7) Reverse primers for amplifying T2A-GFP (two rounds) ATAGTTTAGCGGCCGCTTTACTTGTACAGCTCGTC (SEQ ID NO.8)
[0049] Example 2: Construction of 293T cells co-expressing two AQP4 isoforms, M1 and M23
[0050] (1) 293T cells were seeded into 12 mm cell spread sheets, with a total cell volume of 4 × 10⁻⁶ cells. 4 Individual / hole / climbing plate.
[0051] (2) When the cell confluence reaches 40-50%, the pLenti-CAG-AQP4-M1-T2A-GFP plasmid and pLenti-CAG-AQP4-M23-T2A-GFP plasmid obtained in Example 1 are instantaneously transfected into 293T cells at mass ratios of 1:0, 0:1, 1:1, 1:2, 1:3, 2:1 and 3:1 using a transfection reagent; the transfection reagent is the TurboFect transfection reagent from Thermo Fisher Scientific.
[0052] (3) The cells were placed in a 37°C, 5% CO2 cell culture incubator for 24 hours.
[0053] Example 3: Cell-based AQP4-IgG detection method
[0054] (1) After the cells were cultured for about 24 hours, GFP green fluorescence was observed under a fluorescence microscope. The culture medium was removed, the cells were washed once with PBS, and then 4% paraformaldehyde was added and fixed at room temperature for 20 minutes.
[0055] (2) After the cells were fixed, the cells were washed twice with PBS. After the cell slides were removed, they were placed on a wet dish. Immediately, about 50 μL of goat serum blocking solution was added to the cell slides and the slides were blocked at room temperature for 1 hour.
[0056] (3) Remove the blocking solution, dilute the clinical AQP4-IgG serum with PBS to the highest detection dilution titer for clinical reporting results identification, add 50 μL to the slide, and incubate overnight at 4°C.
[0057] (4) Wash cells three times with PBST, add 50 μL of 1:1000 diluted anti-human IgG-ALEXA FLUOR568 fluorescent secondary antibody to each slide, and incubate at room temperature in the dark for 1 hour.
[0058] (5) Wash cells with PBST three times.
[0059] (6) Add mounting medium containing Dapi, mount the slide, and examine and photograph it under a fluorescence microscope.
[0060] (7) The staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M1 are as follows: Figure 1 As shown; the staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M23 are as follows. Figure 2 As shown; the staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M1+M23 in a 1:1 ratio are as follows. Figure 3 As shown; the staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M1+M23 in a 1:2 ratio are as follows. Figure 4 As shown; the staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M1+M23 in a 1:3 ratio are as follows. Figure 5 As shown; the staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M1+M23 in a 2:1 ratio are as follows. Figure 6 As shown; the staining results of AQP4-IgG serum on transiently transfected 293T cells overexpressing AQP4-M1+M23 in a 3:1 ratio are as follows. Figure 7 As shown; blue represents Dapi-stained cell nuclei, green represents overexpressed AQP4-M1 or AQP4-M23 antigen proteins, and red represents anti-human IgG-ALEXA FLUOR 568 fluorescent secondary antibody.
[0061] Figure 1 The results showed that the binding of AQP4-IgG serum antibody to the overexpressed AQP4-M1 antigen protein was not significant, and some of the overexpressed AQP4-M1 antigen protein failed to bind to AQP4-IgG serum antibody, indicating that its binding specificity was poor. At the same time, non-specific binding resulted in high background color, making it difficult to distinguish positive results.
[0062] Figure 2 The results showed that the AQP4-IgG serum antibody significantly bound to the overexpressed AQP4-M23 antigen protein, with high red fluorescence intensity, indicating that its binding specificity was better than that of AQP4-M1. There was some non-specific binding, resulting in background color, which could distinguish positive results.
[0063] Figures 3-7 The results showed that AQP4-IgG serum antibodies significantly bound to the overexpressed AQP4-M1+M23 combination antigen protein at ratios of 1:1, 1:2, and 1:3. Figures 3-5 The red fluorescence intensity was high; however, its binding to the overexpressed AQP4-M1+M23 combination at ratios of 2:1 and 3:1 was not significant. Figures 6-7The results indicate that the AQP4-M1+M23 overexpression combinations at ratios of 1:1, 1:2, and 1:3 exhibit better binding specificity for the antigen protein. Cells with lower levels of overexpressed antigen protein in the 1:2 and 1:3 ratios of AQP4-M1+M23 can also bind to AQP4-IgG serum antibodies, indicating better binding sensitivity. Only a small amount of non-specific binding occurs, resulting in a very light background color and making it easy to distinguish positive results. Therefore, the 1:2 and 1:3 ratios of AQP4-M1+M23 overexpression show better specificity and sensitivity. Furthermore, positive cells on co-transfected AQP4-M1+M23 exhibit a slightly larger leaf-like morphology, making them easier to distinguish from non-specific staining at the cell's outer edge and reducing the risk of misjudgment by testing personnel.
[0064] In summary, the optimal ratios for AQP4-M1+M23 overexpression in transiently transfected cells were determined to be 1:2 and 1:3 using a cell-based AQP4-IgG assay.
[0065] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for preparing AQP4-IgG detection material, characterized in that, The procedure includes the following steps: simultaneously transfecting 293T cells with plasmids overexpressing both AQP4-M1 and AQP4-M23 isoforms, and then fixing and washing the transfected cells.
2. The preparation method according to claim 1, characterized in that, The construction steps for the plasmids overexpressing the two isotypes AQP4-M1 and AQP4-M23 are as follows: Specific PCR primers for the two isotypes AQP4-M1 and AQP4-M23 are designed. Using the commercially available pCDNA3.1-EGFP-3×Linker-AQP4(human) plasmid as a template, cDNA of AQP4-M1 and AQP4-M23 is amplified. The cDNA is then ligated into the pLenti-CAG-T2A-GFP plasmid vector for transformation, amplification, and extraction to obtain the pLenti-CAG-AQP4-M1-T2A-GFP and pLenti-CAG-AQP4-M23-T2A-GFP plasmids.
3. The preparation method according to claim 2, characterized in that, The forward primer sequence of the AQP4-M1 specific PCR primer is: CCGCTCGAGATGAGTGACAGACCCACAG; the forward primer sequence of the AQP4-M23 specific PCR primer is: CCGCTCGAGATGGTGGCTTTCAAAGGG; the reverse primer sequences of the AQP4-M1 and AQP4-M23 specific PCR primers are the same, namely: TCCTCTGCCCTCTCGGCTAGCTCCTACTGAAGACAATACCTCT.
4. The preparation method according to claim 1, characterized in that, The plasmids overexpressing the AQP4-M1 and AQP4-M23 isoforms were simultaneously transfected into 293T cells at a mass ratio of 1:2-3.
5. The detection material prepared by the preparation method according to any one of claims 1-4, characterized in that, The detection material is a cell smear.
6. The use of the detection material according to claim 5 in the preparation of products for the detection of AQP4-IgG by the CBA method.
7. The application according to claim 6, characterized in that, The products include testing reagents or kits.
8. A CBA method detection kit, characterized in that, It includes the testing material as described in claim 5.
9. A method for detecting AQP4-IgG based on the combination of AQP4-M1 and M23 subtypes, characterized in that, Includes the following steps: (1) Simultaneously transfect 293T cells with plasmids overexpressing two isotypes, AQP4-M1 and AQP4-M23; the preparation steps of the plasmids are as described in any one of claims 1-4. (2) After fixing the transfected cells, wash them with PBS and block them at room temperature with goat serum blocking solution. (3) Remove the blocking solution, add clinical serum diluted with PBS, and incubate overnight; (4) Wash cells with PBST, add anti-human IgG-ALEXA FLUOR 568 fluorescent secondary antibody, and incubate at room temperature in the dark; (5) Wash cells with PBST, mount with mounting medium containing Dapi, examine and photograph under a fluorescence microscope.
10. The detection method according to claim 9, characterized in that, The fixation in step (2) is to fix with 4% paraformaldehyde at room temperature for 20 minutes; the sealing time is 1 hour; the overnight incubation in step (3) is overnight incubation at 4°C; the room temperature incubation in step (4) is incubation at room temperature in the dark for 1 hour.