A synergist that enhances the toxicity of pesticides against the oriental fruit fly.
By downregulating the expression of key genes in the body wall of the oriental fruit fly using RNA interference technology, the problem of low penetration efficiency of insecticides into the oriental fruit fly in existing technologies has been solved, thereby achieving enhanced insecticide toxicity and environmentally friendly pest control effects.
Patent Information
- Application Number
- CN202511850611.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2045-12-10
Smart Images

Figure CN121294551B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological pesticide technology, specifically relating to a synergist that can enhance the toxicity of pesticides to the oriental fruit fly. Background Technology
[0002] The orchid fruit fly ( Bactrocera dorsalis The oriental fruit fly (Bactrocera dorsalis) belongs to the family Bactroceridae in the order Diptera. It is a globally recognized quarantine pest that bores into fruits and vegetables, causing severe damage. It has a wide host range, infesting more than 250 kinds of economically important fruits and vegetables. Native to subtropical regions, it is a significant pest of the fruit and vegetable industry in southern my country. In recent years, due to global climate change and the insect's increased adaptability, its distribution range has expanded northward, even invading previously unsuitable climatic areas, posing a major threat to the safety of my country's fruit and vegetable industry.
[0003] Except for the adult stage, the oriental fruit fly lives in secrecy throughout its various life stages. Therefore, current cost-effective control strategies primarily focus on chemical control of the adult stage. However, the long-term, singular, and excessive use of insecticides has directly led to the development of high-level pesticide resistance in oriental fruit fly populations in the field, while also causing serious environmental pollution and pesticide residue exceeding standards. Therefore, developing pesticide synergists that can effectively reverse or delay resistance and enhance the efficacy of existing pesticides has become an urgent need in the field of pest resistance management.
[0004] Currently, there is a lack of synergists on the market that can enhance the penetration efficiency of insecticides against the oriental fruit fly by specifically regulating the physiological barrier of the insect's body wall. Therefore, in-depth research into the mechanism of synergistic insecticide toxicity can provide new ideas and theoretical basis for the development of a new generation of green and efficient pest control products, which has important scientific significance and application prospects. Summary of the Invention
[0005] The purpose of this invention is to provide a synergist that enhances the toxicity of pesticides to the oriental fruit fly, and this synergist can downregulate the oriental fruit fly gene. CPAP3-5 , CPLCG-4 or RR1-52 The expression level of [something] can be increased, thereby enhancing the toxicity of insecticides to the oriental fruit fly.
[0006] This invention first provides a method for increasing the toxicity of pesticides to the oriental fruit fly. The method involves reducing the toxicity of pesticides to the oriental fruit fly. CPAP3-5 , CPLCG-4 or RR1-52 Gene expression levels;
[0007] The aforementioned CPAP3-5 , CPLCG-4 or RR1-52 The genes, whose nucleotide sequences are SEQ ID NO:1-3;
[0008] The method described uses RNA interference to reduce CPAP3-5 , CPLCG-4 or RR1-52 Gene expression levels in the oriental fruit fly;
[0009] Furthermore, in the aforementioned RNA interference method, the method for reducing CPAP3-5 The dsRNA of the gene has the sequence SEQ ID NO:4;
[0010] Used to reduce CPLCG-4 The dsRNA of the gene has the sequence SEQ ID NO:5;
[0011] Used to reduce RR1-52 The dsRNA of the gene has the sequence SEQ ID NO:6.
[0012] The pesticides mentioned, as specifically described in the examples, are chlorpyrifos, lambda-cyhalothrin, spinosad, or abamectin.
[0013] The present invention also provides a synergist that enhances the toxicity of pesticides to the oriental fruit fly, comprising an agent for reducing the oriental fruit fly's toxicity. CPAP3-5 , CPLCG-4 or RR1-52 Reagents for measuring gene expression levels;
[0014] The reagent described herein, as a specific example, is dsRNA or an engineered strain used for recombinant expression of dsRNA;
[0015] Among them, used to reduce CPAP3-5 The dsRNA of the gene has the sequence SEQ ID NO:4;
[0016] Used to reduce CPLCG-4 The dsRNA of the gene has the sequence SEQ ID NO:5;
[0017] Used to reduce RR1-52 The dsRNA of the gene has the sequence SEQ ID NO:6.
[0018] This invention uses transcriptomics and quantitative fluorescence to discover downregulation in the oriental fruit fly. CPAP3-5 , CPLCG-4 and RR1-52 After gene expression, the toxicity of insecticides to the oriental fruit fly can be significantly enhanced. Therefore, downregulating the expression of key epidermal protein genes in the insect's body wall, thereby promoting the effectiveness of insecticides, can effectively reduce the amount of chemical insecticides used, lower pesticide residues and environmental pressure, which is in line with the development direction of green agriculture. Attached Figure Description
[0019] Figure 1: Effect of methyl eugenol exposure on chlorpyrifos toxicity, where ME and MO represent methyl eugenol and mineral oil, respectively, and the error bars represent LD50. 50 The 95% confidence interval.
[0020] Figure 2 : Effect of methyl eugenol exposure on the toxicity of lambda-cyhalothrin, where ME and MO represent methyl eugenol and mineral oil, respectively, and the error bars represent LD50. 50 The 95% confidence interval.
[0021] Figure 3 : Effect of methyleugenol exposure on the toxicity of abamectin, where ME and MO represent methyleugenol and mineral oil, respectively, and the error bars represent LD50. 50 The 95% confidence interval.
[0022] Figure 4 : Effect of methyl eugenol exposure on spinosad toxicity, where ME and MO represent methyl eugenol and mineral oil, respectively, and the error bars represent LD50. 50 The 95% confidence interval.
[0023] Figure 5 Figure: Downregulation of CPAP3-5 expression levels after exposure to methyl eugenol. ME and MO represent methyl eugenol and mineral oil, respectively. * indicates a significant difference (P < 0.05).
[0024] Figure 6 The graph shows the downregulation of CPLCG-4 expression levels after exposure to methyleugenol. ME and MO represent methyleugenol and mineral oil, respectively. * indicates a significant difference. P <0.05.
[0025] Figure 7 The graph shows the downregulation of RR1-52 expression levels after exposure to methyleugenol. ME and MO represent methyleugenol and mineral oil, respectively. * indicates a significant difference. P <0.05.
[0026] Figure 8 : Interference efficiency plot of CPAP3-5 genes, where * represents significant differences. P <0.05.
[0027] Figure 9 : Interference efficiency graph of CPLCG-4 gene, where * represents significant difference. P <0.05.
[0028] Figure 10 : Interference efficiency plot of RR1-52 gene, where * represents significant difference.P <0.05.
[0029] Figure 11 The figure shows the experimental results of the effect of RNAi interference with CPAP3-5 on the toxicity of four insecticides. * indicates a significant difference. P <0.05.
[0030] Figure 12 The figure shows the experimental results of the effect of RNAi interference with CPLCG-4 on the toxicity of four insecticides. * indicates a significant difference. P <0.05.
[0031] Figure 13 The figure shows the experimental results of the effect of RNAi interference with RR1-52 on the toxicity of four insecticides. * indicates a significant difference. P <0.05. Detailed Implementation
[0032] The CPAP3-5 gene involved in this embodiment of the invention has the following nucleotide sequence:
[0033] ATGAAATATTCGTTTCTGTATTTAACACTTGTCACTTTGACGGTGTGCATCGTAGCGGAAAGTGCATTCCAATGTCCCAAACCTGAGGGCGAATATCCTGATGATGTTCAGTGTGATAAATACTATCAATGTAATGATGGCGTAGCAAAAGAAAAGTTGTGCCCAGATGGCTTAGTGTTCGATCCGCTCAATAGGCACATCAATAAGTGTGATCAACCTTTCAATGTAGATTGCGGTGACCGAACTGAATTGCAGGAGCCAAAATCTTCTAAATTTTGTCCTCGTAAAAACGGATTCTTCGCACATCCTGATTCTTCTGTATGTGATATTTTTTACAATTGTATTGATGGAGATGCTTTAGAAATGAAATGTACTGTTGGATTGCACTTTGATGAATTTGGTGGAACTTGTGTTTGGCCAGATACTGCGAAACGTGAAGGTTGCGAAGCACCACAGAAAAAATCTCCGACCGGATTTGTGTGCCCGAAGGATCGCCCAAAGAATGATGATAAAGGTCAGGTAGTTACTCATCCGAAGTTCCCCCATCCTACAGACTGTCAAAAATTCCATGTCTGCTTAAATGGGGAAGATCCACGCGATCTAGCCTGTCAATTAGGCGAAGTCTACAATGAAGAAACGGAAATGTGTGATGCTCCTGAAAATGTTCCCGGTTGTGAAGATTGGTACAAGGATTCCGATGACAAAAAAGAATAA (SEQ ID NO:1).
[0034] The nucleotide sequence of the CPLCG-4 gene is as follows:
[0035] ATGAAGTTCGCCGTCTCCGTAGTCTTGTTCGCTTTGGCCCTTGGCGCTGCCCACTGCTCGGTCGTACCATTGATCAGTCAAATCAATGGCGCCGTTTTGGCCTCACCACTTGGTTCCGTTGCCGTACATGCCGCCGCCGTGCCAGCCGTTGTCGCCGCCCCAGCACCAGTACAGATCATCACCGCTCCCGCCGTGGTAGCTGCTCCCGCTGTCGTGGCCGCTGAAGGCACCTATGTGGCTAAGACCCGTGGCGCTGTACATGTGGCACCACTGCCCGGTCACATACAATCGGCAGCATCAGTGAACTTGCAACCAGCTCCTGGCACTCTCTAA (SEQ ID NO:2).
[0036] The nucleotide sequence of the RR1-52 gene is as follows:
[0037] (SEQ ID NO:3).
[0038] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0039] Example 1: Effect of methyleugenol on the expression of epidermal protein genes in the body wall of the oriental fruit fly.
[0040] 1. Methyleugenol exposure treatment of adult oriental fruit flies
[0041] Given that individuals at different developmental stages may be exposed to methyl eugenol (ME) during field control, four experimental groups were set up: sexually immature males and females (3 days old), and sexually mature males and females (15 days old) that had not yet mated, all exposed to methyl eugenol (800 µL). The methyl eugenol release device was prepared as follows: methyl eugenol was evenly added dropwise to a petri dish (10 cm in diameter) lined with filter paper, and the surface was covered with 50-mesh gauze and secured with rubber bands to prevent the oriental fruit fly from directly ingesting the methyl eugenol. This release device and adult oriental fruit flies were placed together in a 1.5 mL centrifuge tube containing 20% sucrose solution and a 1 L plastic cup, the cup openings sealed with sealing film. The control group used an equal volume of mineral oil instead of methyl eugenol. Each treatment group contained at least 200 insects, with 50 adults placed in each cup.
[0042] Based on information registered on the China Pesticide Information Network, four commonly used insecticides for controlling the oriental fruit fly—chlorpyrifos, cypermethrin, abamectin, and spinosad—were selected to evaluate the effect of methyl eugenol exposure on their toxicity. The specific procedures were as follows: After 24 hours of methyl eugenol treatment, the test insects were briefly stunned at 4 °C, then transferred to an ice tray. The insecticide was applied by dripping onto the pronotum of the adult insects using a Hamilton PB-600 repeat dispenser. After treatment, the adults were transferred to disposable paper cups, the cup openings were sealed with clean gauze, and a cotton ball soaked in a 20% sucrose solution was placed on the gauze. The control group was treated with acetone. Mortality was observed and recorded after 24 hours; death was defined as no reaction when the insect was lightly touched with a brush. Five to seven concentration gradients were established for each insecticide, with three replicates per concentration and 10-15 adults per replicate.
[0043] Bioassay results showed that methyl eugenol exposure generally enhanced the toxicity of different insecticides to adult oriental fruit flies, but differences existed between different insecticides and different physiological states of adults. For example, for chlorpyrifos, methyl eugenol exposure significantly reduced the LD50 in adults at all four physiological states. 50 ( Figure 1 For high-efficiency cypermethrin, except for sexually mature female insects, the other three groups of insects showed a significant reduction in LD50. 50 ( Figure 2 For abamectin, only immature and sexually mature males showed significantly increased sensitivity, while there was no significant difference between the two groups of females. Figure 3 For spinosad, only the toxicity against sexually mature males was significantly increased; there were no significant differences in the other three groups. Figure 4 Among them, after exposure to methyl eugenol, the decrease in sexually immature males was smallest after treatment with abamectin (1.68 times), while the decrease in sexually mature males was largest after treatment with chlorpyrifos (3.61 times). These results indicate that methyl eugenol not only has strong attractant activity for sexually mature males, but also significantly enhances the toxic effect of insecticides on them.
[0044] 2. Total RNA extraction and cDNA synthesis
[0045] Fruit fly samples treated with methyl eugenol and mineral oil (control) for 24 hours were collected for total RNA extraction and cDNA synthesis. The specific procedures were as follows: Total RNA was extracted according to the Invitrogen TRIzol® Reagent instructions. After homogenization, chloroform was added and centrifuged at 4°C. The supernatant was collected, and isopropanol was added, followed by centrifugation at 4°C to precipitate RNA. The precipitate was washed twice with 75% ethanol, dried at room temperature, dissolved in 100 μL DEPC-H2O, and stored at -80°C after concentration determination. cDNA synthesis was performed using TaKaRa PrimeScript. ® Use the RT reagent kit with gDNA Eraser according to the instructions.
[0046] 3. Quantitative Real-Time PCR Analysis
[0047] Transcriptome data showed that the expression of three epidermal protein genes in *Bactrocera dorsalis* differed significantly 24 hours after exposure to methyl eugenol. To verify its potential role in enhancing the contact toxicity of insecticides with methyl eugenol, we used quantitative real-time PCR to detect the expression of these genes. Primer selection was performed as follows: cDNA templates were serially diluted 2-fold, and six concentration gradients were set for quantitative real-time PCR screening. Primers with amplification efficiency between 90% and 110% and a single-peak melting curve were selected as the primers for the formal experiments.
[0048] cDNA from different treatment groups of *Bactrocera dorsalis* was used as qPCR template. Two replicates were performed for each target gene. The reaction system was prepared according to the ChamQ Universal SYBR qPCR Master Mix (Novitamin) instructions. The primer sequences used are as follows:
[0049] CPAP3-5: F: 5'-TCCAATGTCCCAAACCTGAGG-3,
[0050] R: 5'-AGCCATCTGGGCACAACTTTT-3';
[0051] CPLCG-4: F: 5'-ATGAAGTTCGCCGTCTCCGT-3',
[0052] R: 5'-TACGGCAACGGAACCAAGTG-3';
[0053] RR1-52: F: 5'-CCTTAGTTGCCATTGCCGC-3',
[0054] R: 5'-ATCGGCATCGGGTCTCCTCC-3'.
[0055] Transcriptome analysis showed that, in sexually mature males, compared with the mineral oil control group, methyl eugenol exposure significantly downregulated the expression of epidermal protein genes CPAP3-5, CPLCG-4, and RR1-52. To further investigate the mechanism of action of methyl eugenol in adult *Bacteroides citrinum* at different physiological stages, we analyzed the expression levels of three genes in the body wall tissues of four groups: sexually immature females, sexually immature males, sexually mature females, and sexually mature males. The results showed that CPAP3-5 was significantly downregulated in all four groups, with expression levels decreasing by 3.68, 3.72, 2.29, and 5.00-fold in sexually immature males, sexually immature females, sexually mature females, and sexually mature males, respectively. Figure 5 CPLCG-4 expression was significantly downregulated in both sexually immature females and sexually mature males, decreasing by 2.57 and 2.20-fold, respectively, while no significant difference was observed in the other two groups. Figure 6 ); RR1-52 expression was significantly decreased in all three groups except for sexually mature females, decreasing by 2.06, 1.32, and 8.23 times in sexually immature females, sexually immature males, and sexually mature males, respectively. Figure 7 ).
[0056] Example 2: Determining the effect of epidermal protein gene RNA interference on insecticide toxicity
[0057] 1. Synthesis of double-stranded RNA
[0058] Specific primers containing the T7 RNA polymerase promoter sequence were designed using the E-RNAi website tool. Double-stranded RNA (dsRNA) was synthesized according to the T7 High Yield Transcription Kit (Thermo Fisher Scientific) instructions, with enhanced green fluorescent protein (EGFP) dsRNA used as a control. The synthesized dsRNA was dissolved in nuclease-free water and quantified and quality-controlled by agarose gel electrophoresis and NanoDrop 2000 for subsequent RNA interference experiments.
[0059] The dsRNA targeting the CPAP3-5 gene is named dsCPAP3-5, and its nucleotide sequence is as follows:
[0060] GATCCGCTCAATAGGCACATCAATAAGTGTGATCAACCTTTCAATGTAGATTGCGGTGACCGAACTGAATTGCAGGAGCCAAAATCTTCTAAATTTTGTCCTCGTAAAAACGGATTCTTCGCACATCCTGATTCTTCTGTATGTGATATTTTTTACAATTGTATTGATGGAGATGCTTTAGAAATGAAATGTACTGTTGGATTGCACTTTGATGAATTTGGTGGAACTTGTGTTTGGCCAGATACTGCGAAACGTGAAGGTTGCGAAGCACCACAGAAAAAATCTCCGACCGGATTTGTGTGCCCGAAGGATCGCCCAAAGAATGATGATAAAGGTCAGGTAGTTACTCATCCGAAGTTCCCCCATCCTACAGACTGTCAAAAATTCCATGTCTGCTTAAATGGGGAAGATCCACGCGATCTAGCCTGTCAATTAGGCGAAGTCTACAATGAAGAAACGGAAATGTGTGATGCTCCTGAAAATGTTCCCGGTTGTGAAG (SEQ ID NO:4).
[0061] The dsRNA targeting the CPLCG-4 gene, named dsCPLCG-4, has the following nucleotide sequence:
[0062] CGTCTCCGTAGTCTTGTTCGCTTTGGCCCTTGGCGCTGCCCACTGCTCGGTCGTACCATTGATCAGTCAAATCAATGGCGCCGTTTTGGCCTCACCACTTGGTTCCGTTGCCGTACATGCCGCCGCCGTGCCAGCCGTTGTCGCCGCCCCAGCACCAGTACAGATCATCACCGCTCCCGCCGTGGTAGCTGCTCCCGCTGTCGTGGCCGCTGAAGGCACCTATGTGGCTAAGACCCGTGGCGCTGTACATGTGGCACCACTGCCCGGTCACATACAATCGGCAGCATCAGTGAACTTGCAACCAGCTC (SEQ ID NO:5).
[0063] The designed dsRNA targeting RR1-52, named dsRR1-52, has the following nucleotide sequence:
[0064] GTAGATCCTACAGGCGAGCGTCGTACAATTTCCTACACTGCTGGCAAAAATGGTTTCCAAGCTAGCGGTGATCACTTGCCCGTACCACCACCAGCTCCACCACAACCCGTGCCACAACCGGGCTACGCACCACAGCCACAATACCAGCCACCAGCACAGTCGGGCGGTTACCGCAGCAACGACTACGATGACGGTTCGTACGATCCACGTTACAATGATCCCGGTTTCGG TCAGCAACAAGGTGGTTATCAGGCACCACAACCGCAATATCAGCCACCAGCACCCGCCTACAATCCACCACCACAACAGCCAGCATATAATCCACCGGCGCCACAATACAACAGCTACCAAGCACAACAACAACCCTACTATCACAGACCACACCCAATCCACACCGCTTCGCACCACCCGGCAAATTGTCGCTGAATCGCACACCAGACGGCTTTAGCT (SEQ ID NO:6).
[0065] 2. Microinjection of dsRNA into the oriental fruit fly
[0066] Using a Nanoliter 2000 microinjection system, 4 μg of dsRNA from the three genes mentioned above was injected into the abdominal segment between the first and second abdominal segments of adult insects. Twenty-four hours after injection, test insects were randomly collected, and gene silencing efficiency was detected by quantitative real-time PCR, along with their sensitivity to insecticides.
[0067] Insecticide susceptibility testing was performed using the drop method, with the application dose being the LD50 of each insecticide. 50 Concentration. Each treatment was repeated 5 times, with 10 adults per replicate.
[0068] 3. RNAi results
[0069] 24 h after dsRNA injection, RT-qPCR results showed that the transcriptional levels of CPAP3-5, CPLCG-4, and RR1-52 decreased by 82.15% ( Figure 8 ), 83.30% Figure 9 ) and 67.67% Figure 10 This indicates that the gene silencing effect is significant.
[0070] After effective gene silencing, the test insects exhibited varying degrees of sensitivity changes to chlorpyrifos, lambda-cyhalothrin, spinosad, and abamectin. Compared to the dsEGFP control group, CPAP3-5 silencing significantly increased the toxicity to chlorpyrifos and lambda-cyhalothrin by 29.96% and 33.82%, respectively, while there were no significant differences in the toxicity to the other two insecticides. Figure 11 After silencing CPLCG-4, the toxicity to chlorpyrifos, abamectin, and spinosad was significantly increased by 29.23%, 13.94%, and 33.94%, respectively, while the toxicity to lambda-cypermethrin was not significantly affected. Figure 12 After RR1-52 silencing, the toxicity to chlorpyrifos and abamectin was significantly increased by 12.71% and 33.81%, respectively, but had no significant effect on the toxicity to spinosad. Figure 13 ).
[0071] The results show that silencing the CPAP3-5, CPLCG-4, and RR1-52 genes can enhance the sensitivity of pests to insecticides. These three genes play specific regulatory roles with partially overlapping functions in the detoxification or resistance processes of different types of insecticides.
Claims
1. A method for enhancing the toxicity of pesticides against the oriental fruit fly, characterized in that, The method described herein aims to reduce the expression levels of the CPAP3-5 gene, CPLCG-4 gene, or RR1-52 gene in *Bacteroides citrinum*, thereby enhancing the toxicity of pesticides to *Bacteroides citrinum*. The nucleotide sequences of the CPAP3-5 gene are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively. The method further involves using RNA interference to reduce the expression level of the CPAP3-5 gene in *Bacteroides citrinum*, thereby enhancing the toxicity of chlorpyrifos and lambda-cypermethrin to *Bacteroides citrinum*; using RNA interference to reduce the expression level of the CPLCG-4 gene in *Bacteroides citrinum*, thereby enhancing the toxicity of chlorpyrifos, abamectin, and spinosad to *Bacteroides citrinum*; and using RNA interference to reduce the expression level of the RR1-52 gene in *Bacteroides citrinum*, thereby enhancing the toxicity of chlorpyrifos and abamectin to *Bacteroides citrinum*. The dsRNA used to reduce the CPAP3-5 gene has the sequence shown in SEQ ID NO:4; the dsRNA used to reduce the CPLCG-4 gene has the sequence shown in SEQ ID NO:5; and the dsRNA used to reduce the RR1-52 gene has the sequence shown in SEQ ID NO:
6.
2. A synergist that enhances the toxicity of pesticides against the oriental fruit fly, characterized in that, The synergist contains a reagent for reducing the expression levels of the CPAP3-5, CPLCG-4, or RR1-52 genes in the oriental fruit fly; the reagent is dsRNA or an engineered strain for recombinant expression of dsRNA; wherein the dsRNA for reducing the expression level of the CPAP3-5 gene has the sequence shown in SEQ ID NO:4; the dsRNA for reducing the expression level of the CPLCG-4 gene has the sequence shown in SEQ ID NO:5; and the dsRNA for reducing the expression level of the RR1-52 gene has the sequence shown in SEQ ID NO:6.