Kit and method for detecting Batai virus based on CRISPR / Cas12a

By combining the CRISPR/Cas12a system with RPA amplification technology and utilizing specific gRNA to recognize the NSs gene of the Bate virus, high-sensitivity and high-specificity virus detection has been achieved, solving the problems of insufficient detection efficiency and accuracy in existing technologies. This method is suitable for epidemiological monitoring and animal quarantine screening.

CN121294734APending Publication Date: 2026-01-09FOSHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511471798.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-04-22
Filing Date
2025-10-15
Publication Date
2026-01-09

Smart Images

  • Figure CN121294734A_ABST
    Figure CN121294734A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of animal virus nucleic acid in-vitro detection, and discloses a kit and a method for detecting a Batai virus based on RPA-CRISPR / Cas12a. Specific RPA primers (SEQ ID NO.1-2) and gRNA-3 (SEQ ID NO.5) are designed, Cas12a trans-cleavage is completed within 15 min at 37 DEG C after isothermal amplification is performed for 30 min at 39 DEG C, and a result is read through a fluorescence or immunochromatography test strip. The sensitivity is 18.9 copy / mu L, compared with traditional qPCR, the time is shortened, and cross reaction with congeneric viruses is avoided. The method is suitable for non-diagnostic purpose epidemiological monitoring and animal quarantine screening.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a kit and method for detecting Batai virus based on CRISPR / Cas12a. BACKGROUND

[0002] Batai virus (BATV) is an enveloped arbovirus, a member of the Bunyamwera serogroup of the Orthobunyavirus genus in the family Peribunyaviridae of the order Bunyavirales. It infects humans, domestic animals, poultry, birds and wild animals, causing non-specific fever, anorexia, neurological symptoms and other clinical symptoms. Among them, BATV infection in ruminants leads to abortion, premature birth and congenital defects. Members of the Orthobunyavirus genus are composed of segmented RNA viruses, with high homology between segments and easy genetic recombination. The small (S) segment and large (L) segment of Bunyamwera virus recombine with the medium (M) segment of BATV to form a new virus strain, Ngari virus, which caused two large-scale human hemorrhagic fever outbreaks in Africa. In nature, Batai virus is transmitted through the "mosquito-vertebrate-mosquito" route, with Culex, Anopheles and Aedes as the main vectors. BATV was first isolated from Culex in Kuala Lumpur, Malaysia in 1955, and has since appeared and spread in many places in Asia, Europe and Africa. So far, Batai virus neutralizing antibodies have been detected in poultry, cattle, goats, sheep, dogs, camels, reindeer and rodents. In 1998, BATV (YN92-4) was isolated from Anopheles (Anopheles dirus) in the lower reaches of the Lancang River in Yunnan Province, China. In 2012, BATV (NM-12) was isolated from cattle serum in Inner Mongolia, and in 2014, a duck strain ZJ2014 was isolated from a sample of Muscovy duck in Zhejiang Province. At present, there is little research on the distribution and prevalence of BATV. Although conventional RT-PCR is the preferred method for screening virus in infected host tissues and body fluid samples, there is a lack of RT-PCR equipment and technical support in rural areas where BATV is prevalent. Anopheles philippinensis

[0003] ​​​RPA isothermal amplification is a relatively new nucleic acid amplification method, which can amplify DNA under isothermal conditions, has the characteristics of rapid, efficient, strong specificity, etc., and does not need a thermal cycler or special laboratory facilities. CRISPR / Cas (Clustered regularly interspaced short palindromic repeats, CRISPRs) is a kind of adaptive immune system in bacteria, and Cas protein targets and degrades foreign nucleic acid through RNA-guided nuclease. According to this characteristic, researchers have developed a variety of nucleic acid detection systems such as CRISPR / Cas9, CRISPR / Cas12 and CRISPR / Cas13. The nucleic acid detection system of CRISPR / Cas12a extracts nucleic acid (RNA and obtains cDNA through reverse transcription), and carries out recombinase polymerase amplification (RPA) under isothermal conditions. The CRISPR / Cas12a-gRNA complex binds and cuts the target DNA, which activates the trans-cleavage of ssDNA, and the fluorescence reporter molecule coupled with ssDNA produces a fluorescence signal when cutting. This new method called DNA endonuclease-targeted CRISPR trans-reporter will provide a powerful platform for rapid and accurate detection of bataviruses nucleic acid. The immunochromatography test strip detection is a kind of efficient technical scheme for rapid detection of pathogens. The reaction time is short during detection, the test strip can be stored for a long time, and the cost is relatively low.

[0004] In summary, there is no existing technology for detecting bataviruses based on the CRISPR / Cas12a system at present. The RPA-CRISPR / Cas12a detection method can establish a specific, stable, sensitive and efficient technical detection system, which has important application value in the detection of ruminant bataviruses. It is expected to significantly improve the embryo survival rate of ruminants such as cattle and sheep, reduce the mortality rate, and improve the economic benefits of the breeding industry after the bataviruses are controlled.

[0005] The kit and method provided by the application are intended for epidemiological investigation, virus tracing, import and export animal quarantine, environmental medium monitoring, and basic research of virology in the field of veterinary public health, and are not for non-diagnostic purposes. The method is not directly used for clinical diagnosis of individual animals or humans, and is not used as the only basis for disease treatment decision. SUMMARY

[0006] In view of the deficiencies and defects of the prior art, the application aims to provide a kit and method for detecting bataviruses based on CRISPR / Cas12a.

[0007] The first object of the application is to provide a batavirus detection method for non-disease diagnosis purposes, comprising the following steps: S1. Extracting RNA in the sample to be tested and reverse transcribing into cDNA; S2. Taking the cDNA obtained in step S1 as a template, using the primers shown in SEQ ID NO. 1 and SEQ ID NO. 2 to perform RPA amplification to obtain specific amplification products; S3. Adding the specific amplification products obtained in step S2 to a CRISPR / Cas12a detection system to perform cleavage reaction to obtain cleavage products; the CRISPR / Cas12a detection system uses fluorescence quantitative detection method or immunochromatography test strip to detect whether the cleavage products contain NSs gene of Bata virus; The CRISPR / Cas12a detection system is: 2 μL 10×NEBuffer, 1 μL 500 nMCas12a, 1 μL 500 nM ssDNA fluorescent reporter probe (reporter), 1 μL 300 nM gRNA, 2 μL specific amplification products obtained in step S2, and the rest is ddH2O, the total system is 20 μL; The ssDNA fluorescent reporter probe (reporter) is ssDNA FQ reporter or ssDNA FB reporter; the nucleotide sequence of the gRNA is shown in any one of SEQ ID NO. 3-SEQ ID NO. 5; the ssDNA fluorescent reporter probe (reporter) contains a cleavable sequence TTATTATT.

[0008] Preferably, the program of the RPA amplification reaction is: 39℃ for 30 min.

[0009] Preferably, when the CRISPR / Cas12a detection system uses fluorescence quantitative detection method for detection, the program of the cleavage reaction is: after incubation at 37℃ for 30 s, the fluorescence signal is collected, the collection interval is 30 s, and a total of 60 times; the ssDNA fluorescent reporter probe (reporter) is ssDNA FQ reporter, and the labeled product is: 5' FAM TTATTATT BHQ 3’.

[0010] Preferably, when the CRISPR / Cas12a detection system uses the immunochromatography test strip for detection, the program of the cleavage reaction is: 37℃ for 5-30 min; the ssDNA fluorescent reporter probe (reporter) is ssDNA FB reporter, and the labeled product is: 5' FAM TTATTATT Biotin 3'.

[0011] Preferably, the Batay virus is bovine Batay virus.

[0012] The second objective of this invention is to provide a kit for detecting Bate virus, comprising an RPA detection system and a CRISPR / Cas12a detection system targeting the conserved NSs gene of Bate virus. The RPA detection system includes the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.2; The CRISPR / Cas12a detection system includes a quantitative fluorescence detection system and / or an immunochromatographic test strip detection system; The fluorescence quantitative detection system includes gRNA with nucleotide sequences as shown in any one of SEQ ID NO.3-SEQ ID NO.5, CRISPR / Cas12a protein, and ssDNA FQ reporter for fluorescence quantitative detection; The immunochromatographic test strip detection system includes an immunochromatographic test strip, gRNA with nucleotide sequences as shown in any one of SEQ ID NO.3-SEQ ID NO.5, CRISPR / Cas12a protein, and ssDNA FB reporter for immunochromatographic test strip detection.

[0013] Preferably, the gRNA is a gRNA with a nucleotide sequence as shown in SEQ ID NO.5.

[0014] Preferably, the working concentration of the gRNA is 300 nM, and the working concentration of the CRISPR / Cas12a protein is 500 nM.

[0015] Preferably, the sequence of the ssDNA FQ reporter is: 5' FAM TTATTATT BHQ 3', working concentration is 500 nM; the sequence of the ssDNA FB reporter is: 5' FAM TTATTATT Biotin 3', working concentration is 500 nM.

[0016] Preferably, the immunochromatographic test strip contains a test line and a control line; the test line is coated with an anti-fluorescein antibody labeled with gold nanoparticles, the anti-fluorescein antibody being used to bind to the fluorescent group FAM of the ssDNA FB reporter; the control line contains streptavidin, the streptavidin being used to bind to the biotin group.

[0017] When using quantitative real-time detection, if the Bate virus gene is present in the CRISPR / Cas12a detection system, the nuclease activity of the CRISPR / Cas12a protein will be specifically activated under the mediation of Bate virus-specific gRNA. The activated CRISPR / Cas12a protein cleaves the ssDNA FQ reporter labeled with the fluorescent group FAM and the quencher group BHQ, thereby releasing the activated fluorescent group FAM, which can be detected using quantitative real-time detection. Conversely, when the Bate virus gene sequence is not present in the sample to be tested, the fluorescence reading will be the baseline value.

[0018] When using immunochromatographic test strips, after the CRISPR / Cas12a sample is cut and added to the test strip, the colloidal gold-labeled anti-fluorescein antibody binds to the ssDNA FB reporter labeled with fluorescent group FAM and biotin. The complex flows from the control line to the test line with the liquid flow direction. The streptavidin on the control line saturates and captures the ssDNA FB reporter labeled with fluorescent group FAM and biotin, thus displaying a band. When CRISPR / Cas12a detects the Bate virus gene, it cuts the ssDNA FB reporter labeled with fluorescent group FAM and biotin, resulting in the capture and color development of the fluorescent group FAM-labeled ssDNA fragment by the test line. When CRISPR / Cas12a does not detect the Bate virus gene sequence, it cannot cut the ssDNA FB reporter labeled with fluorescent group FAM and biotin, thus no fluorescent group FAM-labeled ssDNA fragment is captured and color developed by the test line.

[0019] The beneficial effects of this invention are: 1. This invention utilizes CRISPR / Cas12a specific nucleic acid recognition combined with immunochromatography to achieve highly sensitive, highly specific, and rapid visual detection of Bate virus. Research has shown that the NSs gene is well-conserved, and it was selected as the target sequence for detection. Based on the recognition characteristics of Cas12a at the TTTV site, three specific gRNAs were designed. Detection revealed that gRNA-3 (SEQ ID NO. 5) had the highest sensitivity, and a rapid detection system was established based on this.

[0020] 2. This invention is a CRISPR / Cas12a-based Bate virus detection tool, which includes immunochromatographic band detection and enables convenient and rapid result interpretation.

[0021] 3. This invention utilizes CRISPR / Cas12a for specific sequence cleavage and immunochromatography to achieve rapid, highly specific, highly sensitive, and visual detection of the Bate virus. It can detect sequences up to 1.89 × 10⁻⁶. 1 The rapid detection method for Bataevirus established in this invention provides an accurate, rapid, and simple detection method for epidemiological surveillance and animal quarantine screening. (Copy / µL of Bataevirus nucleic acid.)

[0022] 4. This invention discloses a series of RPA-CRISPR / Cas12a reaction systems, RPA amplification primers, and specific gRNAs for the detection of Bate virus, the sequences of which are shown in SEQ ID NO.1 to SEQ ID NO.7. This invention is the first to utilize RPA-CRISPR / Cas12a for the detection of Bate virus, and it has advantages such as high sensitivity, strong specificity, short processing time, high throughput, and no dependence on large-scale experimental equipment. These advantages make the CRISPR / Cas12a-based immunochromatographic test strip detection method developed in this invention convenient for rapid detection and screening of Bate virus in laboratories. Attached Figure Description

[0023] Figure 1 The image shows the fluorescence detection results (44 min) of the Bate virus based on CRISPR / Cas12a specific gRNA in the example.

[0024] Figure 2 This is a bar graph showing the results of specific target sequences from gRNA-1 to gRNA-3 when using quantitative fluorescence detection of Bate virus based on CRISPR / Cas12a in Example 1.

[0025] Figure 3 The results for Example 2, based on CRISPR / Cas12a, show the detection results of the specific gRNA with specific target sequence gRNA-3 when using quantitative fluorescence method to detect Bate virus. The concentrations of the specific gRNA were set to 300 nM, 200 nM, 100 nM, 50 nM, 25 nM, 0 nM, and the negative control (NTC).

[0026] Figure 4The results are for the ssDNA FQreporter concentrations of 500 nM, 250 nM, 125 nM, 50 nM, 25 nM, 10 nM, 0 nM and the negative control (NTC) when using quantitative real-time fluorescence to detect Bate virus based on CRISPR / Cas12a in Example 3.

[0027] Figure 5 The results are for the detection of Bate virus using quantitative fluorescence method based on CRISPR / Cas12a in Example 4, with Cas12a concentrations set to 1 µM, 500 nM, 450 nM, 300 nM, 200 nM, 100 nM, 0 nM, and the negative control (using ddH2O as a template, NTC).

[0028] Figure 6 This is a specific detection diagram of different viruses and negative controls (NTCs) detected by quantitative fluorescence method based on CRISPR / Cas12a in Example 5.

[0029] Figure 7 This is a bar chart showing the specificity of results for different viruses and negative controls (NTCs) detected by quantitative fluorescence method based on CRISPR / Cas12a in Example 5.

[0030] Figure 8 In Example 6, when using CRISPR / Cas12a to detect the sensitivity of Bate virus using quantitative real-time immunoassay, the concentration of the recombinant BATV-NSs plasmid was 1.89 × 10⁻⁶. 8 copy / µL, 1.89×10 7 copy / µL, 1.89×10 6 copy / µL, 1.89×10 5 copy / µL, 1.89×10 4 copy / µL, 1.89×10 3 copy / µL, 1.89×10 2 copy / µL, 1.89×10 1 copy / µL, 1.89×10 0 copy / µL, 1.89×10 -1 Sensitivity test results corresponding to copy / µL and negative control (using ddH2O as template, NTC).

[0031] Figure 9The results of the detection of different concentrations of ssDNA FB reporter under negative conditions based on CRISPR / Cas12a in Example 7 are as follows (1: 500 nM; 2: 400 nM; 3: 300 nM; 4: 200 nM; 5: 100 nM; 6: 50 nM).

[0032] Figure 10 The specificity detection diagrams for the detection of Bate virus and the negative control based on the CRISPR / Cas12a test strip method in Example 8 are shown (1: RPA product; 2: negative control using ddH2O as a template).

[0033] Figure 11 The sensitivity detection results for different concentrations of recombinant BATV-NSs plasmid and the negative control in Example 9, based on CRISPR / Cas12a and using the test strip method to detect BATV virus, are shown (1:1.89×10⁻⁶). 4 copy / µL; 2: 1.89×10 3 copy / µL; 3: 1.89×10 2 copy / µL; 4: 1.89×10 1 copy / µL; 5: 1.89×10 0 Copy / µL; 6: negative control using ddH2O as a template).

[0034] Figure 12 The results for different reaction times (1: 30 min; 2: 20 min; 3: 15 min; 4: 10 min; 5: negative control) are shown in Example 10 when the test strip method for detecting Bate virus is based on CRISPR / Cas12a.

[0035] Figure 13 The results for different incubation times (1: 5 min incubation (positive); 2: 5 min incubation (negative); 3: 10 min incubation (positive); 4: 10 min incubation (negative)) are shown in Example 11 when the test strip method is used to detect the Bate virus based on CRISPR / Cas12a. Detailed Implementation

[0036] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0037] The recombinase polymerase amplification kit (RPA) used in the following examples was purchased from Adicon Technologies Corporation Limited. The CRISPR / Cas12a protein was manufactured by NEB (New England Biotechnology (Beijing) Co., Ltd.). RPA amplification primers, gRNA, and ssDNA probes were synthesized by Sangon Biotech Co., Ltd. In the following examples, a rapid nucleic acid release kit (viral DNA / RNA extraction kit (column method)) purchased from Novizan was used to obtain pretreated nucleic acids for further detection. The Batey virus was isolated, identified, and preserved in the laboratory.

[0038] 1.1 Construction of positive plasmids In this embodiment, the conserved NSs gene fragment of the BAT virus was amplified from the BAT virus (BATVNM-12, whose full-length genes of the S, M, and L fragments of the new BATVNM-12 strain were isolated from bovine serum in Mongolia and are stored in the GenBank database with accession numbers KJ187038, KJ187039, and KJ187040, respectively).

[0039] PCR primers were designed targeting the conserved NSs gene fragment of the Bate virus. The forward and reverse primers were named BATV-NSs-F and BATV-NSs-R, respectively (see SEQ ID NO.6-SEQ ID NO.7), and their specific sequences are shown in Table 1. After design, the primers were synthesized at Sangon Biotech Co., Ltd.

[0040] Table 1. Primers for Baty virus PCR Note: N in the sequence represents any nucleotide of A, T, C, or G.

[0041] BATV (NM-12) virus solution was inoculated into mouse neuroblastoma cells in good growth condition. After blind passage to the third generation, cytopathic effects were observed in the cells. Cells were harvested when approximately 80% of the cells showed cytopathic effects, and the cells were subjected to three freeze-thaw cycles. The collected virus was then stored at -80°C. The aliquoted virus was thawed on ice, and viral nucleic acid was extracted in a biosafety cabinet according to the Gene JET Viral DNA and RNA Purification Kit manual. The extracted total RNA was reverse transcribed according to the HiScript II 1st Strand cDNA Synthesis Kit (Novizan, catalog number R212). The reaction system and procedure for reverse transcription are shown in Table 2.

[0042] Table 2 Reverse Transcription System The BATV-NSs primers (BATV-NSs-F / BATV-NSs-R) designed in this experiment were used to perform PCR amplification with the cDNA sample obtained after reverse transcription. The samples were then ligated, transformed, and the recombinant plasmid DH5α strain was screened. The recombinant plasmid was extracted and sent to Sangon Biotech Co., Ltd. for sequencing. The sequencing results were consistent with the target fragment sequence, indicating that the recombinant plasmid was constructed correctly and named BATV-NSs.

[0043] 1.2 Design and preparation of primers for Bate virus-specific gRNA and RPA The specific gRNA was prepared according to the following protocol: A target sequence containing the CRISPR / Cas12a recognition sequence (PAM) TTTV was identified in the Bate virus NSs gene. A specific gRNA of 44 nt in length was designed. The specific gRNA consisted of the Cas12a system crRNA backbone sequence UAAUUUCUACUAAGUGUAGAU and the specific target sequence, as detailed in SEQ ID NO. 3-SEQ ID NO. 5, as shown in Table 3. After design, the gRNA was directly synthesized at Sangon Biotech.

[0044] Table 3. Baty virus-specific gRNA Note: The underlined portion in the sequence represents the specific target.

[0045] RPA primers were prepared according to the following protocol: based on the binding site of the specific gRNA, RPA primers were designed in the upstream and downstream regions, named BATV-RPA-F (see SEQ ID NO.1) and BATV-RPA-R (see SEQ ID NO.2), as shown in Table 4. After design, the specific gRNA was directly synthesized at Sangon Biotech Co., Ltd.

[0046] Table 4. Primers for Batai virus RPA 1.3 RPA isothermal amplification The RPA reaction system is shown in Table 5. After the components in the reaction system are thoroughly mixed, the reaction is carried out at 39°C for 30 min in a constant temperature device to obtain the specific product.

[0047] Table 5 RPA amplification system 1.4 CRISPR / Cas12a system for cutting the target fragment The test used a 20 μL system as shown in Table 6, but it is not limited to this and includes adjustments to the proportions of the corresponding components.

[0048] Table 6. CRISPR / Cas12a Detection System for Bate Virus The ssDNA reporter is either an ssDNA FQ reporter or an ssDNA FB reporter. The ssDNA FQ reporter is used for quantitative real-time detection; the ssDNA FB reporter is used for immunochromatographic strip detection. The ssDNA FQ reporter is ssDNA labeled with 6-carboxyfluorescein and a fluorescence quencher, with the labeling product as follows: 5'-FAM-TTATTATT-BHQ-3', named ssDNA FQ reporter / 5'-FAM-TTATTATT-BHQ-3'. The ssDNA FB reporter is ssDNA labeled with fluorescein and biotin, with the labeling product as follows: 5'-FAM-TTATTATT-Biotin-3', named ssDNA FB reporter / 5'-FAM-TTATTATT-Biotin-3'.

[0049] 1.5 Quantitative Fluorescence Detection The detection activity of the CRISPR / Cas12a detection system was determined using fluorescence detection. In quantitative fluorescence detection, various components were sequentially added to the CRISPR / Cas12a target gene detection system, and fluorescence kinetics were monitored. After thorough mixing, the mixture was incubated at 37°C for 30 seconds, and fluorescence signals were collected starting at 30-second intervals for a total of 60 collections.

[0050] The detection activity of the CRISPR / Cas12a detection system was determined using fluorescence detection. Quantitative fluorescence analysis was used to measure the fluorescence of the detection reaction. In the detection of the Bate virus, the cleavage kinetics of each Bate virus gRNA (gRNA1-gRNA3) were monitored, such as... Figure 1 (60 cycles). The results can be determined using a fluorescence method, enabling the detection of the Batey virus.

[0051] 1.6 Immunochromatographic test strip detection In the immunochromatographic test strip detection, the test strip contains an anti-fluorescein antibody labeled with gold nanoparticles, which binds to the fluorescent group FAM of the ssDNA FB reporter. The control line (C line) of the immunochromatographic test strip contains streptavidin, which binds to the biotin group. Various components are added sequentially to the CRISPR / Cas12a target gene detection system. After thorough mixing, the mixture is reacted at 37°C for 15-30 min.

[0052] The immunochromatographic test strip detection procedure is as follows: Mix 20 μL of CRISPR / Cas12a cleavage product with 30 μL of ultrapure water. Immerse the test strip in the mixture and react for 5 min. The result can then be visually determined.

[0053] Example 1: Optimal gRNA screening for CRISPR / Cas12a detection system Quantitative fluorescence was used to detect CRISPR / Cas12a reaction kinetics, and the results are as follows: Figures 1-2 As shown, the kinetics of cleavage detection for each specific gRNA (specific target sequence gRNA1-gRNA3) against Bate virus were monitored (60 cycles). It was found that the specific gRNA with specific target sequence gRNA-3 had a high fluorescence value for the detection of Bate virus.

[0054] Based on the results obtained in Example 1, the specific gRNA of gRNA-3, which has a specific targeting sequence as shown in SEQ ID NO.5, has a high fluorescence value for the detected Bate virus gene. Therefore, the specific gRNA of gRNA-3, which has a specific targeting sequence as shown in SEQ ID NO.5, was used for subsequent detection.

[0055] Example 2: Optimization of gRNA concentration in CRISPR / Cas12a detection system Quantitative fluorescence was used to measure and detect the reaction kinetics of CRISPR / Cas12a, using a 20 µL system as shown in Table 6. The concentrations of specific gRNA targeting the specific sequence gRNA-3 (SEQ ID NO. 5) were set at 300 nM, 200 nM, 100 nM, 50 nM, 25 nM, 0 nM (gRNA limit dilution to 0 nM), and a negative control (using ddH2O instead of gRNA). Figure 3 As shown, in the detection of Bate virus, a high fluorescence value was found when the concentration of specific gRNA of gRNA-3, which has a specific target sequence as shown in SEQ ID NO.5, was 300 nM.

[0056] Based on the results obtained in Example 2, the concentration of the specific gRNA of gRNA-3, which has a specific targeting sequence as shown in SEQ ID NO.5, at 300 nM showed a high fluorescence value for the detected Bate virus gene. Therefore, the specific gRNA of gRNA-3, which has a specific targeting sequence as shown in SEQ ID NO.5, at a concentration of 300 nM was used for subsequent detection.

[0057] Example 3: Optimization of ssDNA FQ reporter concentration in CRISPR / Cas12a detection system Quantitative fluorescence was used to measure and monitor the reaction kinetics of CRISPR / Cas12a, using a 20 µL system as shown in Table 6. The concentrations of the ssDNA FQ reporter were set at 500 nM, 250 nM, 125 nM, 50 nM, 25 nM, 10 nM, 0 nM (ssDNA FQ reporter was infinitesimally diluted to 0 nM), and a negative control (using ddH2O instead of the ssDNA FQ reporter). Figure 4 As shown, a high fluorescence value was found in the detection of Bate virus when the concentration of ssDNA FQ reporter was 500 nM.

[0058] Based on the results obtained in Example 3, the concentration of ssDNA FQ reporter at 500 nM showed a high fluorescence value for the detected Bate virus gene. Therefore, ssDNA FQ reporter at a concentration of 500 nM was used for subsequent detection.

[0059] Example 4: Optimization of Cas12a concentration in the CRISPR / Cas12a detection system Quantitative PCR was used to measure and monitor the reaction kinetics of CRISPR / Cas12a, employing a 20 µL system as shown in Table 6. Cas12a concentrations were set at 1 µM, 500 nM, 450 nM, 300 nM, 200 nM, 100 nM, 0 nM (Cas12a was infinitesimally diluted to 0 nM), and a negative control (using ddH2O instead of Cas12a). Figure 5 As shown, a high fluorescence value was found in the detection of Bate virus when the concentration of Cas12a was 500 nM.

[0060] Based on the results obtained in Example 4, Cas12a at a concentration of 500 nM showed a high fluorescence value for the detected Bate virus gene. Therefore, Cas12a at a concentration of 500 nM was used for subsequent detection.

[0061] Example 5: CRISPR / Cas12a Specificity Assay for Detecting Bate Virus In the specificity assay, pseudorabies virus (PRV), getta virus (GETV), Japanese encephalitis virus (JEV), and porcine reproductive and respiratory syndrome virus (PRRSV) nucleic acids were used as templates for RPA amplification. A negative control (ddH2O template) and a positive control (BATV-NSs plasmid template) were also included. The reaction system is shown in Table 5. After thorough mixing, the reaction was carried out at 39℃ for 30 min in a constant temperature device. After the RPA amplification reaction, the target fragment was cleaved using the CRISPR / Cas12a system according to the system shown in Table 6 (wherein, the specific gRNA used was 300 nM of the specific target sequence gRNA-3 shown in SEQ ID NO. 5, the Cas12a concentration was 500 nM, and the ssDNA reporter was 500 nM of ssDNA FQreporter). Finally, quantitative fluorescence detection was performed.

[0062] The results obtained in Example 5 are as follows Figures 6-7 As shown, only the BATV-NSs recombinant plasmid has a high fluorescence value, and the RPA-CRISPR / Cas12a fluorescence quantitative method has high specificity for detecting Bate virus.

[0063] Example 6: Sensitivity test of CRISPR / Cas12a for detecting Bate virus In the sensitivity test, the BATV-NSs-DH5α strain was revived, and after identification, the recombinant plasmid was extracted. The concentration of the recombinant plasmid was measured to be 90 ng / µL. Based on the molecular weight conversion, the copy number was found to be 1.89 × 10⁻⁶. 10 Copies / μL, after 10-fold serial dilution, were directly used as RPA templates to obtain 1.89 × 10⁻⁶ copies / μL. 8 copy / µL, 1.89×10 7 copy / µL, 1.89×10 6 copy / µL, 1.89×10 5 copy / µL, 1.89×10 4 copy / µL, 1.89×10 3 copy / µL, 1.89×10 2 copy / µL, 1.89×10 1 copy / µL, 1.89×10 0 copy / µL, 1.89×10 -1Ten samples were collected at a concentration of copy / µL. Using the 10 concentration gradients of BATV-NSs recombinant plasmids as templates, RPA amplification reactions were performed. The reaction systems are shown in Table 5. After thorough mixing, the mixtures were incubated at 39℃ for 30 min. After the RPA amplification reaction, the target fragment was cleaved using the CRISPR / Cas12a system according to the system shown in Table 6 (wherein, the specific gRNA used was a 300 nM specific target sequence such as gRNA-3 as shown in SEQ ID NO. 5, the Cas12a concentration was 500 nM, and the ssDNA reporter was a 500 nM ssDNA FQ reporter). Finally, quantitative fluorescence detection was performed.

[0064] The results obtained in Example 6 are as follows Figure 8 As shown, the RPA-CRISPR / Cas12a fluorescence quantitative method can detect Bate virus at a resolution of 1.89 × 10⁻⁶. 1 High-sensitivity detection of copy / µL copies.

[0065] Example 7: Screening of negative ssDNA FB reporter concentration using CRISPR / Cas12a detection system In the immunochromatographic test strip assay, a 20 µL system as shown in Table 6 was used. The concentrations of ssDNA FB reporter were set to 500 nM, 250 nM, 125 nM, 50 nM, 25 nM, 10 nM, and 0 nM. ddH2O was used as the template. The specific gRNA used was a gRNA with a specific target sequence of gRNA-3 (as shown in SEQ ID NO. 5) at a concentration of 300 nM, and Cas12a at a concentration of 500 nM. After reacting at 39℃ for 30 min, 20 µL of the reaction product was mixed with 30 µL of ultrapure water. The test strip was immersed for 5 minutes, and the results were observed.

[0066] The results are as follows Figure 9 As shown, a control line appeared but a test line did not appear when the concentration of ssDNA FB reporter was 500 nM.

[0067] Based on the results obtained in Example 7, the ssDNA FB reporter concentration of 500 nM is more accurate for detecting Bate virus using immunochromatographic test strips. Therefore, a concentration of 500 nM ssDNA FB reporter was used for subsequent immunochromatographic test strip detection.

[0068] Example 8: Determination of ssDNA FB reporter concentration in CRISPR / Cas12a detection system In the immunochromatographic test strip assay, a 20 µL system as shown in Table 6 was used. The concentration of ssDNA FB reporter was set to 500 nM. The positive control template was the RPA amplification product of the BATV-NSs recombinant plasmid, and the negative control template was ddH2O. The specific gRNA used was the specific gRNA with the specific targeting sequence shown in SEQ ID NO.5, gRNA-3, and the Cas12a concentration was 500 nM. After reacting at 37℃ for 30 min, 20 µL of the reaction product was mixed with 30 µL of ultrapure water. The test strip was immersed for 5 minutes, and the results were observed.

[0069] The results are as follows Figure 10 As shown, when the concentration of ssDNA FB reporter was 500 nM, a detection line appeared in the positive control, but no detection line appeared in the negative control, thus establishing the positive and negative control criteria.

[0070] Based on the results obtained in Example 8, ssDNA FB reporter at a concentration of 500 nM was used for subsequent immunochromatographic test strip detection.

[0071] Example 9: Sensitivity test of CRISPR / Cas12a for detecting Bate virus In the immunochromatographic test strip sensitivity test, the BATV-NSs-DH5α strain was revived, identified, and the recombinant plasmid was extracted. The concentration of the recombinant plasmid was measured to be 90 ng / µL. Based on the molecular weight conversion, the copy number was found to be 1.89 × 10⁻⁶. 10 Copies / μL, after 10-fold serial dilution, were directly used as RPA templates to obtain 1.89 × 10⁻⁶ copies / μL. 4 copy / µL, 1.89×10 3 copy / µL, 1.89×10 2 copy / µL, 1.89×10 1 copy / µL, 1.89×10 0Five samples were collected at a concentration of copy / µL. Using the BATV-NSs recombinant plasmids at the five concentration gradients mentioned above as templates, RPA amplification reactions were performed. The reaction systems are shown in Table 5. After thorough mixing, the mixtures were incubated at 39℃ for 30 min in a constant temperature environment. After the RPA amplification reaction, the target fragment was cleaved using the CRISPR / Cas12a system according to the system shown in Table 6 (wherein, the specific gRNA used was a specific gRNA with a specific target sequence such as gRNA-3 as shown in SEQ ID NO. 5 at a concentration of 300 nM, the Cas12a concentration was 500 nM, and the ssDNA reporter was a 500 nM ssDNA FB reporter). After incubation at 37℃ for 30 min, 20 µL of the reaction product was mixed with 30 µL of ultrapure water. The test strips were immersed for 5 minutes, and the results were observed.

[0072] The results obtained in Example 9 are as follows Figure 11 As shown, the RPA-CRISPR / Cas12a immunochromatographic test strip can detect Bate virus at a resolution of 1.89 × 10⁻⁶. 1 High-sensitivity detection of copy / µL copies.

[0073] Example 10: Optimal reaction time optimization of CRISPR / Cas12a detection system In the immunochromatographic test strip detection, a 20 µL system as shown in Table 6 was used (wherein, the specific gRNA used was 300 nM of the specific target sequence gRNA-3 as shown in SEQ ID NO. 5, the Cas12a concentration was 500 nM, and the ssDNA reporter was 500 nM ssDNA FB reporter). The reaction was carried out in a metal bath at 37℃ for 30 min, 20 min, 15 min, and 10 min, respectively. A negative control was set up (using ddH2O as a template). After the reaction, 20 µL of the reaction product was mixed with 30 µL of ultrapure water. The test strip was immersed in the mixture for 5 minutes, and the reaction time was determined by observing the change in the T line.

[0074] The results are as follows Figure 12 As shown, a clear T-line can be observed after 15 minutes of reaction in the Cas12a system, making it easy to observe with the naked eye. This method completes detection in 15 minutes with a sensitivity of 18.9 copies / μL; while traditional qPCR using cDNA as a template requires at least 95 minutes, and has poor repeatability when the Ct value is ≥38.

[0075] Based on the results obtained in Example 10, a reaction time of 15 minutes was used for subsequent immunochromatographic test strip detection.

[0076] Example 11: Optimal incubation time optimization for the CRISPR / Cas12a detection system In the immunochromatographic test strip detection, a 20 µL system as shown in Table 6 was used (wherein, the specific gRNA used was 300 nM of the specific target sequence gRNA-3 as shown in SEQ ID NO. 5, the Cas12a concentration was 500 nM, and the ssDNA reporter was 500 nM ssDNA FB reporter). The reaction was carried out in a metal bath at 37℃ for 15 min, with a negative control (ddH2O as a template). After the reaction, 20 µL of the reaction product was mixed with 30 µL of ultrapure water. The test strips were immersed for 5 min and 10 min, respectively, and the incubation time of the test strips was determined by observing the change of the T line.

[0077] The results are as follows Figure 13 As shown, at 5 min, the negative control T line had no bands, and the T line depth of the positive sample could be observed with the naked eye. At 10 min, the changes in the depth of the T and C lines of the positive and negative controls were the same as at 5 min.

[0078] Based on the results obtained in Example 11, an incubation time of 5 minutes was sufficient to clearly distinguish between positive and negative results, and the negative control showed no background interference. Extending the incubation time to 10 minutes did not significantly improve the results. Therefore, to maximize detection efficiency, 5 minutes was determined to be the optimal incubation time.

[0079] The results show that the nucleic acid detection technology combining RPA and CRISPR / Cas12a can achieve sensitive, rapid and accurate detection of the nucleic acid of the Batae virus.

Claims

1. A method for detecting Bate virus for non-disease diagnostic purposes, characterized in that, Includes the following steps: S1. Extract RNA from the sample to be tested and reverse transcribe it into cDNA; S2. Using the cDNA obtained in step S1 as a template, RPA amplification was performed using the primers shown in SEQ ID NO.1 and SEQ ID NO.2 to obtain specific amplification products; S3. The specific amplification product obtained in step S2 is added to the CRISPR / Cas12a detection system for cutting, and the presence of the Bate virus NSs gene is determined by fluorescence quantitative method or immunochromatographic test strip. The CRISPR / Cas12a detection system is as follows: 2 μL 10×NEBuffer, 1 μL 500 nMCas12a, 1 μL 500 nM ssDNA fluorescent reporter probe, 1 μL 300 nM gRNA, 2 μL of the specific amplification product obtained in step S2, with the remainder being ddH2O, and the total volume is 20 μL. The ssDNA fluorescent reporter probe is an ssDNA FQ reporter or an ssDNA FB reporter; the nucleotide sequence of the gRNA is shown in any one of SEQ ID NO.3-SEQ ID NO.5; the ssDNA fluorescent reporter probe contains a cleavable sequence TTATTATT.

2. The method according to claim 1, characterized in that, The RPA amplification reaction procedure is as follows: 39℃ for 30 min.

3. The method according to claim 1, characterized in that, When using the quantitative fluorescence detection method in the CRISPR / Cas12a detection system, the cleavage reaction procedure is as follows: incubation at 37°C for 30 seconds, followed by fluorescence signal acquisition, with acquisition intervals of 30 seconds, for a total of 60 times; the ssDNA fluorescent reporter probe is an ssDNA FQ reporter, and its labeled product is: 5' FAM TTATTATT BHQ 3'.

4. The method according to claim 1, characterized in that, When using the aforementioned immunochromatographic test strip to detect CRISPR / Cas12a, the cleavage reaction procedure is 37℃ for 5-30 min; the ssDNA fluorescent reporter probe is an ssDNA FB reporter, and its labeled product is: 5' FAM TTATTATT Biotin 3'.

5. The method according to any one of claims 1-4, characterized in that, The aforementioned Batay virus is bovine Batay virus.

6. A kit for detecting Bate virus, characterized in that, This includes RPA detection systems and CRISPR / Cas12a detection systems targeting conserved NSs genes of the Bate virus; The RPA detection system includes the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.2; The CRISPR / Cas12a detection system includes a quantitative fluorescence detection system and / or an immunochromatographic test strip detection system; The fluorescence quantitative detection system includes gRNA with nucleotide sequences as shown in any one of SEQ ID NO.3-SEQ ID NO.5, CRISPR / Cas12a protein, and ssDNA FQ reporter for fluorescence quantitative detection; The immunochromatographic test strip detection system includes an immunochromatographic test strip, gRNA with nucleotide sequences as shown in any one of SEQ ID NO.3-SEQ ID NO.5, CRISPR / Cas12a protein, and ssDNAFB reporter for immunochromatographic test strip detection.

7. The reagent kit according to claim 6, characterized in that, The gRNA is a gRNA with a nucleotide sequence as shown in SEQ ID NO.

5.

8. The reagent kit according to claim 6, characterized in that, The working concentration of the gRNA is 300 nM, and the working concentration of the CRISPR / Cas12a protein is 500 nM.

9. The reagent kit according to claim 6, characterized in that, The sequence of the ssDNA FQ reporter is: 5' FAM TTATTATT BHQ 3', working concentration is 500 nM; the sequence of the ssDNA FB reporter is: 5' FAM TTATTATT Biotin 3', working concentration is 500 nM.

10. The reagent kit according to claim 6, characterized in that, The immunochromatographic test strip contains a test line and a control line; the test line is coated with an anti-fluorescein antibody labeled with gold nanoparticles, the anti-fluorescein antibody being used to capture FAM-labeled ssDNA fragments; the control line contains streptavidin, the streptavidin being used to bind to the biotin group.