Use of apple MdMYS1 gene in regulating wax content of plant fruits and leaves

By constructing overexpression and silencing vectors for the apple MdMYS1 gene, the wax content of fruits and leaves was regulated, solving the problem of unclear roles of key genes in apple wax synthesis. This resulted in a significant increase in wax content and enhanced stress resistance, improving fruit quality and reducing losses.

CN121320380BActive Publication Date: 2026-04-28QINGDAO AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511751416.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-04-28
Estimated Expiration
2045-11-26

AI Technical Summary

Technical Problem

In existing technologies, the role of MdMYS1, a key gene for apple wax synthesis, is unclear, leading to insufficient regulation of wax content in fruits and leaves, which affects fruit quality and stress resistance.

Method used

By constructing overexpression and silencing vectors for the apple MdMYS1 gene, the wax content of plant fruits and leaves can be regulated to increase or decrease wax deposition, thereby enhancing drought resistance and disease and pest resistance.

Benefits of technology

It significantly increases the wax content of apple and tomato fruits and leaves, enhances drought resistance and disease and pest resistance, improves fruit quality, reduces postharvest water loss and disease infection, lowers management costs, and improves economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320380B_ABST
    Figure CN121320380B_ABST
Patent Text Reader

Abstract

The application discloses application of an apple MdMYS1 gene in regulation of wax content of plant fruits and leaves and belongs to the technical field of plant genetic engineering. The application separates a MdMYS1 gene with high expression in an apple variety with high wax content, and the nucleotide sequence of the MdMYS1 gene is shown as SEQ ID NO. 1. Subcellular localization shows that a transcription factor expressed by the MdMYS1 gene is located on a cell nucleus. Experimental results show that overexpression of the MdMYS1 gene can significantly improve the wax content of apple fruits and leaves by promoting biosynthesis of the wax, and the MdMYS1 gene plays a key role in regulation of the wax content of apple fruits and leaves. The application provides an efficient and rapid way for apple breeding, provides gene materials for improvement of apple quality, and has wide application prospects in improvement of economic and ecological benefits of apple planting.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the apple MdMYS1 gene in regulating the wax content of plant fruits and leaves. Background Technology

[0002] The apple industry plays a vital role in increasing fruit growers' income and promoting rural economic development. The quality of the fruit directly affects its economic value and growers' income. The waxy coating on the apple peel acts as a protective barrier, significantly contributing to improved fruit quality and resistance.

[0003] The waxy coating on fruit acts as a natural protective barrier. On one hand, it effectively reduces water loss, maintains the freshness and plumpness of the fruit, and minimizes post-harvest shriveling and drying caused by water loss, thus greatly extending its shelf life. On the other hand, the dense waxy layer can resist pathogen infection, prevent the attachment and invasion of harmful microorganisms, reduce post-harvest rot, ensure fruit quality, and reduce economic losses. For leaves, sufficient wax helps regulate stomatal conductance, optimizes water use efficiency, and enables leaves to maintain normal photosynthesis and physiological metabolism under adverse conditions such as drought or high temperatures. Moreover, the wax can reflect some strong light, reduce photoinhibition damage to leaves, enhance the overall stress resistance of apple trees, ensure healthy tree growth, and lay the foundation for high-quality and high-yield fruit.

[0004] Previous studies have focused on various factors affecting apple growth and development, while also exploring key functional genes that can specifically increase the wax content of apple fruits and leaves. It is known that plant wax synthesis involves a series of complex biochemical pathways regulated by multiple genes. However, the role of the transcription factor MdMYS1 in increasing wax content in apple fruits and leaves remains unclear. Therefore, in-depth research and analysis of this functional gene are of great significance for revealing the mechanism of apple wax synthesis, optimizing apple quality, and enhancing stress resistance. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the apple MdMYS1 gene in regulating the wax content of plant fruits and leaves, in order to solve the problems existing in the prior art. This invention discovers the key role of the MdMYS1 gene in apple wax synthesis, and that overexpression of the MdMYS1 gene can significantly increase the wax content on the surface of apple fruits.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides an application of the apple MdMYS1 gene in any of the following:

[0008] (1) Regulate the wax content of plant fruits and / or leaves;

[0009] (2) Cultivating transgenic plants with high wax content in fruits and / or leaves;

[0010] (3) Prepare products that increase the wax content of plant fruits and / or leaves;

[0011] The nucleotide sequence of the MdMYS1 gene is shown in SEQ ID NO.1.

[0012] Preferably, the apple MdMYS1 gene is overexpressed in plants to increase the wax content of the fruit and / or leaves of the plants;

[0013] The plants mentioned are apples and tomatoes.

[0014] Preferably, the method for overexpressing the apple MdMYS1 gene in plants includes the steps of constructing an overexpression vector of the apple MdMYS1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

[0015] The present invention also provides the use of the recombinant vector of the apple MdMYS1 gene in any of the following:

[0016] (1) Regulate the wax content of plant fruits and / or leaves;

[0017] (2) Cultivating transgenic plants with high wax content in fruits and / or leaves;

[0018] (3) Prepare products that increase the wax content of plant fruits and / or leaves.

[0019] The present invention also provides the use of the engineered bacteria of the recombinant vector in any of the following:

[0020] (1) Regulate the wax content of plant fruits and / or leaves;

[0021] (2) Cultivating transgenic plants with high wax content in fruits and / or leaves;

[0022] (3) Prepare products that increase the wax content of plant fruits and / or leaves.

[0023] The present invention also provides a method for increasing the wax content of plant fruits and / or leaves, comprising the step of overexpressing the apple MdMYS1 gene in the plant to increase the wax content of the plant fruits and / or leaves;

[0024] The nucleotide sequence of the MdMYS1 gene is shown in SEQ ID NO.1;

[0025] The plants mentioned are apples and tomatoes.

[0026] Preferably, the method for overexpressing the apple MdMYS1 gene in plants includes the steps of constructing an overexpression vector of the apple MdMYS1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

[0027] This invention also provides a breeding method for transgenic plants with high wax content in fruits and / or leaves, comprising the following steps:

[0028] The apple MdMYS1 gene is overexpressed in plant cells, the plant cells are then cultured, and the plant cells are used to regenerate plants, resulting in transgenic plants with increased wax content in the fruit and / or leaves.

[0029] The nucleotide sequence of the MdMYS1 gene is shown in SEQ ID NO.1;

[0030] The plants mentioned are apples and tomatoes.

[0031] The present invention also provides an application of the apple MdMYS1 gene in improving the hydrophobicity of the peel, wherein the nucleotide sequence of the MdMYS1 gene is shown in SEQ ID NO.1.

[0032] The present invention also provides an application of the apple MdMYS1 gene in improving the drought resistance and / or disease and pest resistance of plants. The apple MdMYS1 gene improves the drought resistance and / or disease and pest resistance of the plant by increasing the wax content of the fruit and / or leaves. The nucleotide sequence of the MdMYS1 gene is shown in SEQ ID NO.1.

[0033] The present invention discloses the following technical effects:

[0034] This invention helps to deeply analyze the molecular regulatory network of apple wax synthesis, providing new theoretical support and key gene resources for genetic engineering strategies to improve apple quality. Through apple transient injection experiments, wax component determination, and gene expression analysis, it was shown that overexpression of the MdMYS1 gene significantly increases the wax content on the apple fruit surface, while silencing the MdMYS1 gene leads to a significant decrease in the wax content. This further verifies the crucial role of the MdMYS1 gene in apple wax synthesis.

[0035] Analysis of the appearance, wax content, gene expression, and leaf permeability of transgenic apple plants showed that overexpression of the MdMYS1 gene significantly increased wax deposition in leaves and significantly reduced permeability, while interference with the MdMYS1 gene resulted in a significant reduction in wax deposition and disruption of permeability. This invention provides a new possibility for improving the drought and pest resistance of apple plants through genetic engineering.

[0036] Analysis of the transgenic tomato plants, including appearance observation, wax content measurement, and gene expression, showed that overexpression of the MdMYS1 gene significantly increased the wax content on the surface of tomato fruits. This invention provides a new possibility for improving the drought resistance and pest and disease resistance of tomato plants through genetic engineering.

[0037] From the perspective of practical benefits in agricultural production, the application of the MdMYS1 gene of this invention can effectively reduce yield losses caused by problems such as post-harvest water loss, disease infection, and premature leaf senescence, reduce the cost input of irrigation and plant protection in orchard management, and significantly improve the economic and ecological benefits of apple planting. Attached Figure Description

[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0039] Figure 1 The map shows the changes in MdMYS1 gene expression and the subcellular localization of MdMYS1 gene expression during fruit development; where A represents the changes in MdMYS1 gene expression during the development of rusted / rust-free fruits; and B represents the subcellular localization of MdMYS1 gene expression. The scale bar is 50 µm.

[0040] Figure 2 Figure 1 shows the phenotypic, wax composition, and gene expression analysis results of apple fruits infected with MdMYS1 gene overexpression and silencing vectors. A represents the phenotype of apple fruits with MdMYS1 overexpression and silencing and those of the control group (scale bar = 1 cm); B represents the wax content in the peel of apple fruits with MdMYS1 overexpression and silencing and those of the control group; C represents the content of common wax components in the three groups; D represents the fatty acid content; E represents the alkane content; F represents the fatty aldehyde content; G represents the expression level of wax biosynthesis-related genes in apple fruits with MdMYS1 overexpression and silencing and those of the control group; EV-OE: empty vector pRI101 group; EV-VIGS: empty vector pTRV2 group; MYS1-OE: MdMYS1-pRI101 group; MYS1-VIGS: MdMYS1-pTRV2 group.

[0041] Figure 3Figure 1 shows the phenotype and wax composition of apple 'GL-3' tissue culture seedlings after transformation with leaf discs overexpressing and interfering vectors of MdMYS1 gene. A represents the leaf phenotype of WT and apple lines overexpressing and interfering with MdMYS1; B represents the leaf wax content of WT and apple lines overexpressing and interfering with MdMYS1; C represents the content of major wax components; D represents the alkane content; E represents the fatty acid content; and F represents the lipid content. WT: Wild-type apple 'GL-3'; OE-5: Overexpressing apple line-5; OE-6: Overexpressing apple line-6; RNAi-3: Interfering MdMYS1 apple line-3; RNAi-4: Interfering MdMYS1 apple line-4.

[0042] Figure 4 Figure 1 shows the results of related index measurements after transformation of apple 'GL-3' tissue culture seedlings with MdMYS1 gene overexpression and interference vector leaf discs. A represents the results of leaf dripping experiments on WT and apple lines overexpressing and interfering with MdMYS1; B represents the results of toluidine blue staining on leaves of WT and apple lines overexpressing and interfering with MdMYS1; C represents the results of chlorophyll leaching experiments on leaves of WT and apple lines overexpressing and interfering with MdMYS1; D represents the expression levels of wax synthesis-related genes in WT and apple lines overexpressing and interfering with MdMYS1. WT: Wild-type apple 'GL-3'; OE-5: Overexpressing apple line-5; OE-6: Overexpressing apple line-6; RNAi-3: Interfering MdMYS1 apple line-3; RNAi-4: Interfering MdMYS1 apple line-4.

[0043] Figure 5 Figure 1 shows the phenotype, wax composition, and related index measurements of tomato fruits overexpressing the MdMYS1 gene. A represents the fruit phenotype of WT and MdMYS1 overexpressing tomato lines; B represents the wax content of fruits from WT and MdMYS1 overexpressing tomato lines; C represents the content of major wax components; D represents the fatty acid content; E represents the alkane content; F represents the expression level of wax synthesis-related genes in fruits from WT and MdMYS1 overexpressing tomato lines; G represents the results of the water droplet experiment on fruits from WT and MdMYS1 overexpressing tomato lines. WT: Wild-type tomato 'Micro-Tom'; OE-2: MdMYS1 overexpressing tomato line-2; OE-6: MdMYS1 overexpressing tomato line-6. Detailed Implementation

[0044] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0045] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0046] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0047] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0048] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0049] Current reports on the MYS1 gene mainly focus on its role in Arabidopsis wax accumulation, with no reports on its regulation of apple wax. Therefore, identifying and functionally studying the apple MYS1 gene is of great significance.

[0050] This invention involved in-depth research, and transcriptome sequencing results of fruits from 'Fuji' × 'Golden Delicious' hybrid F1 lines with and without rust were used to identify a significantly differentially expressed transcription factor, MdMYS1. During fruit development, the expression level of the MdMYS1 gene was higher in the rust-free line than in the rust-free line. The full-length cDNA is 1188 bp, and its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing.

[0051] SEQ ID NO.1:

[0052]

[0053] To investigate the function of the MdMYS1 gene, this invention constructed overexpression vectors, silencing vectors, and interference vectors for the MdMYS1 gene. The method for constructing the gene overexpression vector is as follows:

[0054] Forward and reverse primers for the MdMYS1 gene were designed. The gene sequence was then cloned from the cDNA of rust-free fruit. The sequence was constructed into the plant overexpression vector pRI101 using Sal I and BamHI double restriction sites, forming the fusion plasmid MdMYS1-pRI101. This fusion plasmid was then transformed into Agrobacterium tumefaciens GV3101 using a freeze-thaw method. The primer sequences are as follows:

[0055] MdMYS1(Sal I)-F:

[0056] TGATACATATGCCCGTCGACATGGATGAGCTAGAATTTGGTTAT (SEQ ID NO. 2);

[0057] MdMYS1(BamH I)-R:GCTCACCATGGATCCTTAAAGAGAAAGAGAAAGCTTAGTGC

[0058] CCCTTGCTCACCATGGATCCAAGAGAAAGAGAAAGCTTAGTGCTAA (SEQ ID NO. 3).

[0059] The amplification steps are as follows:

[0060] PCR reaction system:

[0061]

[0062] PCR reaction procedure:

[0063]

[0064] The gene silencing vector was constructed as follows:

[0065] A 400 bp fragment of the non-conserved cDNA region of this gene was selected as the specific fragment, and its sequence is shown in SEQ ID NO.4.

[0066] SEQ ID NO.4:

[0067] TGGAAGGGATTACATATCTTGCATGGTGCACCAAACAACCAACCAGCCTCGTCGACATGTATACTTTAGAATGGACAACGGTGGCATCGTTGTAGCAACAAATCCACACGACTGTCATAGCCAATCACAGCCAGATTTTAAAGCTAGCTCAAGGTCAAGTTCTCTACTAAACAAAGAACTCGCAAAAGGCAACAACTCGA ACAAATCTATAGATACAATCTTGCAAACTTTACCGATAAACCCTAGCAAGTTTCTTGAGGAAAGGCCTCCATTTGAAACGATTAACAAACAACAATGGAGGGCTAAAAGAAGACCAGCTGCCAAAATCAATTGGTCAGATAATCGTCATGGCTCCCAATCTGACCATCTAATGCATCATATGCACACCACACCAAGGTTG.

[0068] Then, using the Xho I and BamHI double restriction sites, the specific fragment was constructed into the viral silencing vector pTRV2, completing the pTRV2-MdMYS1 recombinant plasmid, which was then transformed into Agrobacterium tumefaciens GV3101 via freeze-thaw transformation. The primer sequences are as follows:

[0069] pTRV2-MdMYS1(BamH I)-F:

[0070] GGATCC CAACCTTGGTGTGGTGT(SEQ ID NO.5);

[0071] pTRV2-MdMYS1(Xho I)-R:

[0072] CTCGAG TGGAAGGGATTACATATCTTGC (SEQ ID NO. 6).

[0073] The interference vector was constructed as follows:

[0074] A 400 bp fragment of the non-conserved cDNA region of this gene was selected as the specific fragment, the sequence of which is shown in SEQ ID NO.4. Then, using the Spe I and BamHI double restriction sites and the Asc I and Swa I double restriction sites, SEQ ID NO.4 was constructed into the interference vector pFGC1008, completing the construction of the pFGC1008-MdMYS1 recombinant plasmid. This plasmid was then transformed into *Agrobacterium tumefaciens* LBA4404 using the freeze-thaw method. The primer sequences are as follows:

[0075] MdMYS1-RNAi-Asc I -F: GGCGCGCCTGGAAGGGATTACATATCTTGC (SEQ ID NO. 7);

[0076] MdMYS1-RNAi-Swa I -R: ATTTAAATCAACCTTGGTGTGGGTGTGCA (SEQ ID NO. 8).

[0077] MdMYS1-RNAi-Spe I-F:ACTAGTTGGAAGGGATTACATATCTTGC (SEQ ID NO. 9);

[0078] MdMYS1-RNAi-BamHI-R:GGATCCCAACCTTGGTGTGGGTGTGCA (SEQ ID NO. 10).

[0079] The amplification steps are as follows:

[0080] PCR reaction system:

[0081]

[0082] PCR reaction procedure:

[0083]

[0084] Through apple transient injection experiments, genetic transformation of apple tissue culture seedlings, genetic transformation of tomatoes, wax component analysis, physiological data measurement, and gene expression analysis, it was shown that overexpression of the MdMYS1 gene can improve fruit quality and enhance leaf stress resistance by promoting wax biosynthesis; while silencing the MdMYS1 gene reduces wax content and impairs leaf permeability. This indicates that the MdMYS1 gene plays a significant role in regulating apple wax content.

[0085] Example 1: Cloning of the full-length and specific fragments of the apple MdMYS1 gene

[0086] 1. RNA extraction and reverse transcription from rust-free apple fruits

[0087] 1.1 Extraction of total RNA from plants

[0088] The total RNA content of apple fruit samples was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing). The specific steps are as follows:

[0089] 1) Homogenization treatment. Grind 50-100 mg of plant leaves or fruit pulp into powder rapidly in liquid nitrogen, add 500 μL of lysis buffer SL (please check whether β-mercaptoethanol has been added before use), and immediately vortex vigorously to mix.

[0090] 2) Centrifuge at 12000 rpm for 2 min.

[0091] 3) Transfer the supernatant to the CS filter column in the collection tube, centrifuge at 12000 rpm for 2 min, and carefully aspirate the supernatant from the collection tube into a new RNase-free centrifuge tube, avoiding contact between the pipette tip and cell debris in the collection tube as much as possible.

[0092] 4) Slowly add 0.4 times the volume of supernatant in anhydrous ethanol, mix well, and transfer the resulting solution and precipitate into the adsorption column CR3. Centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0093] 5) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0094] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube. Add 70 μL of RDD buffer and mix gently.

[0095] 7) Add 80 μL of DNase I working solution to the center of the adsorption column CR3 and let it stand at room temperature for 15 min.

[0096] 8) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0097] 9) Add 500 μL of washing solution RW to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0098] 10) Repeat step 9).

[0099] 11) Centrifuge at 12000 rpm for 2 min, place the adsorption column CR3 into a new RNase-Free centrifuge tube, add 30-50 μL of RNase-Free ddH2O dropwise to the middle of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 1 min to obtain the RNA solution.

[0100] The RNA was stored at -80°C. Before storage, the integrity of the RNA was detected by agarose gel electrophoresis and the concentration of the RNA was determined on an Agilent 2100 bioanalyzer (Santa Clara, California, USA).

[0101] 1.2 RNA reverse transcription into cDNA

[0102] The samples were reverse transcribed using the HiScript II Q RT SuperMix for qPCR kit (Vazyme, Nanjing). The specific steps are as follows:

[0103] 1) Genomic DNA removal

[0104] Prepare the following mixture in an RNase-free centrifuge tube: 4 × g DNA wiper mix 4 μL, template RNA 1 pg-1 μg, and RNase-free ddH2O to a final volume of 16 μL; gently mix by pipetting. Incubate at 42°C for 2 min.

[0105] 2) Preparation of reverse transcription reaction system

[0106] Add the following reagents to the reaction tube in step 1: 4 μL of 5 × HiScript II qRT SuperMix II and 16 μL of the reaction solution from step 1. Gently mix by pipetting.

[0107] 3) Perform reverse transcription: 50℃ for 15 min, 85℃ for 5 s. Obtain the reverse transcription product. The product can be used immediately for qPCR, or stored at -20℃ and used within six months; for long-term storage, it is recommended to aliquot and store at -70℃. Avoid repeated freeze-thaw cycles on cDNA.

[0108] 2. Cloning of the full-length MdMYS1 gene

[0109] Using the cDNA from "1.2 RNA Reverse Transcription to cDNA" as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme. The upstream and downstream primers for MdMYS1 are as follows:

[0110] MdMYS1-F: CATATGCCCGTCGACATGGATGAGCTAGAATTTGGTTAT (SEQ ID NO. 11);

[0111] MdMYS1-R: GCTACCATGGATCCTTAAAGAGAAAGAGAAAGCTTAGTGC (SEQ ID NO. 12).

[0112] The amplification steps are as follows:

[0113] 1) PCR reaction system

[0114] Upstream primer (10 μM) 2.5 μL, downstream primer (10 μM) 2.5 μL, 2 × Phanta Max Buffer 25 μL, template DNA x μL, ddH2O to bring the total to 50 μL.

[0115] The template usage includes: 50-400 ng genomic DNA, 10 pg-30 ng plasmid or viral DNA, and 1-5 μL cDNA (not exceeding 1 / 10 of the total PCR reaction volume).

[0116] 2) PCR reaction program: 95℃ pre-denaturation for 3 min; cycling parameters: 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 70 s, for 35 cycles; 72℃ extension for 5 min.

[0117] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD18-T, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the JGI database (https: / / phytozome-next.jgi.doe.gov) by BLAST, and the cloned sequence was consistent with the MD10G1278800 sequence.

[0118] 3. Cloning of a specific fragment of the MdMYS1 gene

[0119] Using the cDNA from “1.2 RNA reverse transcription to cDNA” as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme.

[0120] The amplification steps and PCR reaction procedure are the same as in "2. Cloning of the full length of the MdMYS1 gene".

[0121] After the PCR reaction, the PCR product was recovered, ligated into the cloning vector pMD18-T, transformed into Escherichia coli DH5α, plated onto LB solid medium containing 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Plasmids were extracted from the correctly sequenced single colonies to determine the specific fragment sequence of the MdMYS1 gene.

[0122] Example 2: Changes in MdMYS1 gene expression during development

[0123] 1) Sample the pericarps of rust-free and rust-free apples at different developmental stages and fix them rapidly in liquid nitrogen. Extract total RNA from the pulp of the above-mentioned apples at different developmental stages and reverse transcribe it into cDNA, using the same method as in "1. RNA extraction and reverse transcription of rust-free apple fruits" in Example 1.

[0124] 2) Design specific primers for the non-conserved region of MdMYS1, as well as apple internal reference primers MdActin-F and MdActin-R. The sequences are as follows:

[0125] MdMYS1-qRT-F: CTTGGAGAGAGCAGAAACG (SEQ ID NO. 13);

[0126] MdMYS1-qRT-R: CTCAAACCTAAATGGCGAC (SEQ ID NO. 14);

[0127] MdActin-F: TGACCGAATGAGCAAGGAAATTACT (SEQ ID NO. 15);

[0128] MdActin-R: TACTCAGCTTTTGGCAATCCACATC (SEQ ID NO. 16);

[0129] 3) Using the cDNA obtained in step 2) as templates, adjust these cDNA templates with apple internal reference primers MdActin-F and MdActin-R to make the concentration of each cDNA template consistent.

[0130] 4) Use cDNA templates of consistent concentration to perform qRT-PCR to detect the expression level of the MdMYS1 gene.

[0131] qRT-PCR reaction system:

[0132]

[0133] qRT-PCR reaction procedure:

[0134]

[0135] The results showed that the expression level of the MdMYS1 gene was significantly higher in rust-free fruits at 60, 90, and 120 days than in fully rusted fruits. This may positively regulate fruit wax synthesis. Figure 1 Therefore, further research on the MdMYS1 gene is needed in the future.

[0136] Example 3 Construction of MdMYS1 gene-related vector

[0137] The full-length cDNA sequence of the MdMYS1 gene obtained in Example 1, “2. Cloning of the full-length MdMYS1 gene”, was amplified using primer sequences SEQ ID NO.2 and SEQ ID NO.3, which contain Sal I and BamHI restriction sites, respectively. Following the gene cloning method in Example 1, “2. Cloning of the full-length MdMYS1 gene”, the sequence was ligated into the cloning vector pMD18-T to obtain the fusion plasmid MdMYS1-pMD18-T(Sal I, BamHI).

[0138] Then, the empty vector pRI101 and MdMYS1-pMD18-T (Sal I, BamHI) were digested with restriction endonucleases Sal I and BamHI, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pRI101 vector and the target gene MdMYS1 fragment were ligated and transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdMYS1-pRI101 was extracted.

[0139] The cDNA-specific fragment of the MdMYS1 gene obtained in Example 1, "3. Cloning of the MdMYS1 gene-specific fragment," was amplified using primer sequences SEQ ID NO. 9 and SEQ ID NO. 10, which respectively contain Spe I and BamHI restriction sites. Following the gene cloning method in Example 1, "2. Cloning of the full-length MdMYS1 gene," the fragment was ligated into the cloning vector pMD18-T to obtain the fusion plasmid pMD18-T(Spe I, BamHI). Amplification was then performed using primer sequences SEQ ID NO. 7 and SEQ ID NO. 8, which respectively contain Asc I and SwaI restriction sites. Following the gene cloning method in Example 1, "2. Cloning of the full-length MdMYS1 gene," the fragment was ligated into the cloning vector pMD18-T to obtain the fusion plasmid pMD18-T(Asc I, SwaI).

[0140] Then, the empty vector pFGC1008 and the lower-MdMYS1-pMD18-T (Spe I, BamHI) were digested with restriction endonucleases Spe I and BamHI, respectively. After agarose gel electrophoresis, gel recovery, and ligation of the linear pFGC1008 vector and the target gene MdMYS1 fragment with T4-DNA ligase, the vector was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid lower-MdMYS1-pFGC1008 was extracted.

[0141] Next, the lower-MdMYS1-pFGC1008 and upper-MdMYS1-pMD18-T (Asc I, Swa I) were digested with restriction endonucleases Asc I and Swa I, respectively. Agarose gel electrophoresis was performed, the gel was recovered, and the linear pFGC1008 vector and the target gene MdMYS1 fragment were ligated with T4-DNA ligase. The resulting fragment was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdMYS1-pFGC1008 was extracted.

[0142] Similarly, the cDNA-specific fragment of the MdMYS1 gene obtained in Example 1, “3. Cloning of the MdMYS1 gene-specific fragment”, was amplified using primer sequences SEQ ID NO.5 and SEQ ID NO.6, which respectively contain BamHI and XhoI restriction sites. Following the gene cloning method in Example 1, “2. Cloning of the full-length MdMYS1 gene”, the fragment was ligated into the cloning vector pMD18-T to obtain the fusion plasmid MdMYS1-VIGS-pMD18-T (BamHI, XhoI). Then, the empty vector pTRV2 and MdMYS1-VIGS-pMD18-T (BamHI, XhoI) were digested with restriction endonucleases BamHI and XhoI, respectively. After agarose gel electrophoresis, gel recovery, and T4-DNA ligase, the linear pTRV2 vector and the target gene MdMYS1 specific fragment were ligated. The resulting fragment was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid MdMYS1-pTRV2 was extracted.

[0143] The two recombinant plasmids, MdMYS1-pRI101 and MdMYS1-pTRV2, were transformed into Agrobacterium GV3101 using the freeze-thaw method. The recombinant plasmid MdMYS1-pFGC1008 was transformed into Agrobacterium LBA4404 using electroporation.

[0144] Example 4: Transient transformation of apple fruit using the MdMYS1 gene

[0145] 1. Injection of an overexpression vector containing the MdMYS1 gene

[0146] 1) The MdMYS1-pRI101 vector bacterial culture containing the target gene fragment, which has been shaken until golden yellow, is centrifuged at 20℃, 5000 rpm for 10 min, and the supernatant is discarded.

[0147] 2) Resuspend the bacterial cells with ddH2O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0148] 3) Resuspend the bacterial cells in 10mM MgCl2, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0149] 4) 10 mM MgCl2 suspension of bacterial cells, adjusting OD 600nm =0.6-0.8.

[0150] 5) Add 10 mM MES and 150 mM acetylsuccinone (AS).

[0151] 6) After letting the mixture stand in the dark for 2-3 hours, inject the apple and observe the phenotype after 3-5 days.

[0152] 2. Injection of a silencing vector containing the MdMYS1 gene

[0153] 1) The pTRV2 and pTRV1 helper vector bacterial cultures containing the target gene fragment, which have been shaken until golden yellow, are centrifuged at 5000 rpm for 10 min at room temperature, and the supernatant is discarded.

[0154] 2) Resuspend the bacterial cells with ddH2O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0155] 3) Resuspend the bacterial cells in 10 mM MgCl2, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0156] 4) 10 mM MgCl2 suspension of bacterial cells, adjusting OD 600nm =0.6-0.8.

[0157] 5) Mix the pTRV2 vector and pTRV1 helper vector containing the gene in equal volumes at a ratio of 1:1.

[0158] 6) Add 10 mM MES and 150 mM acetylsuccinone.

[0159] 7) After letting the mixture stand in the dark for 2-3 hours, inject the apple and observe the phenotype after 3-5 days.

[0160] Example 5 Subcellular localization of the MdMYS1 gene

[0161] Similar to the transient overexpression method in fruits described above, the enzyme-digested MdMYS1 fragment was inserted into the pRI101-GFP vector (Sal I / BamHI) to generate the MdMYS1-green fluorescent protein (GFP) fusion protein construct. The resulting construct was transferred to Agrobacterium GV3101 and used to infect healthy tobacco plants. The infected tobacco plants were observed using an EVOS FL AUTO2 (Thermo Fisher Scientific, Massachusetts, USA). The specific steps are as follows:

[0162] 1) Activation of pRI101-GFP-MdMYS1 and pRI101-GFP Agrobacterium strains. Take about 20 μL of bacterial culture into 10 mL centrifuge tubes, add 2 mL of LB liquid medium containing kanamycin and rifampin, and incubate at 28 ℃ in a shaker for 12 h to activate the strains.

[0163] 2) Take 1 mL of the activated bacterial culture and place it in a 100 mL Erlenmeyer flask. Add 30 mL of LB liquid medium containing kanamycin and rifampin. Continue incubation at 28 °C with a shaker until the OD value is reached. 600nm =0.6-0.8.

[0164] 3) Transfer all bacterial cultures to 50 mL centrifuge tubes, centrifuge at 28 ℃ and 5000 rpm for 10 min, and discard the supernatant.

[0165] 4) Add 30 mL of ultrapure water to each centrifuge tube and mix well by pipetting. Centrifuge at 28 ℃ and 5000 rpm for 10 min, then discard the supernatant.

[0166] 5) Add 8 mL of tobacco resuspension to each centrifuge tube and mix well by aspiration.

[0167] 6) Inject the suspension into the reverse side of the tobacco leaves, specifically the third, fourth, and fifth leaves of three tobacco plants.

[0168] 7) Place the tobacco in the dark for 12 hours, then incubate under normal light for 2-3 days.

[0169] 8) The injected leaves were picked, and under an AUTO2 microscope, the leaf epidermis was first immersed in 1 / 2 MS liquid culture medium, then washed in sterile water, and finally the epidermis was spread out and placed on a clean glass slide. A coverslip was then placed on top to remove air bubbles, and the localization of the target protein at the subcellular level was finally observed.

[0170] The results showed that MdMYS1-GFP was localized in the cell nucleus ( Figure 1 (Middle B), with a scale of 50 µm.

[0171] Example 6: Phenotypic and waxy component analysis of transiently transformed apple fruits

[0172] 1. Photograph of apple fruit appearance

[0173] Apples from the four experimental groups were placed in a small photography studio, and photographs were taken with a camera pointed directly at the injection holes. Clear injection holes were observed on the surface of the fruit from all four groups. See the images for pRI101 (labeled EV-OE), MdMYS1-pRI101 (labeled MYS1-OE), pTRV2 (labeled EV-VIGS), and MdMYS1-pTRV2 (labeled MYS1-VIGS) apples. Figure 2 A.

[0174] 2. Wax composition analysis diagram

[0175] 1) Fruit wax extraction: Fruit slices were immersed in chloroform. The combined extracts were concentrated using a rotary evaporator under a nitrogen flow at 55°C, and the wax yield was determined by gravimetric analysis. The wax content was calculated using the following equation:

[0176] Wax content (μg / dm) 2 = Wax weight / area of ​​the peeled sample.

[0177] 2) GC-MS analysis of wax components:

[0178] Wax extraction was performed on the pericarps of the injected samples. The wax content in the pericarps of MdMYS1-pRI101 fruits was significantly increased, while the wax content in the pericarps of MdMYS1-pTRV2 fruits was significantly decreased, with the wax content of MdMYS1-pTRV2 being half that of pTRV2. Figure 2 (B)

[0179] GC-MS analysis revealed that the main wax components, including alkanes, fatty acids, and aliphatic aldehydes, were all detected. Figure 2 In the fruit of MdMYS1-pRI101, six monomeric alkanes were mainly detected, with a significant increase in components with carbon chain lengths of 14, 16, 17, 30, and 32, indicating that even-numbered carbon chains were predominant. The C26 content showed no significant difference compared to the control. Figure 2 (E). Three components, C19, C21, and C36, were detected in the fatty acid monomers, and their contents increased significantly after overexpression of the MdMYS1 gene. Figure 2 (D). A small amount of fatty aldehydes was detected. The contents of C21 and C27 were significantly increased compared with those of pRI101 fruit. Figure 2 (Middle F).

[0180] The total amount of alkanes, fatty acids, and aliphatic aldehydes in MdMYS1-pTRV2 was significantly reduced. Figure 2Further analysis of the changes in the content of each component in the injected sample revealed that among the six monomeric components detected in alkane, the components with carbon chain lengths of 14, 17, 26, 30, and 32 showed a significant decrease, while the component with a carbon chain length of 16 showed a decrease in content, but no significant difference was observed. Figure 2 (E). Three components, C19, C21, and C36, were detected in the fatty acid monomers, and their contents were significantly reduced after silencing the MdMYS1 gene. Figure 2 (D). Fatty acid monomers were detected in components C21 and C27, which were significantly decreased in MdMYS1-pTRV2 ( Figure 2 (Middle F).

[0181] Example 7: Expression levels of genes related to wax in transiently transformed apple fruit

[0182] 1) Apple pulp samples were taken from the four experimental groups and rapidly fixed in liquid nitrogen. Total RNA was extracted from the pulp of the different groups and reverse transcribed into cDNA, using the same method as in "1. RNA extraction and reverse transcription of rust-free apple fruit" in Example 1.

[0183] 2) Specific primer sequences for the MdMYS1 gene are shown in SEQ ID NO.13 and SEQ ID NO.14. Specific primers were designed for the non-conserved regions of the MdCER1, MdCER2, MdCER4, MdKCS1, MdKCS7, MdLACS2, MdDEWAX, and MdSHN3 genes, with the following sequences:

[0184] MdCER1-qRT-F: CTTGGAAGCTTTAAGCATGTGG (SEQ ID NO. 17);

[0185] MdCER1-qRT-R: GGAGGAATGGTGATGTGAGTGG (SEQ ID NO. 18);

[0186] MdCER2-qRT-F: ATCCGGATAACCGAAACGGG (SEQ ID NO. 19);

[0187] MdCER2-qRT-R: AGGCAGAAAACGCATCTCCA (SEQ ID NO. 20);

[0188] MdCER4-qRT-F: CTCTCAATACTTTGGGAGC (SEQ ID NO. 21);

[0189] MdCER4-qRT-R:AGTTTTTCTTGGAGCAGCC (SEQ ID NO. 22);

[0190] MdKCS1-qRT-F: CGTCTCCGTAATAATCCAGCTCA (SEQ ID NO. 23);

[0191] MdKCS1-qRT-R: GAGGCCAAAGAAGAAGAGAAGGA (SEQ ID NO. 24);

[0192] MdKCS7-qRT-F: CCCTAAAAACCAACATCACCAC (SEQ ID NO. 25);

[0193] MdKCS7-qRT-R: AGGCACCTCTACAGGAAACTCA (SEQ ID NO. 26);

[0194] MdLACS2-qRT-F: CTCCCACAAGAAAAAGCAGCACC (SEQ ID NO. 27);

[0195] MdLACS2-qRT-R: CTCTCAGGCAAATCTCTCCACGG (SEQ ID NO. 28);

[0196] MdDEWAX-qRT-F: GATTGTGCTGCATTTAAGC (SEQ ID NO. 29);

[0197] MdDEWAX-qRT-R: TACCGATCTCCTCCTCTCT (SEQ ID NO. 30);

[0198] MdSHN3-qRT-F: TGATGAACGGACAGAATGC (SEQ ID NO. 31);

[0199] MdSHN3-qRT-R:CCCTGAGTAGCTCGGAAAG (SEQ ID NO. 32).

[0200] 3) Using the cDNA obtained in step 1) as templates, adjust these cDNA templates with apple internal reference primers MdActin-F (SEQ ID NO.15) and MdActin-R (SEQ ID NO.16) to make the concentration of each cDNA template consistent.

[0201] 4) Using cDNA templates of consistent concentration, qRT-PCR was performed to detect the expression differences of MdCER1, MdCER2, MdCER4, MdKCS1, MdKCS7, MdLACS2 and MdMYS1 genes in fruits from different experimental groups.

[0202] qRT-PCR reaction system:

[0203]

[0204] qRT-PCR reaction procedure:

[0205]

[0206] The results showed that the expression level of the MdMYS1 gene in MdMYS1-pRI101 fruit was significantly higher than that in the control fruit (empty vector pRI101); and in MdMYS1-pRI101 fruit, the expression levels of all wax-related genes except MdCER4 were significantly upregulated. Compared with the control fruit (empty vector pTRV2), the expression level of the MdMYS1 gene was significantly decreased in MdMYS1-pTRV2 fruit, while the expression levels of wax-related genes were significantly downregulated in MdMYS1-pTRV2 fruit. Figure 2 These results fully demonstrate that the MdMYS1 gene plays a positive regulatory role in fruit wax synthesis, and that the MdMYS1 gene exerts its positive regulatory role in fruit wax by promoting wax biosynthesis.

[0207] Example 8: Phenotypic analysis, wax composition analysis, and expression levels of wax-related genes in apple tissue culture seedlings transformed from leaf discs.

[0208] 1. Photographs of apple tissue culture seedling phenotypes

[0209] Photographs were taken of wild-type 'GL-3' and transgenic apple tissue culture seedlings. Figure 3 (A)

[0210] 2. Wax composition analysis diagram

[0211] The results showed that the total wax content in the leaves of MdMYS1-pRI101 plants was significantly higher than that in the control group ( Figure 3 (B). GC-MS results showed that the main components of the wax in apple 'GL-3' tissue culture seedlings were lipids, fatty acids, and alkanes, with a particularly significant increase in the content of alkanes. Figure 3 (C). Seven monomeric components were screened from alkane compounds, and the carbon chain lengths of 14, 15, 16, 20, 21, 24, and 26 were significantly increased in both MdMYS1-pRI101 lines. Figure 3 (D). Fatty acid monomer components C19 and C21 and lipid monomer components C7 and C27 were significantly increased in OE-5 and OE-6. Figure 3 (E, F).

[0212] The total wax content in the leaves of MdMYS1-pFGC1008 plants was significantly lower than that in the control group. Figure 3(B). GC-MS results showed a significant decrease in the contents of lipids, fatty acids, and alkanes. Figure 3 (C). Seven monomeric components were screened from alkane compounds. The carbon chain lengths of 14, 15, 16, 20, 21, 24, and 26 were all significantly reduced in both MdMYS1-pFGC1008 lines. Figure 3 (D). Fatty acid monomer components C19 and C21 and lipid monomer components C7 and C27 were all significantly reduced ( Figure 3 Chinese E, Figure 3 (Middle F).

[0213] Therefore, this invention hypothesizes that the MdMYS1 transcription factor in apple 'GL-3' not only promotes wax synthesis but also influences the composition of wax components. These components are primarily alkanes, with minor amounts of fatty acids and lipids.

[0214] 3. Expression levels of wax-related genes in transgenic plants

[0215] Expression levels of genes related to the wax synthesis pathway in transgenic apple plants were measured. Compared with their respective controls, the expression levels of wax synthesis genes CER1, SHN3, KCS1, and KCS7 were significantly upregulated in MdMYS1-pRI101 plants, while DEWAX was significantly downregulated. In MdMYS1-RNAi plants, the expression levels of wax synthesis genes CER1, SHN3, KCS1, and KCS7 were significantly downregulated, while DEWAX was significantly upregulated. Figure 4 (D). This invention infers that the MdMYS1 gene may affect the synthesis of waxes in transgenic plants by regulating the expression of these key genes.

[0216] Example 9: Determination of physiological indicators of transgenic plants

[0217] 1) TB staining: Leaves of four-week-old tissue culture seedlings were cut and completely immersed in 0.05% toluidine blue solution for 2 hours. The material was then removed and rinsed 2-3 times with deionized water.

[0218] 2) Chlorophyll extraction: Leaves from 6-week-old tissue culture seedlings were weighed and placed in 30 mL of 80% ethanol at room temperature with slow stirring (in the dark). Extracts were removed from each sample every 10 min, repeated ten times. Absorbance was measured at wavelengths of 664 nm and 647 nm, and the micromolar concentration of total chlorophyll per gram of fresh weight was calculated using the following formula: Total micromolar chlorophyll = 7.93(A664) + 19.53(A647).

[0219] 3) Hydrophobicity test: Lay the leaves of four-week-old tissue culture seedlings flat, add water droplets of the same volume to the surface and measure the angle between the water droplets.

[0220] TB staining assay was used to observe changes in wax permeability. The results showed that, compared with wild-type plants, MdMYS1-pRI101 leaves exhibited lower permeability during staining, while MdMYS1-RNAi leaves exhibited higher permeability during staining. Figure 4 (B) This indicates that MdMYS1 can alter epidermal permeability. Furthermore, through chlorophyll leaching experiments, this invention found that the extraction of chlorophyll from MdMYS1-pRI101 plants was significantly slow, while the extraction of chlorophyll from MdMYS1-RNAi plants was significantly accelerated. Figure 4 (C), which further confirms the change in the permeability of the leaf cuticle. To verify the hydrophobicity of the leaves, water droplets of the same volume were applied to the leaves. Observation revealed that the water droplet contact area on the leaves of MdMYS1-pRI101 plants was smaller, indicating that the leaves of MdMYS1-pRI101 plants have higher hydrophobicity; the water droplet contact area on the leaves of MdMYS1-RNAi plants was larger, indicating that the leaves of MdMYS1-RNAi plants have decreased hydrophobicity (C). Figure 4 (A). These findings provide a new perspective on understanding the role of the MdMYS1 gene in regulating leaf wax layer properties.

[0221] Example 10: Phenotypic analysis, wax composition analysis, expression levels of wax-related genes, and determination of physiological indicators of genetically transformed tomato fruits.

[0222] 1. Photograph of tomato fruit appearance

[0223] Photos of wild-type tomato 'Micro-Tom' and genetically modified tomato fruits ( Figure 5 (A)

[0224] 2. Wax composition analysis diagram

[0225] The results showed that the total wax content in MdMYS1-pRI101 tomato fruits was significantly higher than that in the control group ( Figure 5 (B). GC-MS results showed that the main components of the wax in tomato 'Micro-Tom' were fatty acids and alkanes, with a particularly significant increase in the content of alkane compounds. Figure 5 (C). Eleven monomeric components were screened from alkane compounds, and the carbon chain lengths of 9, 10, 12, 13, 14, 15, 16, 17, 20, 26, and 29 were significantly increased in both MdMYS1-pRI101 tomato lines. Figure 5 In OE-2 and OE-6, the fatty acid monomer components C10, C19, and C21 are significantly increased. Figure 5 (D).

[0226] Therefore, this invention hypothesizes that the MdMYS1 transcription factor in tomato 'Micro-Tom' not only promotes wax synthesis but also influences the composition of wax components. These components are primarily alkanes, with a small amount of fatty acids also present.

[0227] 3. Expression levels of wax-related genes in transgenic tomato fruits

[0228] Specific primers were designed for the non-conserved regions of the SICER3, SIKCS1, SIKCS2, SILACS2, and SILTPG1 genes, as well as the tomato internal reference primers SIActin-F and SIActin-R. The sequences are as follows:

[0229] SICER3-qRT-F: GGACAAATGAAAGAGCACCAGA (SEQ ID NO. 33);

[0230] SICER3-qRT-R: TGGAGAAAGGCACTGAGCTG (SEQ ID NO. 34);

[0231] SIKCS1-qRT-F: CCCTTACTGAGCAATTCAGGTTT (SEQ ID NO. 35);

[0232] SIKCS1-qRT-R:TCCTTGATGGCTCCATATGCC (SEQ ID NO.36);

[0233] SIKCS2-qRT-F: CCAAGCAAATGCTACAGGTTCA (SEQ ID NO. 37);

[0234] SIKCS2-qRT-R: CGCTTTCGATCGGACGATTT (SEQ ID NO. 38);

[0235] SILACS2-qRT-F: ATTCAAGCTGTCCCAAGGGG (SEQ ID NO. 39);

[0236] SILACS2-qRT-R: ACCACAGCCACTAGGAAGGA (SEQ ID NO. 40);

[0237] SILTPG1-qRT-F: TGCGGCGGAAGATATCAAAGA (SEQ ID NO. 41);

[0238] SILTPG1-qRT-R: TGGAGGAATGTTGAGTAGCTTAGG (SEQ ID NO. 42);

[0239] SIActin-F: GTCCTCTCCAGCCATCCAT (SEQ ID NO. 43);

[0240] SIActin-R: ACCACTGAGCACAATGTTACCG (SEQ ID NO. 44).

[0241] qRT-PCR reaction system:

[0242]

[0243] qRT-PCR reaction procedure:

[0244]

[0245] The expression levels of genes related to the wax synthesis pathway in transgenic tomato plants were measured, and it was found that compared with their respective controls, the expression levels of wax synthesis genes CER3, KCS1, KCS2, LACS2, and LTPG1 were significantly upregulated in MdMYS1-pRI101 plants. Figure 5 (F). This invention infers that the MdMYS1 gene may affect the synthesis of waxes in transgenic tomato plants by regulating the expression of these key genes.

[0246] 4. Hydrophobicity test: Add water droplets of the same volume to the surface of the transgenic tomato fruit and measure the angle between the water droplets.

[0247] To verify the hydrophobicity of the transgenic tomato peel, water droplets of the same volume were applied to its peel. Observations revealed that the water droplet contact area on the peel of MdMYS1-pRI101 tomatoes was smaller, indicating that the peel of MdMYS1-pRI101 tomatoes has higher hydrophobicity. Figure 5 (G). This discovery provides a new perspective on understanding the role of the MdMYS1 gene in regulating the properties of the fruit wax layer.

[0248] Based on the aforementioned techniques, a transcription factor, MdMYS1, was isolated from apples. Functional verification through transient injection experiments in apples and in transgenic plants showed that the MdMYS1 gene plays a significant role in promoting wax synthesis in apple fruits. The discovery of the MdMYS1 gene provides a basis for improving apple fruit quality and has important economic and social benefits for enhancing apple quality.

[0249] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A type of apple MdMYS1 The application of genes in any of the following: (1) Regulate the wax content of plant fruits and / or leaves; (2) Cultivating transgenic plants with high wax content in fruits and / or leaves; (3) Prepare products that increase the wax content of plant fruits and / or leaves; The MdMYS1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; Overexpression of apple in plants MdMYS1 Genes that increase the wax content of the fruits and / or leaves of the plant; The plants mentioned are apples and tomatoes.

2. The application as described in claim 1, characterized in that, The overexpression of apple in plants MdMYS1 Genetic methods, including constructing the apple MdMYS1 The steps include: overexpressing a gene using a gene overexpression vector, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

3. A device comprising the apple as described in claim 1 MdMYS1 The application of gene recombinant vectors in any of the following: (1) Regulate the wax content of plant fruits and / or leaves; (2) Cultivating transgenic plants with high wax content in fruits and / or leaves; (3) Prepare products that increase the wax content of plant fruits and / or leaves; Overexpression of apple in plants MdMYS1 Genes that increase the wax content of the fruits and / or leaves of the plant; The plants mentioned are apples and tomatoes.

4. The use of an engineered bacterium comprising the recombinant vector of claim 3 in any of the following: (1) Regulate the wax content of plant fruits and / or leaves; (2) Cultivating transgenic plants with high wax content in fruits and / or leaves; (3) Prepare products that increase the wax content of plant fruits and / or leaves; Overexpression of apple in plants MdMYS1 Genes that increase the wax content of the fruits and / or leaves of the plant; The plants mentioned are apples and tomatoes.

5. A method for increasing the wax content of plant fruits and / or leaves, characterized in that, Including overexpression of apple in plants MdMYS1 The step of using genes to increase the wax content of the fruit and / or leaves of the plant; The MdMYS1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The plants mentioned are apples and tomatoes.

6. The method as described in claim 5, characterized in that, The overexpression of apple in plants MdMYS1 Genetic methods, including constructing the apple MdMYS1 The steps include: overexpressing a gene using a gene overexpression vector, transforming the overexpression vector into Agrobacterium, and then infecting the plant.

7. A breeding method for a transgenic plant with high wax content in its fruit and / or leaves, characterized in that, Includes the following steps: Overexpression of apple in plant cells MdMYS1 Genes are then used to cultivate plant cells, and the plant cells are used to regenerate plants, resulting in transgenic plants with increased wax content in the fruits and / or leaves. The MdMYS1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The plants mentioned are apples and tomatoes.

8. A type of apple MdMYS1 The application of genes in improving the hydrophobicity of fruit peel is characterized by, The MdMYS1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; Overexpression of apple in plants MdMYS1 Genes; the plants described are apples and tomatoes.

Citation Information

Patent Citations

  • Two color-related mutations in apple MdMYB1 gene and detection method thereof

    CN102242186A

  • Fruit color regulation gene MdMYBS1 and application thereof

    CN118240043A