Vingmen green-shell laying hen OASL mutant haplotype gene and application thereof in regulation and control of cell growth

Abstract

The invention discloses an OASL mutant haplotype gene of Jingmen green-shell laying hens and application of the OASL mutant haplotype gene in regulation and control of cell growth, and belongs to the technical field of gene engineering. According to the invention, an OASL mutant haplotype gene is identified in a Jingmen green-shell laying hen group, and the nucleotide sequence of the OASL mutant haplotype gene is shown as SEQ ID NO.4. Compared with a wild type gene, the mutant haplotype gene can remarkably improve the cell activity, improve the cell cycle progress and lower the expression of apoptosis-related factors, and has important significance on enhancing the cell proliferation capacity and inhibiting cell apoptosis. According to the invention, a theoretical basis is provided for research on cell proliferation and apoptosis mechanisms of the Jingmen green-shell laying hens, a technical support is provided for construction of a high-activity cell model, and a new genetic resource is provided for identification of animal growth performance and molecular assisted breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a Jingmen green-shelled laying hen OASL mutant haplotype gene and application thereof in regulating cell growth. BACKGROUND

[0002] Jingmen green-shelled laying hens have the characteristics of compact body size, moderate size and various feather colors, but mainly black or mottled, with the characteristics of "five blacks and one green", namely black feathers, black skin, black meat, black bones and black internal organs, and green eggshells. Genetic improvement and high value-added trait excavation are important directions of current breeding research.

[0003] OASL (2'-5'oligoadenylate synthetase-like) gene is an important member of the interferon-stimulated gene (ISG) family and plays a key role in the body's antiviral innate immune response. The protein expressed by the gene can enhance the activity of RNase L by simulating ubiquitin-like modification, thereby degrading viral RNA and inhibiting viral replication. At present, research on chicken OASL gene is mostly focused on its expression regulation mechanism, and there is less research on natural genetic variations (single nucleotide polymorphisms, SNPs) of OASL gene. In particular, the overall function verification and application of multiple SNP sites as a functional unit (haplotype) are particularly lacking in chicken molecular breeding.

[0004] Therefore, in-depth research on Jingmen green-shelled laying hen OASL gene, excavation of potential SNP sites and research on the role of SNP sites in poultry growth can provide new tools and resources for poultry molecular marker-assisted breeding and biomedical research. SUMMARY

[0005] The purpose of the present application is to provide a Jingmen green-shelled laying hen OASL mutant haplotype gene and application thereof in regulating cell growth, so as to solve the problems existing in the prior art. The present application identifies a OASL mutant haplotype gene in Jingmen green-shelled laying hen population, which can significantly improve cell viability, improve cell cycle progression and down-regulate the expression of apoptosis-related factors. The present application has important significance for enhancing cell proliferation ability and inhibiting cell apoptosis. The present application provides a theoretical basis for the mechanism research of Jingmen green-shelled laying hen cell proliferation and apoptosis, technical support for the construction of high-viability cell model, and new genetic resources for the identification of animal growth performance and molecular-assisted breeding.

[0006] To achieve the above-mentioned purpose, the present application provides the following solutions.

[0007] The present application provides a Jingmen green-shelled laying hen OASL mutant haplotype gene, the nucleotide sequence of which is shown in SEQ ID NO. 4.

[0008] The present application also provides a recombinant vector comprising the OASL mutant haplotype gene.

[0009] The present application also provides a recombinant microorganism comprising the recombinant vector.

[0010] The present application also provides use of the OASL mutant haplotype gene, the recombinant vector or the recombinant microorganism in the preparation of a product for improving cell viability.

[0011] The present application also provides use of the OASL mutant haplotype gene, the recombinant vector or the recombinant microorganism in the preparation of a product for enhancing cell proliferation ability.

[0012] The present application also provides use of the OASL mutant haplotype gene, the recombinant vector or the recombinant microorganism in the preparation of a product for inhibiting cell apoptosis.

[0013] The present application also provides use of the OASL mutant haplotype gene, the recombinant vector or the recombinant microorganism in the preparation of a high-viability cell model.

[0014] Optionally, the cell comprises chicken fibroblasts.

[0015] The present application also provides a method for constructing a high-viability cell model, comprising the step of introducing the OASL mutant haplotype gene into a cell model to enable stable expression thereof, so as to improve the viability of the cell model.

[0016] The cell model comprises chicken fibroblasts used for virus culture, vaccine development and cancer research.

[0017] The present application also provides a product for improving cell viability, wherein the product comprises the OASL mutant haplotype gene, the recombinant vector or the recombinant microorganism.

[0018] The present application discloses the following technical effects:

[0019] The application identifies an OASL mutant haplotype gene in Jingmen green shell egg chicken population. Through recombinant plasmid construction, cell transfection, cell viability detection and cell cycle monitoring experiments, compared with the wild type gene, the mutant haplotype gene can significantly improve cell viability, improve cell cycle progression, down-regulate the expression of apoptosis-related factors, and has important significance for enhancing cell proliferation ability and inhibiting cell apoptosis. The OASL mutant haplotype gene of the application can construct a cell model with higher viability and faster proliferation rate, and provide a more stable, efficient and reliable biological manufacturing and scientific research platform for the preparation of avian vaccine and recombinant protein and the culture of virus, so as to improve yield, quality and reduce cost. The application provides a theoretical basis for the mechanism research of Jingmen green shell egg chicken cell proliferation and apoptosis, provides technical support for the construction of high-activity cell model, and provides new genetic resources for the identification of animal growth performance and molecular assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0021] Figure 1 It is the detection result graph of PCR product of Jingmen green shell egg chicken OASL gene; A is wild type individual, B is mutant individual, wherein lane M is Marker, lanes 1-5 are 5 different individual samples respectively;

[0022] Figure 2 It is the position information graph of the mutation site of Jingmen green shell egg chicken OASL gene;

[0023] Figure 3 It is the double enzyme digestion detection result graph of OASL wild type recombinant plasmid and mutant haplotype recombinant plasmid; wherein A is the detection result of OASL wild type recombinant plasmid; B is the detection result of OASL mutant haplotype recombinant plasmid; lane M is Marker, lane 1 is recombinant plasmid;

[0024] Figure 4 It is the subcellular localization fluorescence graph of OASL wild type and mutant haplotype plasmid transfected DF-1 cells;

[0025] Figure 5 It is the cell viability comparison graph of each group of cells at different time points after plasmid transfection;

[0026] Figure 6 It is the cell cycle distribution flow graph of each group of cells;

[0027] Figure 7 Statistical chart of cell cycle distribution of each group of cells;

[0028] Figure 8 Detection result chart of mRNA relative expression amount of apoptosis-related factors in each group of cells. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of the application and not as limiting the application. It will be readily understood that the various aspects, specific details and embodiments of the present application can be varied, and that the scope of the application is not limited to what is described in this detailed description.

[0030] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. In addition, where a range of values is provided, it is understood that each intervening value, to the extent that it does not adversely affect the end result of the subject matter at hand, between the upper and lower limit of that range is also separately and individually

[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.

[0032] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0033] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0034] The experimental methods in the following examples are all routine methods unless otherwise specified. The instruments and equipment used in the following examples are all routine laboratory instruments and equipment unless otherwise specified; the test materials used in the following examples are all purchased from routine biochemical reagent stores unless otherwise specified.

[0035] Example 1 Discovery and identification of OASL gene haplotype of Jingmen green-shelled laying hens

[0036] Blood samples of 218 chickens from different strains (68 Jingmen green-shelled laying hens, 50 Xiaogan green-shelled laying hens, 50 Wuhan green-shelled laying hens, and 50 Jingzhou Roman light egg laying hens) were collected from the Jingzhou Farm and Ranch in Hubei Province. About 1 mL of blood was collected from the wing vein of each chicken for anticoagulation treatment and then delivered to the company for variation detection. Candidate genes related to antiviral were screened and analyzed.

[0037] Whole genome resequencing was performed on some individuals, and the data were aligned with the chicken reference genome (NCBI accession number: NC_052543.1). Using bioinformatics software, multiple SNP sites were screened in the coding region of the OASL gene, and through linkage disequilibrium analysis, a haplotype block composed of three sites g.727C>T, g.1358A>G, and g.1754G>A was determined in the Jingmen green-shelled laying hen population.

[0038] Specific primers were designed for the gene region containing the three sites, and PCR amplification was performed. The primer sequences are as follows:

[0039] Forward primer F: 5'-GCAAATGGGCGGTAGGCGTGTAC-3'; SEQ ID NO. 1;

[0040] Reverse primer R: 5'-CAGTGGGAGTGGCACCTTCCAGG-3'; SEQ ID NO. 2.

[0041] The reaction system was as follows: 2x Taq Master Mix 15 μL, DNA template 1.5 μL, upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL, and ddH2O 10.5 μL. The reaction program was as follows: 94°C pre-denaturation for 1.5 min; 94°C denaturation for 20 s, 58-60°C annealing for 20 s, 72°C extension for 30 s, 35 cycles; finally, 72°C extension for 5 min, and 4°C storage of the amplification product.

[0042] 5 μL of the PCR product was taken for 1.5% agarose gel electrophoresis detection, and the results showed that a single bright band appeared at about 1455 bp (see Figure 1 ). The band clear PCR product was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for Sanger sequencing. The sequencing map was aligned using SnapGene (see Figure 2 ), the genotype of each individual at the three mutation sites was determined, and the haplotype was divided.

[0043] Example 2 Construction and identification of OASL wild-type and mutant haplotype recombinant plasmids

[0044] The complete CDS region of OASL gene was amplified using high-fidelity enzyme with Jingmen green-shell egg chicken blood cDNA as template. Through overlap extension PCR technology, g.727C, g.1358A, g.1754G in wild type sequence were once site-directed mutated to g.727T, g.1358G, g.1754A, thereby obtaining mutant haplotype sequence.

[0045] The CDS region nucleotide sequence of OASL wild type gene (OASL-WT) (SEQ ID NO. 3) is as follows:

[0046]

[0047] The nucleotide sequence of the CDS region of OASL mutant haplotype gene (OASL-MUT) (SEQ ID NO. 4) is as follows:

[0048] ATGGAGCTGGGCGTGAGGTGGGAGATGGGGTTGGAGAGCGTGAGCTCGCGCCAGCTGGAGGGCTGGGTGGCCGCCCACCTGCAGCCCAGCACGGAATTCAGCACGGCGGTGAAGCAGACGGTGAAGGACATCTGCGACTTCCTCAAGGAGCGCTGCTTCGAAGGCATCAGCGTCCTCAAGACCGTCAAGGGCGGCTCGGCGGGGAAGGGCACGGCGCTGCGCAACAACTCGGATGCCGACGTGGTGCTCTTCATCAACTGCTTCTCCAGCTACCAGGAGCAGGAGGCGCGGCGGGGCCACATCCTCGCCATCATCGAGAGGCGGCTCAACGAGTGCCTCCCGACGCTGTCCTTCGGAGTCAGCATCACCAGTCCGCGCTACAAGGACAGCCGGGACAGACCGCGCTCCCTCAGCCTCACCCTCTCCTCCAGCGCCTCCAGAGAGTCCATCGACGTCGACATCCTGCCTGCTTACGACGCACTGGGGCAGGTGATTCAGGATGCCCGCCCGGACCCCGCGGTCTACGTGAAGCTGTTGGCCACGC ACTGCGGCCCCGGCGATTTCTCCCCCAGCTTCACAGAACTGCAGAAGAACTTTGTGAAGTGGCGCCCTGCTAAGCTGAAAGACCTGCTGCGCCTGGTCAAGCACTGGTACAAGGAGATGTTGAAGCCGAAGTACCCCAACGCTAAGCTGCCCCCCAAGTATGCACTGGAGCTGCTGACCATCTACGCCTGGGAGGAGGGCACAGGCAGGGAGGACTTCAGCATGGCTGAAGGCTTCTGCACTGTGCTGGAGCTGCTTGGCCAGTACCGGGACATCTGTATTTACTGGGAGAAGTACTATTCCCTGGAGGATGAGTGGGTCGGTGCCTACCTGAAGGAGCAGCTGCGCCAGCCCCGCCCCGTCATCCTGGATCCCGCCGACCCCACCGGCATCCTGGGCCAAGGCAAGAACTGGGACTTGGTGGCCAAGGAGGCTGCCGAGAGCCGTGTGTCACTGCCCTGCGTCAGCGATGTC C GCTCCTGGGACGTGCAGCCCACCCGACCTGTGAAGGTGCAAGTGAAGCAGCTGCAGGGCATGAGCCTGACCAGGAAGGTCCACCCCAGCACCACAGTCTGGGAGCTGAAGGGGGAGATAGAGAAGGAGTGGTGCATCCCCCGCTACCAGCAGCGCCTGTGCACCGAGCCCCAGGAGATGGAGGTCCTGGTGAAGGACAGTAACAAGACCACAGTCTACACCGTA T GGCCCACGGACACTGTGAAGCAGCTGAAGCAGCAGATCTATGCCCGCCAGCACGTGCCCGTGGAGCAGCAGCGCCTGACCTACGAGACCAAGGAGCTGGAGAACCACCACACGCTGGAGCACTACCACGTGCAGCCCCGCAGCACCATCTACCTCCTGCTGAGGCTGCGGGGTGGCGCGGGGCCGCTGCCCAGACGCTGCGTGCCCTCCTGA (The bold and underlined positions are the mutation sites).

[0049] The purified wild-type and mutant PCR products of OASL were ligated into the His vector. The recovered target gene fragment and vector plasmid were digested with restriction endonucleases NheI and ApaI. The target gene was then cloned into the pcDNA3.1(+) eukaryotic expression vector to construct the recombinant plasmids pcDNA3.1-OASL-WT and pcDNA3.1-OASL-MUT. The ligation products were temporarily stored at -20℃.

[0050] Perform plasmid cloning and transformation according to the following steps:

[0051] (a) Remove DH5α competent cells and thaw them on ice. Use a pipette to transfer 50 μL of the thawed cells into a 200 μL PCR tube. Take 20 μL of recombinant plasmids pcDNA3.1-OASL-WT and pcDNA3.1-OASL-MUT and place them into the PCR tube containing the competent cells. Gently pipette to mix and incubate on ice for 30 min.

[0052] (b) The competent cells were placed in a 42°C constant temperature water bath for 45 s for heat shock. Afterwards, the competent cells were quickly placed in an ice bath to complete the transformation process.

[0053] (c) Add 300-500 μL of ampicillin-free LB liquid medium to competent cells and revive the bacterial culture for 1-2 h at 37°C on a constant temperature shaker at 200 rpm.

[0054] (d) Centrifuge the cultured sample at 5000 rpm for 3 min at room temperature to allow the cells to settle at the bottom of the centrifuge tube. Remove excess culture medium and gently pipette to mix the remaining culture medium with the cells. Spread the mixture onto an LB agar plate containing ampicillin. Invert the plate and incubate at 37°C for 16 h until a complete single colony appears on the plate.

[0055] After selecting single colonies for expansion culture, plasmids were extracted and subjected to double enzyme digestion for identification. The results showed that after double enzyme digestion, the plasmids released both the vector band and the target gene band (see...). Figure 3 Subsequently, sequencing verification was performed, and the plasmids pcDNA3.1-OASL-WT and pcDNA3.1-OASL-MUT, which were confirmed to be correct by sequencing, were harvested.

[0056] Example 3: Effects of OASL wild-type gene and mutant haplotype gene on cell growth

[0057] 1. Cell transfection and subcellular localization

[0058] Chicken embryo fibroblasts (DF-1) were cultured in 6-well plates and placed in cell crawling slides. When the cell density reached 70%-80%, pcDNA3.1-OASL-WT, pcDNA3.1-OASL-MUT, and the empty vector pcDNA3.1(+) were transfected using Lipofectamine 3000 to obtain wild-type cells (WT-OASL-pc), mutant cells (MUT-OASL-pc), and control cells (pcDNA3.1). Immunofluorescence was performed 24 h after transfection, and the cells were observed under a fluorescence microscope. The results showed that both wild-type and mutant OASL proteins were uniformly distributed in the cytoplasm, indicating that the mutation did not alter its normal subcellular localization (see...). Figure 4 ).

[0059] 2. Cell viability assay

[0060] DF-1 cells were seeded in 96-well plates and transfected with the three plasmids mentioned above, with a blank control group (no plasmid transfection) included. At 24 h, 48 h, and 72 h post-transfection, CCK-8 reagent was added to each well, and after 2 h of incubation, the absorbance (OD value) at 450 nm was measured using a microplate reader. The results showed that at 48 h and 72 h, the OD values ​​of the mutant cells were significantly higher than those of the wild-type cells and the control group (P < 0.05), indicating that this OASL mutant haplotype has the effect of enhancing cell viability (see...). Figure 5 ).

[0061] 3. Cell cycle analysis

[0062] Cells were collected 48 h after plasmid transfection, fixed with pre-cooled 70% ethanol, stained with PI, and analyzed for cell cycle distribution by flow cytometry. The results showed that, compared with wild-type and control cells, the proportion of mutant cells in G1 phase was significantly reduced, while the proportion of cells in S phase was increased (see [link to data]). Figure 6 and Figure 7 This cell cycle distribution characteristic indicates that the OASL mutant haplotype can effectively promote the transition of cells from G1 phase to S phase, alleviate G1 / S phase arrest induced by exogenous transfection stress, and thus promote cell proliferation.

[0063] 4. Analysis of Apoptosis-Related Factor Expression

[0064] Forty-eight hours after plasmid transfection, total RNA was extracted from cells and reverse transcribed into cDNA. The mRNA expression levels of apoptosis-related genes Caspase-3 and Bax / Bcl-2 were detected using SYBR Green qPCR. The results showed that compared with wild-type cells, Bcl-2 was significantly increased in mutant cells (P < 0.05), while Caspase-3 and Bax were significantly downregulated (P < 0.05), indicating that this haplotype has an inhibitory effect on apoptosis (see [link to relevant documentation]). Figure 8 ).

[0065] In summary, this invention identified an OASL mutant haplotype gene in the Jingmen green-shelled chicken population and verified the function of this mutant haplotype in regulating cell proliferation and apoptosis using DF-1 cells as the experimental subject. DF-1 cells are a passageable chicken fibroblast cell line widely used in animal virus research, vaccine development, and cancer research, serving as an important biomaterial for virus transfection and culture. Enhancing the growth performance of DF-1 cells and reducing their apoptosis factor expression helps create a more stable, efficient, and reliable biomanufacturing and research platform. In the production of poultry vaccines and recombinant proteins, highly viable cells are beneficial for increasing yield and quality while reducing costs, improving cell survival and stability under stress conditions such as passage, transfection, and viral infection, extending the production window, and ensuring smooth experiments. Therefore, this invention not only provides theoretical support for studying cell proliferation and apoptosis mechanisms but also provides technical support for constructing high-viability cell models and offers new genetic resources for identifying animal growth performance and molecular-assisted breeding.

[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A mutant haplotype gene for OASL in Jingmen green-shelled egg-laying chickens, characterized in that, The nucleotide sequence of the OASL mutant haplotype gene is shown in SEQ ID NO.

4.

2. A recombinant vector comprising the OASL mutant haplotype gene of claim 1.

3. A recombinant microorganism comprising the recombinant vector of claim 2.

4. The use of the OASL mutant haplotype gene of claim 1, the recombinant vector of claim 2, or the recombinant microorganism of claim 3 in the preparation of products that enhance cell viability.

5. The use of the OASL mutant haplotype gene of claim 1, the recombinant vector of claim 2, or the recombinant microorganism of claim 3 in the preparation of products that enhance cell proliferation.

6. The use of the OASL mutant haplotype gene of claim 1, the recombinant vector of claim 2, or the recombinant microorganism of claim 3 in the preparation of products that inhibit apoptosis.

7. The application of the OASL mutant haplotype gene of claim 1, the recombinant vector of claim 2, or the recombinant microorganism of claim 3 in the preparation of a high-viability cell model.

8. The application according to any one of claims 4-7, characterized in that, The cells include chicken fibroblasts.

9. A method for constructing a high-viability cell model, characterized in that, The method includes the step of transferring the OASL mutant haplotype gene as described in claim 1 into a cell model and stably expressing it to improve the cell model viability; The cell model includes chicken fibroblasts used for virus culture, vaccine development, and cancer research.

10. A product for improving cell vitality, characterized in that, The product contains the OASL mutant haplotype gene of claim 1, the recombinant vector of claim 2, or the recombinant microorganism of claim 3.

Images