Peanut allergen component fluorescent PCR (polymerase chain reaction) detection equivalent kit

Abstract

The invention relates to the technical field of kits, and discloses a peanut allergen component fluorescence PCR (Polymerase Chain Reaction) detection equivalent kit, which comprises (1) 2 * Probe qPCR Mix; (2) a florescence source probe primer mixture; (3) a 18S internal reference probe primer mixture; (4) ultrapure water; (5) positive control; (6) negative control; according to the invention, a dual detection mechanism of a florescence source specific gene and an eukaryote general reference gene is combined, and a specially designed chimeric recombinant plasmid is adopted as a multifunctional positive control, so that when a complex food matrix is treated, a forced standard reaching mechanism of a reference gene channel can timely identify a sample treatment abnormal condition; and wrong interpretation caused by improper operation is avoided. Meanwhile, the activity of core components of the kit can be verified through the two-channel synchronous response characteristic of positive control, and the credibility of a detection result and the scientific preciseness of interpretation are improved.

Description

Technical Field

[0001] This invention relates to the field of reagent kit technology, specifically to an equivalent reagent kit for the fluorescent PCR detection of peanut allergen components. Background Technology

[0002] Peanuts, belonging to the legume family, are rich in nutrients and have a relatively balanced amino acid content. Reports indicate that peanuts contain 45-53% oil and 24-29% protein. In recent years, allergic diseases have received widespread attention, and peanuts are one of the eight major food allergens listed in a report by the Food and Agriculture Organization of the United Nations. They are a significant food allergen, very common in food allergies, accounting for 10%-47% of all food allergy cases. Moreover, peanut allergies are characterized by severe clinical symptoms; even ingesting trace amounts of peanut allergens can trigger strong allergic reactions, making them a major concern in public health and food safety. Furthermore, due to the prevalence and complexity of cross-allergies, peanut allergies exhibit significant cross-reactions with other types of allergies, increasing the probability of developing a peanut allergy. Additionally, peanut allergies do not develop immune tolerance with age, and if left untreated, they can easily lead to other serious diseases.

[0003] Currently, methods for detecting food allergens include antigen detection, nucleic acid detection, and immunological detection. Among these, fluorescent PCR detection has become the main method for food testing due to its advantages such as high sensitivity and good specificity. However, existing fluorescent PCR detection kits for peanut allergen components suffer from low detection accuracy and poor stability.

[0004] Therefore, an equivalent kit for the fluorescent PCR detection of peanut allergen components is proposed to solve the above problems. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides an equivalent kit for the fluorescent PCR detection of peanut allergen components. This kit is equivalent to the detection requirements for peanut components in BJS 202412, thus solving the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution: an equivalent kit for fluorescent PCR detection of peanut allergen components, the kit comprising: (1) 2×Probe qPCR Mix; (2) Peanut-derived probe and primer mixture; (3) 18S internal reference probe primer mixture; (4) Ultrapure water; (5) Positive control; (6) Negative control; The 2×Probe qPCR Mix contains Tris-HCl buffer at pH 8.4, potassium chloride (KCl), and magnesium chloride. The final concentrations were 40 mmol / L, 40 mmol / L and 3 mmol / L, respectively. The peanut-derived probe-primer mixture contains the forward primer shown in SEQ ID NO:1, the reverse primer shown in SEQ ID NO:2, and the probe shown in SEQ ID NO:3, with each primer / probe having a working concentration of 10 μM. The 18S internal reference probe primer mixture contains the forward primer shown in SEQ ID NO:4, the reverse primer shown in SEQ ID NO:5, and the probe shown in SEQ ID NO:6, with each primer / probe having a working concentration of 10 μM. The positive control was a recombinant plasmid pUC57-HS-18S containing the peanut-derived target gene fragment SEQ ID NO:7 and the 18S internal reference gene fragment SEQ ID NO:8, at a concentration of 1×10⁻⁶. 8 Copy / μL.

[0007] Preferably, the 2×Probe qPCR Mix is ​​prepared by diluting 10×PCR buffer, which contains 200 mmol / L Tris-HCl, pH 8.4, 200 mmol / L KCl, and 15 mmol / L... .

[0008] Preferably, the peanut source probe SEQ ID NO:3 is labeled with a FAM fluorescent group at its 5' end and a TAMRA quenching group at its 3' end; the 18S internal reference probe SEQ ID NO:6 is labeled with a FAM fluorescent group at its 5' end and a TAMRA quenching group at its 3' end.

[0009] Preferably, the positive control recombinant plasmid pUC57-HS-18S contains the following chimeric sequence: Peanut-derived target gene fragments: 5'-GATAGGTTGCAGGGGAGGCAACAGGAGCAACAGTTCAAGAGGGAGCTCAGGAACTTGCCTCAACAGTGCGGCCTAGGGCACCACAGCGTTG -3', SEQ ID NO:7; 18S internal reference gene fragment: 5'- TCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATT -3', SEQ ID NO: 8.

[0010] Preferably, the amount of each component added in a 25 μL reaction system is as follows: 2×Probe qPCR Mix: 12.5μL; Peanut-derived probe-primer mixture or 18S internal reference probe-primer mixture: 3 μL; Template DNA: 2 μL; Ultrapure water: Add to 25μL.

[0011] Preferably, the final concentration of primers and the final concentration of probes in the reaction system are both 0.4 μM.

[0012] Preferably, it includes the following steps: Step 1: Serial dilution of standard products Take a positive control, 1×10 8 copies / μL, serially diluted 10-fold to 6 concentration levels, 1×10 7 To a concentration of 1×10² copies / μL, the dilution process was performed using a cartridge pipette tip in a separate area; Step 2: Sample DNA Preparation Food samples were processed using conventional DNA extraction methods, with simultaneous ultrapure water negative and positive controls, 1×10⁻⁶. 5 Copy / μL of standard; Step 3: Construction of the fluorescent PCR reaction system The system consists of two separate peanut source detection systems and an 18S internal reference detection system, each containing: 2×Probe qPCR Mix 12.5μL; 3 μL of the corresponding probe and primer mixture; Template DNA: 2 μL; Make up the ultrapure water to 25 μL; Step 4: Fluorescent PCR Amplification The reaction procedure is as follows: Pre-denaturation: 95℃ for 15 min; Cyclic reaction for 40 cycles: 95℃ for 3 seconds: denaturation, 60℃ for 25 seconds: annealing / extension, FAM channel signal acquired; Step 5: Result Interpretation Negative control: Ct value ≥ 40.0 or no amplification curve; Positive control: Ct value ≤ 35.0 and exhibiting an S-shaped amplification curve; For the sample to be tested: a Ct value of <35.0 for the peanut source channel is considered positive, and a Ct value of ≥40.0 is considered negative. If 35.0 < Ct value ≤40.0, the test needs to be repeated. Internal control quality: A Ct value of <30.0 in the 18S channel is considered a valid test; otherwise, the result is invalid.

[0013] The 18S internal reference channel showed S-shaped amplification curves with Ct values ​​≤ 30.0 in all samples; The negative control showed no amplification, with a Ct value ≥40; The positive control showed Ct values ​​≤35.0 in the peanut source channel and Ct values ​​≤30.0 in the 18S channel.

[0014] Preferably, when performing quantitative detection: A standard curve was constructed with the Ct value of the serially diluted standard on the vertical axis and the copy number logarithm on the horizontal axis. The peanut source copy number of the test sample was obtained through the standard curve equation. = -a×Ct+b is calculated, where a and b are the fitting parameters.

[0015] Preferably, a specific primer-probe combination for detecting peanut allergens comprises: Peanut-derived detection primer and probe set: Forward primer: GATAGGTTGCAGGGGAGGCA, SEQ ID NO:1; Reverse primer: CAACGCTGTGGTGCCCTAAG, SEQ ID NO:2; Probe: FAM-AGGGAGCTCAGGAACTTGCCTCAACAGTGCGGC-TAMRA, SEQ ID NO:3; 18S internal reference detection primer and probe set: Forward primer: 5'-TCTGCCCTATCAACTTTCGATGGTA-3', SEQ ID NO:4; Reverse primer: 5'-AATTTGCGCGCCTGCTGCCTTCCTT-3', SEQ ID NO: 5; Probe: 5'-FAM-CCGTTTCTCAGGCTCCCTCTCCGGAATCGAAC-TAMRA-3', SEQ ID NO: 6.

[0016] Compared with existing technologies, this invention provides an equivalent kit for fluorescent PCR detection of peanut allergen components, which has the following beneficial effects: 1. This invention addresses the false-negative risk problem in traditional detection methods by establishing a dual-target synchronous detection system for peanut allergen detection in food samples. This system combines a peanut-specific gene and a universal eukaryotic internal reference gene for detection, and employs a specially designed chimeric recombinant plasmid as a multifunctional positive control. The system constructs a triple quality control barrier, enabling real-time monitoring of sample DNA extraction quality, reaction inhibitor interference, and amplification system effectiveness. When handling complex food matrices, the mandatory target achievement mechanism of the internal reference gene channel can promptly identify abnormal sample processing conditions, avoiding misinterpretations due to improper operation. Simultaneously, the dual-channel synchronous response characteristics of the positive control verify the activity of the core components of the kit, ensuring the reliability of each batch of tests and improving the credibility and scientific rigor of the test results.

[0017] 2. This invention addresses the technical bottleneck of drastically reduced sensitivity of traditional reagents in oily and complex matrices by optimizing the concentration ratio of key ions in the reaction buffer. This concentration design neutralizes the inhibitory effect of oily substances on enzyme activity, maintaining the continuous stability of the catalytic reaction in complex matrices. When processing samples from food production environments, the optimized buffer system resists interference from processing residues, ensuring ideal amplification efficiency. Maintaining stable amplification kinetics in the presence of oil achieves high consistency in detection results across different food matrices, providing a reliable monitoring method across food safety production chains.

[0018] 3. In interpreting trace allergen components, this invention improves amplification specificity and signal acquisition efficiency by constructing a multi-level quality control mechanism and synergistically optimizing key temperature parameters. This temperature parameter design achieves an optimal balance between probe hydrolysis efficiency and primer binding specificity, completing fluorescence signal release within a limited time. Combined with the DNA unwinding process during the sufficient pre-denaturation stage, it ensures early recognition of weak positive signals. The simultaneously established gradient standard interpretation system, through specific mathematical relationships, avoids interference from non-specific amplification while enhancing the sensitivity of trace component identification.

[0019] 4. The detection results of this invention have a high degree of consistency with standard methods. The target genes and usage parameters are consistent with relevant standards. The test kit results are accurate and reliable, and can be used as an effective detection method for detection or scientific research.

[0020] Experimental data sheet for test kits as specified in national standards:

[0021]

[0022] Table of equivalence analysis between beneficial effects and national standard reagent kits:

[0023] Attached Figure Description

[0024] Figure 1 This is a flowchart illustrating the usage of an equivalent kit for the fluorescent PCR detection of peanut allergen components according to the present invention. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Example 1: Design and Synthesis of Primers and Probes The peanut-derived probe was labeled with a FAM fluorescent group at its 5' end and a TAMRA fluorescent quencher group at its 3' end; the 18S internal control probe was labeled with a FAM fluorescent group at its 5' end and a TAMRA fluorescent quencher group at its 3' end. Primers and probes for the peanut-derived and 18S internal controls were synthesized, and their specific sequences are shown in Table 1.

[0027]

[0028] National standard compliance of primer and probe systems:

[0029] Equivalence to traditional reagent kits:

[0030] Example 2: An equivalent kit for fluorescent PCR detection of peanut allergen components, comprising: (1) 2×Probe qPCR Mix; (2) Peanut-derived detection primer and probe reaction solution; (3) 18S primer and probe reaction solution; (4) Negative control; (5) Positive control.

[0031] The 2×Probe qPCR Mix includes Tris-HCl buffer, pH 8.4, KCl, The concentration of KCl was 40 mM. The concentration is 3 mM.

[0032] The enzyme system for fluorescent PCR reaction includes UNG enzyme and Taq DNA polymerase. The concentration of UNG enzyme is 0.1 U / μl, and the concentration of Taq DNA polymerase is 0.5 U / μl.

[0033] The peanut-derived detection primer and probe reaction solution includes the peanut-derived detection primers and probes from Example 1, totaling three: peanut-F, peanut-R, and peanut-P. The concentrations of peanut-F, peanut-R, and peanut-P in the primer and probe reaction solution are all 10 μM. The 18S primer-probe reaction solution includes the peanut-derived detection primers and probes from Example 1, totaling three: 18S internal reference-F, 18S internal reference-R, and 18S internal reference-P. The concentrations of 18S internal reference-F, 18S internal reference-R, and 18S internal reference-P in the primer-probe reaction solution are all 10 μM.

[0034] The negative control was DEPC water.

[0035] The positive control included the recombinant plasmid pUC57-HS-18S containing fragments of the target gene and the internal reference gene, with a concentration of 1×10⁻⁶. 8 Copies / μL, the sequence of pUC57-HS-18S is as follows: gataggttgcaggggaggcaacaggagcaacagttcaagagggagctcaggaacttgcctcaacagtgcggccttagggcaccacagcgttgTCTGCCCTATCAA CTTTCGATGGTAGGATAGTGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATT is denoted as SEQ ID NO:9.

[0036] The accelerated stability and freeze-thaw stability of the equivalent kit for detecting peanut allergen components by fluorescent PCR obtained in Example 2 were investigated, and the specific implementation was as follows: (1) Acceleration stability Prepare the kit by grouping as follows: ① Add 12.5 μL of 2×Probe qPCR Mix and 3 μL of primer / probe reaction solution (stored at 35℃ for 0 days) to a final volume of 23 μL of reaction solution, then add 2 μL of positive control (diluted to 10 μL). 5 ① Prepare a 25 μL reaction system using 12.5 μL of 2×Probe qPCR Mix and 3 μL of primer / probe reaction solution, which have been stored at 35℃ for 3 days. Add water to make up to 23 μL of reaction solution, then add 2 μL of positive control to prepare a 25 μL reaction system. ② Prepare a 25 μL reaction system using 12.5 μL of 2×Probe qPCR Mix and 3 μL of primer / probe reaction solution, which have been stored at 35℃ for 6 days. Add water to make up to 23 μL of reaction solution, then add 2 μL of positive control to prepare a 25 μL reaction system. ③ Prepare a 25 μL reaction system using 12.5 μL of 2×Probe qPCR Mix and 3 μL of primer / probe reaction solution, which have been stored at 35℃ for 8 days. Add water to make up to 23 μL of reaction solution, then add 2 μL of positive control to prepare a 25 μL reaction system. ④ Prepare a 25 μL reaction system using 12.5 μL of 2×Probe qPCR Mix and 3 μL of primer / probe reaction solution, which have been stored at 35℃ for 8 days. ⑤ Prepare a 25 μL reaction system using 12.5 μL of 2×Probe qPCR Mix and 3 μL of primer / probe reaction solution, which have been stored at 35℃ for 8 days. Mix 3 μL of primer and probe reaction solution, add water to make up to 23 μL of reaction solution, and then add 2 μL of positive control to prepare a 25 μL reaction system. The prepared kit was then tested, and the results are shown in Table 2.

[0037] National standard compliance of reagent kit stability:

[0038] Equivalence to traditional reagent kits:

[0039]

[0040] Example 3: A method for using an equivalent kit for the fluorescent PCR detection of peanut allergen components, comprising the following steps: (1) Sample preparation DNA samples were extracted from food samples such as chocolate, biscuits, and sauces. The extracted DNA samples can be used for testing immediately. If they are not tested immediately after extraction, they can be stored at -20°C for later use. (2) Preparation of reaction solution ① Preparation of the reaction system Place the 2×Probe qPCR Mix and primer / probe reaction solution on ice or at 4°C to thaw and shake well. Prepare the reaction system according to the amount of each component added for a single reaction as shown in Table 3. If the number of samples to be tested is n, including positive and negative controls, prepare the reaction system according to n+1 reactions to prevent sample loss and insufficient reaction system. Add all components together to a centrifuge tube, mix thoroughly, and centrifuge to obtain the PCR reaction solution. Table 3:

[0041] ②System repackaging Aliquot the PCR reaction solution into PCR tubes suitable for the fluorescence PCR instrument, adding 23 μL of PCR reaction solution per tube. ③ Sample testing Add 2 μL of the DNA sample to be tested, 2 μL of the negative control, and 2 μL of the positive control to different aliquoted PCR tubes, so that the reaction volume in each PCR tube is 25 μL. Tightly cap the tubes to obtain the reaction tubes. (3) On-machine testing Place the reaction tube into the fluorescent PCR detector and run the test according to the cycling parameters in Table 4. Table 4:

[0042] Fluorescence detection was performed at 60℃, with the detection channels being FAM: peanut allergen gene and CY5: 18S internal reference gene. (4) Results Analysis: After the reaction is complete, the instrument automatically saves the results. If the negative control shows no curve amplification and the positive control shows curve amplification in both channels, the experiment is valid; otherwise, the results are considered invalid. If the peanut allergen gene channel shows S-type amplification and the Ct value is <35, the reaction is considered positive (+); if there is no Ct value or the Ct value is ≥40, the reaction is considered negative (-); if the Ct value of the 18S internal reference gene channel is ≥30, the test is considered invalid and needs to be repeated. The specific methods for determining the results are shown in Table 5: Table 5:

[0043] National standard compliance with testing performance:

[0044]

[0045] Equivalence to traditional reagent kits:

[0046] Example 4: Application of an equivalent kit for the fluorescent PCR detection of peanut allergen components in the detection of allergen residues in the food processing environment, comprising the following steps: (1) Environmental sample collection Wipe a 50cm² area food production line conveyor belt with a sterile swab and add 1mL of sample preservation solution containing 0.1% Tween-20 PBS; (2) DNA enrichment and extraction ① Centrifuge the swab eluent at 12,000 rpm for 5 min, discard the supernatant and retain the precipitate; ② Use the DNA extraction column provided with the kit to treat the precipitate, with an elution volume of 30 μL; (3) Construction of fluorescent PCR reaction system Preparation of the reaction system:

[0047] (4) Amplification procedure and data acquisition

[0048] (5) Cross-contamination verification results Repeated testing was performed on samples from the three types of production lines, n=10:

[0049] The detection effect and judgment mechanism of an equivalent kit for fluorescent PCR detection of peanut allergen components: an analysis of its advantages compared with national standards and existing technologies. 1. Detection and judgment mechanism: The core of the kit lies in its dual-target simultaneous detection system, combining a peanut-derived specific gene and an 18S internal reference gene with a specially designed chimeric recombinant plasmid positive control, thus constructing a rigorous result interpretation process. Multiple rules must be followed when interpreting test results to mitigate the risks of false negatives and false positives: Forced monitoring of the internal control gene: The Ct value of the 18S internal control gene channel must be <30; otherwise, the test result is considered invalid. This mechanism monitors the quality of sample DNA extraction and reaction inhibitors in real time, including oils in the food matrix, to ensure accurate sample processing. The document explicitly requires: "An 18S channel Ct value <30 is considered a valid detection; otherwise, the result is invalid."

[0050] Co-validation with negative and positive controls: The negative control, ultrapure water, showed no amplification (Ct value ≥ 40), while the positive control, the chimeric recombinant plasmid pUC57-HS-18S, exhibited S-shaped amplification curves with Ct values ​​< 30 in both the peanut source and the 18S channel. This dual validation ensured the effectiveness of the kit's core components: primers, probes, and enzyme activity.

[0051] Criteria for positive / negative results in the test samples: A Ct value < 35 for the peanut source channel is considered positive, indicating the presence of peanut allergen; a Ct value ≥ 40 is considered negative. Furthermore, the interpretation must meet the requirement that "all samples show an amplification curve with a Ct value < 30 in the 18S internal control channel" to avoid misjudgments due to operational errors or matrix interference.

[0052] 2. Advantages compared to national standards: Eliminating the risk of false negatives: While national standards only require single-target quality control, this kit employs simultaneous dual-target detection—the peanut-derived gene, the 18S internal reference gene, and the chimeric plasmid positive control pUC57-HS-18S, containing SEQ ID NO: 7 and 8—to construct a "triple quality control barrier." Documented experimental data shows that in cross-contamination validation, the kit achieved a detection rate of 90-100% for food production line samples, compared to only 0-40% for the national standard kit. This is attributed to the mandatory compliance mechanism of the internal reference gene, which promptly identifies sample anomalies and avoids false negatives.

[0053] Enhanced resistance to matrix interference: While the national standard does not specify concrete parameters for resistance to high-fat environments, this kit features an optimized buffer formulation of 40 mmol / L KCl + 3 mmol / L MgCl2 to neutralize the enzyme activity inhibition caused by lipids. In accelerated stability testing, after 9 days of storage at 35°C, the kit's Ct value shift was ≤0.5. For freeze-thaw stability, the Ct shift after 10 cycles was ≤1.0, exceeding the national standard requirement of ≤1.5 after 7 days. This allows the kit to maintain stable amplification efficiency in high-fat matrices such as chocolate and baked goods, whereas traditional kits often experience a sharp drop in sensitivity due to buffer ion imbalance.

[0054] Improved accuracy in trace detection: The national standard specifies a probe fluorescence intensity ΔRn ≥ 5000 and a primer working concentration of 100-900 nM. The kit's measured ΔRn for the FAM channel reaches 7800 ± 210, with final primer concentrations of 0.4 μM and 400 nM, meeting the standard. However, through optimization of the 60℃ annealing extension temperature and 15-minute pre-denaturation program, the kit balances probe hydrolysis efficiency and specificity, achieving a detection limit as low as 10 pg / cm² in trace samples. The detection rate for the condiment filling line samples in the document is 90%, while the detection rate of the national standard kit is almost 0 under the same conditions.

[0055] 3. The innovative effect compared to existing technologies: A dual-probe quenching system replaces single-dye detection: Traditional kits often use SYBR Green dye or the quencher group BHQ1, which easily leads to non-specific amplification and background noise. This kit uses dual-labeled probes: a peanut-derived probe (SEQ ID NO:3) labeled with FAM-TAMRA, and an 18S internal control probe (SEQ ID NO:6) labeled with FAM-TAMRA. The TAMRA quencher group, with a spacing of 5.2 nm, reduces background noise, achieving a "superior" signal-to-noise ratio.

[0056] Dynamic threshold interpretation replaces fixed threshold: Traditional methods rely on fixed Ct thresholds, which cannot adapt to sample differences. The kit introduces a dynamic threshold mechanism for the internal reference gene and combines it with standard curve quantification to avoid misjudgments caused by fluctuations in amplification efficiency. In food processing environment detection, the kit achieves a detection rate as high as 90-100%, while traditional kits only reach 30-40%, highlighting its superior adaptability.

[0057] Enhanced freeze-thaw resistance and stability: Existing kits often suffer from enzyme activity loss or premix layering due to freeze-thaw cycles, affecting the accuracy of assays. This kit, through freeze-thaw protectants and a homogenizing and stabilizing formulation, achieves a Ct shift ≤1.0 after 10 freeze-thaw cycles, with an enzyme activity retention rate of 98.2%, surpassing the stability deficiencies of traditional products. Accelerated stability data, with a Ct shift ≤0.5 after 9 days of storage at 35°C, demonstrates its reliable assay performance even under harsh conditions.

[0058] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0059] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A peanut allergen component fluorescent PCR detection equivalent kit, characterized in that, The kit comprises: (1) 2x Probe qPCR Mix; (2) probe primer mixture of peanut origin; (3) 18S internal reference probe primer mixture; (4) ultrapure water; (5) positive control; (6) negative control; wherein the 2x Probe qPCR Mix comprises Tris-HCl buffer at pH 8.4, potassium chloride KCl and magnesium chloride at final concentrations of 40 mmol / L, 40 mmol / L and 3 mmol / L, respectively; The probe primer mixture of peanut origin comprises a forward primer shown in SEQ ID NO: 1, a reverse primer shown in SEQ ID NO: 2, and a probe shown in SEQ ID NO: 3, and the working concentration of each primer / probe is 10 μM; The 18S internal reference probe primer mixture comprises a forward primer shown in SEQ ID NO: 4, a reverse primer shown in SEQ ID NO: 5, and a probe shown in SEQ ID NO: 6, and the working concentration of each primer / probe is 10 μM; The positive control is recombinant plasmid pUC57-HS-18S containing peanut-derived target gene fragment SEQ ID NO: 7 and 18S internal reference gene fragment SEQ ID NO: 8, with a concentration of 1 x 10 8 copies / μL.

2. The peanut allergen component fluorescent PCR detection equivalent kit according to claim 1, characterized in that, The 2×Probe qPCR Mix was prepared by diluting 10×PCR buffer, which contained 200 mmol / L Tris-HCl, pH 8.4, 200 mmol / L KCl, and 15 mmol / L... .

3. The peanut allergen component fluorescent PCR detection equivalent kit according to claim 1, characterized in that, The 5' end of the probe of peanut origin SEQ ID NO: 3 is labeled with a FAM fluorescent group, and the 3' end is labeled with a TAMRA quenching group; the 5' end of the 18S internal reference probe SEQ ID NO: 6 is labeled with a FAM fluorescent group, and the 3' end is labeled with a TAMRA quenching group.

4. The peanut allergen component fluorescent PCR detection equivalent kit according to claim 1, characterized in that, The positive control recombinant plasmid pUC57-HS-18S comprises the following chimeric sequence: Peanut origin target gene fragment: 5'-gataggttgcaggggaggcaacaggagcaacagttcaagagggagctcaggaacttgcctcaacagtgcggccttagggcaccacagcgttg-3', SEQ ID NO: 7; 18S internal reference gene fragment: 5'-TCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATT-3', SEQ ID NO:

8.

5. The peanut allergen component fluorescent PCR detection equivalent kit according to claim 1, characterized in that, The amount of each component added in the 25 μL reaction system is: 2x Probe qPCR Mix: 12.5 μL; probe primer mixture of peanut origin or 18S internal reference probe primer mixture: 3 μL; template DNA: 2 μL; ultrapure water: supplemented to 25 μL.

6. The peanut allergen component fluorescent PCR detection equivalent kit according to claim 1, characterized in that, The final concentration of primers in the reaction system is 0.4 μM, and the final concentration of probes is 0.4 μM.

7. A method of using the equivalent kit for the fluorescent PCR detection of peanut allergen components according to any one of claims 1 to 6, characterized in that, The following steps are included: Step one, standard gradient dilution Take positive control, 1 x 10 8 Copy / μL, 6 concentration levels were diluted by 10 times gradient, 1 x 10 7 To 1 x 10² copies / μL, filter core suction head was used during dilution process and independent area was operated; Step two, sample DNA preparation The food sample to be tested is treated by using a conventional DNA extraction method, and at the same time, an ultrapure water negative control and a positive control are set, 1×10 5 copies / μL standard; Step three, construction of fluorescence PCR reaction system Separate peanut origin detection system and 18S internal reference detection system, each system independently comprising: 2x Probe qPCR Mix 12.5 μL; corresponding probe primer mixture 3 μL; template DNA: 2 μL; ultrapure water supplemented to 25 μL; Step four, fluorescence PCR amplification The reaction program is as follows: Pre-denaturation: 95℃ 15min; Cycle reaction 40 cycles: 95℃ 15s; denaturation, 60℃ 1min: annealing / extension, collect FAM channel signal; Step five, result interpretation Negative control: Ct value ≥ 40.0 or no amplification curve; Positive control: Ct value ≤ 35.0 and S-shaped amplification curve; Test sample: peanut-derived channel Ct value < 35.0 is positive, ≥ 40.0 is negative, if 35.0 < Ct value ≤ 40.0, then repeat the test; Internal reference quality control: 18S channel Ct value < 30.0 is considered as valid detection, otherwise the result is invalid.

8. The method of using the peanut allergen component fluorescent PCR detection equivalent kit according to claim 7, characterized in that, The result interpretation needs to meet the following conditions at the same time: 18S internal reference channel appears Ct value ≤ 30.0 S-shaped amplification curve in all samples; Negative control has no amplification, Ct value ≥ 40; Positive control appears Ct value ≤ 35.0 in peanut-derived channel and Ct value ≤ 30.0 in 18S channel.

9. The method of using the peanut allergen component fluorescent PCR detection equivalent kit according to claim 7, characterized in that, When quantitative detection is performed: Establish a standard curve with gradient dilution standard Ct value as the vertical axis and copy number logarithmic value as the horizontal axis; The peanut-derived copy number of the sample to be tested is calculated by the standard curve equation = -a x Ct + b, where a, b are fitting parameters.

Images