Strong pathogenicity duck virus hepatitis III virus and egg yolk antibody, preparation and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a highly pathogenic duck virus hepatitis III virus and an egg yolk antibody, preparation and application thereof. The virus strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 24, 2024, the preservation number is CGMCC No.46271, and the virus strain is named as RD240820B. The egg yolk antibody is prepared by using the highly pathogenic duck virus hepatitis III type virus strain as an antigen. The egg yolk antibody is applied to preparation of products for preventing or treating duck virus hepatitis III. In a virulence experiment on a duck embryo, the death rate of the virus strain reaches 80% after the duck embryo is inoculated for 36 hours, and the virus strain has strong pathogenicity. And the death rate within 60 hours after inoculation is 100%, and the strain has relatively strong pathogenicity. The death rate is still 60% when the diluent is 10-8, and the toxicity is strong. The ELD50 value of the strain is relatively low, which indicates that the strain has relatively strong pathogenicity to duck embryos. After the egg yolk antibody is injected, the protection rate reaches up to 97.6% after the diseased duck is treated, and the egg yolk antibody has a remarkable prevention and control effect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microorganisms, in particular to a strong pathogenic duck viral hepatitis type III virus and its yolk antibody, preparation and application. BACKGROUND

[0002] Duck viral hepatitis (DVH) is an acute infectious disease caused by duck hepatitis virus (DHV), which is characterized by convulsions, hyperextension of the angle and liver swelling and hemorrhage in ducklings. It is highly lethal and contagious. Currently, DVH has become one of the most serious infectious diseases in the duck industry, causing huge economic losses to the duck industry and seriously affecting its healthy and steady development.

[0003] Currently, there is no ideal commercial drug on the market to prevent and control the disease, and there is no overall prevention and treatment measure for the prevention and control of multiple genotypes of the disease. Yolk antibody is an antibody against specific antigens extracted from immunized laying hens, which is an immunoglobulin in yolk, has good stability, heat resistance and acid resistance, is safe, efficient and residue-free, and has significant treatment effect. Yolk antibody has good specificity and is suitable for actual production. Currently, the market demand for yolk antibody is huge.

[0004] Because the toxicity of the virus directly affects the condition of the antibody, it is necessary to screen a strong pathogenic duck viral hepatitis type III virus with high immunogenicity, so that the prepared yolk antibody has the advantages of high purity, high titer and good treatment and prevention effect.

[0005] It should be noted that the information disclosed in the above background section is only used to strengthen the understanding of the background of the present application, and therefore can include information that does not constitute prior art known to those of ordinary skill in the art. SUMMARY

[0006] To solve the problem of weak pathogenicity of duck viral hepatitis type III virus in the prior art, a strong pathogenic duck viral hepatitis type III virus RD240820B is obtained by screening.

[0007] The technical scheme of the present application is as follows: In a first aspect, the present application provides a strong pathogenic duck viral hepatitis type III virus (Duck Hepatitis A Virus Type 3), which was deposited with the China General Microbiological Culture Collection Center on December 24, 2024, and has the accession number CGMCC No.46271, and is named RD240820B.

[0008] In another aspect, the DHAV-3 VP1 genome sequence of the strong pathogenicity duck viral hepatitis type III virus is shown as SEQ ID NO: 1.

[0009] In another aspect, the DHAV-3 VP1 genome sequence of the strong pathogenicity duck viral hepatitis type III virus is shown as SEQ ID NO: 1. .

[0010] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10 -8 In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0011] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0012] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0013] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0014] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0015] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0016] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0017] In another aspect, the strong pathogenicity duck viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10

[0018] The beneficial effects achieved by the present application are: 1. The viral hepatitis type III virus strain has a 80% mortality rate in the duck embryo virulence experiment at 36h after inoculation, and all the ducks die within 60h after inoculation, with a 100% mortality rate, which has a strong pathogenicity compared with other existing strains; 2. The viral hepatitis type III virus strain has a 60% mortality rate at a dilution of 10-8 The mortality rate is still 60% at dilution, and the virulence is strong. The ELD 50 value of the strain is low (10 -8.3 ), indicating that the strain has strong pathogenicity to duck embryos; 3. Injecting 0.5 mL of the egg yolk antibody in the application per duck, the protection rate of the treated ducks is as high as 97.6%, while the control group is injected with 1 mL of the egg yolk antibody, and the protection rate of the treated ducks is only 88.3%, which is significantly lower than the application. Compared with the existing egg yolk antibody in the control group, the application still has a significant prevention and control effect under the condition of halving the dose; 4. In the preparation process of the egg yolk antibody, by controlling the stirring speed and time, the highest titer is effectively maintained while avoiding denaturation of the egg yolk. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is a phylogenetic analysis result diagram of the duck viral hepatitis type III virus strain based on the whole genome sequence.

[0020] Figure 2 is a genomic nucleotide homology comparison diagram of the duck viral hepatitis type III virus and other reference strains in GenBank.

[0021] Figure 3 is an electron microscope diagram of the duck viral hepatitis type III virus of the application.

[0022] Figure 4 is a PCR identification diagram of the duck viral hepatitis type III virus of the application. Among them, lane 1: marker; lanes 2-3: RD240820B; lane 3: DHV-3 negative control.

[0023] Figure 5 is a susceptible duck embryo death state diagram.

[0024] Figure 6 is the animal regression experiment result. Among them: A: the beak of the dead duckling is purple and black after infection; B: the duckling is depressed after infection; C: the state of the dead duckling; D, E: the liver of the infected duckling is hemorrhagic; F: the control liver has no lesions.

[0025] Figure 7 is a PCR diagram of the duck viral hepatitis type III virus infection and protection test of the application. Among them, lane M: marker; 1: non-treatment after infection; 2: treatment group after infection; 3: prevention group after infection; 4: negative control group; 5: blank. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the contents in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all the other embodiments obtained by a person of ordinary skill in the art without creative effort belong to the scope of protection of the present application.

[0027] In the present application, unless specified, the equipment and raw materials used can be purchased from the market or commonly used in the art. The methods in the following examples are all conventional methods in the art, unless specified otherwise. Unless otherwise defined, all technical and scientific terms used in the present specification have the same meanings as commonly understood by a person skilled in the art of the present application.

[0028] In the present embodiment: The 7-day-old ducklings used for the test were purchased from a duckling hatching farm in Weifang.

[0029] The 9-day-old duck embryos used for the test were purchased from a laying duck farm in Weifang.

[0030] The sterile PBS solution was purchased from Wuhan Dr. Deki Biological Engineering Co., Ltd.

[0031] 2xTapPCRStarMix was purchased from Beijing Kangrunchengye Biological Technology Co., Ltd.

[0032] Tween 80 and Span 80 were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.

[0033] Other raw materials were all commonly commercially available.

[0034] In the present embodiment, the duck viral hepatitis type III virus RD240820B strain is also referred to as "RD240820B strain" for short.

[0035] Embodiment 1: Isolation and identification of duck viral hepatitis type III virus RD240820B strain 1. Virus isolation The liver tissue of a duck suspected to be infected with duck viral hepatitis type III in Weifang, Shandong was collected aseptically. The liver tissue was mixed with sterile PBS at a ratio of 1:2 (W / V), and then homogenized and grinded, centrifuged at 6000 rpm for 15 min, repeated freeze-thawing for 3 times, and then the supernatant was collected for strain isolation and purification, filtered through a 0.22u sterile filter, and stored at -20℃ for standby. After blind transmission in a common duck embryo allantoic cavity for 1 generation and blind transmission in a SPF duck embryo for 3 generations, the duck viral hepatitis type III virus strain was isolated and purified. The whole genome of the strain was sequenced, and the DHAV-3 VP1 gene sequence is shown as SEQ ID NO: 1.

[0036] SEQ ID NO: 1 ATGTCTGTGAGAGCAGGTATTTGCCTTGCAGGAGCTAAGCCACATTGGTGGACAGGAACACCAGCCTGCAGGAGTTATGTGTTGCCTTTATTACTCCCCTTGATCATTTACAGTGTACTTGTCAAAGTCTGTCTGCAACAAGTGATTTTCAACCCATCTCTACTGCTGTTGGCCTGGTCTGCCCTGCCACCCCTCACCCGGTGAGCAGGGCATCCTCCTCGTGTCATTTCCCTCGGCATGGTGAGAGATGAGCACAAATGCTTGTTCACCCCACTGCAGCAAGTGACATATCTGAGGGGAAAATATCGCTGAAGCCATTTTCACCATCCAACTGTCACAAATGCTTCCATTATGCCCTTCTGCATGTGGCTGCTCACAGGCTTTTGTCTGTTTGCCTCTCTCTCTTCCTCGACTGATGGTGTGGTGCCTTATCAGGCTACCACTTTCGCCTTCTTGTGAATGCACCATCTGGGGCTGCTGGGGGACTAATGATGGTGTGGATGCCTTATC As shown in Figure 1 and Figure 2 phylogenetic tree analysis results show that the virus sequence of the patent belongs to different branches; sequence similarity heat map shows that the virus sequence of the patent has distant homology with the existing sequence, and has uniqueness. Therefore, the strain has a distant genetic relationship with the existing sequence, belongs to a new branch, indicating that the isolated strain is a new type of duck viral hepatitis III virus, which is named: RD240820B strain, and was preserved in China General Microbiological Culture Collection Center on December 24, 2024, with the preservation number of CGMCC No. 46271.

[0037] Morphological observation of duck viral hepatitis III virus RD240820B strain (1), take 20 ul containing duck viral hepatitis III virus RD240820B strain liquid drop on copper mesh, natural precipitation 15 mim, and use filter paper from the side to absorb the excess liquid, add a drop of 2% phosphotungstic acid (PTA) on the copper mesh to stain the virus for 10 min, then use filter paper to absorb the staining liquid from the side, and observe the virus morphology with electron microscope after the sample is dried.

[0038] Result analysis: by Figure 3It can be seen that the virus RD240820B of duck viral hepatitis type III has smaller particles, and the virus diameter is 20-40 nm.

[0039] 3. Virus identification (1) Virus DNA extraction The specific operation process is carried out according to the StarSceipt III One-Step RT-RCR Kit(Dye) extraction kit instructions, and the sample addition amount is 300 μL.

[0040] Identification primer: DHAV-3-F: AACCCCTTTGATCCACACTG DHAV-3-R: GATAAGGCATCCACACCATC The length of the fragment of the identification primer is 554 bp.

[0041] (2) PCR amplification system 20 μL amplification system is used for amplification, and the specific reagents are shown in Table 1: Table 1 PCR amplification system (20 μL)

[0042] (3) Amplification program 94°C pre-denaturation 3 min, 94°C denaturation 30 s, 55°C annealing 40 s, 72°C extension 305 s, 30 cycles; after the end of the cycle, 72°C extension for 10 min, 4°C storage. After the reaction is completed, the PCR product is subjected to 1% agarose gel electrophoresis, and the results are shown in Figure 4 .

[0043] 4. Virulence experiment of duck viral hepatitis type III virus RD240820B strain on duck embryo The virus strains RD240820B, and the existing virus strains RD240810B, RD240830B, RD240840B, RD240850B, RD240860B, were respectively diluted 1:100 with PBS (0.01 mol / L, pH=7.2), and 10 9-day-old duck embryos were inoculated with 0.2 ml per embryo, and incubated at 37°C. After 24-168 h of duck embryo inoculation, the results are shown in Table 2.

[0044] Table 2: Analysis of duck embryo death status

[0045] As can be seen from Table 2, compared with other existing strains, the RD240820B strain in the application has 8 deaths at 36h, compared with 0, 3, 1, 2, 0 of the existing. The mortality rate of the RD240820B strain in the application at 36h reaches 80%, which has strong pathogenicity. And all died at 60h, the mortality rate is 100%, compared with other existing strains, which has strong pathogenicity.

[0046] And, by Figure 5 It can be seen that the embryos died after inoculation of the RD240820B strain are hemorrhagic all over the body and the embryo bodies are red.

[0047] Example 2: Antigen preparation 1. Virus propagation procedure The duck viral hepatitis type III virus RD240820B strain isolated in Example 1 was inoculated into 9-day-old duck embryos at a dose of 0.2 ml per embryo. The dead embryos within 24h were discarded, and the allantoic fluid of the duck embryos that died and had typical lesions at 36-120h was collected. The collected allantoic fluid of duck embryos was mixed and centrifuged at 8000 rpm for 15 min. The sterile supernatant was quantitatively dispensed and stored frozen.

[0048] 2. Virus liquid inactivation The antigens that died for at least 8 embryos and had correct and clear PCR electrophoresis bands at 24-168h after inoculation of duck embryos were mixed, 10% formaldehyde solution was added, and the mixture was shaken and mixed thoroughly. The final concentration of formaldehyde solution was 0.1%. Then the virus liquid was smoothly poured into another sterile stainless steel barrel, and was stirred and inactivated at 37℃ for 24h (the time was counted from the temperature of the antigen rising to 37℃, and the stirring was performed 3-4 times during the period). After inactivation, samples were taken for inactivation test. The inactivated virus liquid was stored at 2-8℃ for standby use.

[0049] 2.1 Sterility test The inactivated virus liquid was tested according to the current Appendix of Chinese Veterinary Pharmacopoeia.

[0050] 2.2 Inactivation test The inactivated virus liquid was inoculated into 9-day-old duck embryos at 0.2ml per embryo, and the duck embryos were observed for 168h. The duck embryos should be all healthy and alive, and the blind transmission of one generation was performed according to the method. The duck embryos should still be all healthy and alive.

[0051] Results: The antigen after inactivation was sterile. The antigen was completely inactivated, 10 9-day-old duck embryos were inoculated, and the blind transmission of one generation was performed. All the 9-day-old duck embryos were healthy and alive.

[0052] 3. Preparation of immunogen 3.1 Preparation of oil phase 94 parts of white oil for injection and 6 parts of Span 80 were mixed, heated to 90℃ while stirring, and then autoclaved at 121℃ for 30min to obtain the oil phase.

[0053] 3.2 Preparation of water phase Take 96 parts of antigen, 4 parts of Tween 80, mix well after shaking to make Tween 80 completely dissolved, which is the water phase.

[0054] 3.3 Emulsification Prepare the immunogen according to the ratio of 3:1 (V / V) of oil phase and water phase. Take 3 parts of oil phase in a high-speed shearing instrument, stir at 15000 r / min while slowly adding 1 part of water phase, stir for 6 min to make the mixture fully emulsified. After emulsification, sterilely dispense into 250 ml sterile bottles, mark the name, preparation time, loading capacity, etc. on the outer wall of the bottle, and store at 2-8℃.

[0055] 4. Test of immunogen 4.1 Properties Appearance: white and uniform emulsion Dosage form: water-in-oil type. Take a clean straw, drop a small amount of immunogen into cold water, and it does not spread except for the first drop.

[0056] Stability: take 10 ml of immunogen and add it to a centrifuge tube, centrifuge at 3000 r / min for 15 min, and the water phase separated at the bottom is 0.1 ml, not more than 0.5 ml.

[0057] Viscosity: according to the current "Chinese Veterinary Pharmacopoeia" appendix, it is 100 cP, not more than 200 cP.

[0058] 4.2 Sterility test According to the current "Chinese Veterinary Pharmacopoeia" appendix, the test is sterile after testing.

[0059] 4.3 Safety test Use 10 SPF chickens of 14 days old, inject 2.0 ml of immunogen into the leg muscle, and observe for 14 days. No local and systemic adverse reactions caused by injection of immunogen are observed.

[0060] 4.4 Efficacy test Use 20 SPF chickens of 60 days old, of which 15 are injected with 1 ml of immunogen into the leg muscle, and the other 5 are controls. After 21 days of immunization, blood is collected and serum is separated, inactivated at 56℃ for 30 min, and the antibody neutralization titer is determined. The antibody neutralization titer of the immunized group is 1:1024, and that of the control group is negative.

[0061] Example 3: Preparation of RD240820B yolk antibody of duck viral hepatitis type III virus 1. Immunization program First immunization, the immunogen prepared in Example 2 was injected into 140-day-old commercial hens at 0.5 ml per hen; second immunization, the immunogen was injected into the hens at 1.0 ml per hen 15 days after the first immunization; third immunization, the immunogen was injected into the hens at 1.5 ml per hen 15 days after the second immunization; fourth immunization, the immunogen was injected into the hens at 2 ml per hen 30 days after the third immunization. The eggs were collected 14 days after the fourth immunization for detection. When the titer of the egg duck embryo neutralizing antibody test was not less than 1:3072, the hyperimmune eggs were collected and stored at 4°C for standby use.

[0062] The eggs were collected 14 days after the fourth immunization for detection. When the titer of the egg duck embryo neutralizing antibody test was not less than 1:3072, the hyperimmune eggs were collected and stored at 4°C for standby use.

[0063] 2. Preparation of egg yolk antibody 2.1 Cleaning and disinfection: soak in 0.1% 42°C new jieer solution for 15 min, drain after lifting out, and rinse with running water to remove surface dirt. Spray the eggs with 0.1% weikang (glutaraldehyde) for 30 min, and then dry the eggs and crack them.

[0064] 2.2 Egg yolk pretreatment: separate egg white and egg yolk with an eggbeater; mix and stir evenly according to 1:1 (v / v, egg yolk: 0.02 mol / L sodium phosphate dibasic solution); filter the impurities in the egg yolk liquid with a 60-mesh steel screen; transfer the above egg yolk liquid to a settling tank, and add the remaining 2 times the volume of sodium phosphate dibasic solution (0.02 mol / L); stir at 1000 rpm for 60 min. At this time, the pH value of the mixed solution is about 7.2, the color is milky yellow, and the turbidity is uniform.

[0065] When the stirring speed is 500 rpm, the color is milky yellow, the turbidity is uniform, and the titer is 1:512 after stirring for 60 min.

[0066] When the stirring speed is 1000 rpm, the color is milky yellow, the turbidity is uniform, and the titer is 1:768 after stirring for 60 min.

[0067] When the stirring speed is 1500 rpm, the color is milky yellow, the turbidity is uniform, and the titer is 1:512 after stirring for 60 min.

[0068] When the stirring speed is 2000 rpm, the color is light yellow, the clarity is relatively high, and the titer is 1:256 after stirring for 60 min.

[0069] When the stirring speed is 3000 rpm, the color is light yellow, the clarity is relatively high, and the titer is 1:64 after stirring for 60 min.

[0070] According to the above data, it is shown that when the stirring speed is 1000 rpm and the stirring time is 60 min, the titer is the highest, and as the stirring speed increases, the titer decreases.

[0071] Therefore, the inventors found that during this step, it is necessary to operate at a low and uniform speed and for a sufficient time, and to strictly prevent the denaturation of the egg yolk.

[0072] 2.3 Acidification extraction: 1-fold sedimentation liquid (PVP and trehalose are respectively 6.66 g / L and 4.16 g / L, and the same mass of egg yolk is dissolved in purified water) is slowly added to the sedimentation tank at a ratio of 1:1 (v / v, egg yolk: sedimentation agent). At this time, the solution is yellowish, uniform, and turbid. The pH value of the sedimentation liquid is adjusted to 6.0 with a 30% citric acid solution, and the solution is treated at 4°C for 12 h. After the sedimentation is completed and the supernatant titer is not less than 1:768, the supernatant can be completely transferred to the next process.

[0073] 2.4 Caprylic acid lipid removal: 0.1% caprylic acid is added to the extracted supernatant, and after mixing, the solution is placed at room temperature for 2-6 h. The impurities are removed by filter cloth, and the obtained solution is the antibody stock solution.

[0074] 2.5 Sterilization filtration: 0.22-μm microporous filter cartridges are used for sterilization filtration.

[0075] 2.6 Virus removal by ultrafiltration: A virus is removed by ultrafiltration using an ultrafiltration membrane with a molecular weight cut-off of 1000 kDa.

[0076] 2.7 Ultrafiltration concentration: Egg yolk antibodies are concentrated 2-fold by ultrafiltration using an ultrafiltration membrane with a molecular weight cut-off of 100 kDa.

[0077] 2.8 Antibody titer determination: The duck embryo neutralization antibody titer is not less than 1:768.

[0078] 2.9 Sub-packing: The solution is quantitatively sub-packed, sealed, and stored at 2-8°C.

[0079] Example 4: Determination of the median infectious dose (EID 50 ) of RD240820B strain The isolated RD240820B strain virus stock solution was diluted 10-fold with PBS (0.01 mol / L, pH=7.2) to obtain 8 dilution degrees. Each dilution degree was inoculated into 10 9-day-old duck embryos (200 µL / embryo) in the allantoic cavity, and a blank control group was set up. The embryos were incubated at 37°C. After inoculation, the duck embryos that died within 24 h were discarded, and then the duck embryos were observed every 24 h until 168 h. The cumulative number of dead and non-dead duck embryos at each dilution degree was counted. The EID 50 of the virus in 0.2 mL suspension was calculated according to the Reed-Muench method.

[0080] Table 3: Mortality of inoculated duck embryos and ELD of RD240820B strain 50

[0081] As can be seen from Table 3, the virulence of RD240820B strain in the present application is stronger. Specifically, there is still a 60% mortality rate at a dilution of 10 -8 , so the strain can still kill chicken embryos at very low doses. The ELD 50 value of the strain is low (10 -8.3 ), indicating that the strain has strong pathogenicity to chicken embryos.

[0082] Example 5: Animal regression test of RD240820B strain Select 80 healthy 7-day-old ducklings and divide them into two groups, one group is injected with 0.5 mL of sterile PBS into the leg muscle as a control group; the other group is injected with 0.5 mL of DHAV-3 into the leg muscle as a challenge group. The test animals are continuously observed for 7 days for clinical symptoms and death, and the dead ducklings are dissected and observed for pathological changes.

[0083] Experimental results: The RD240820B strain virus solution was injected into the leg muscle of 7-day-old ducklings, and the ducklings showed acute death within 24-72 hours after infection with DHAV-3, with a mortality rate of 100%. The clinical symptoms of the dead ducklings included hyperextension of the beak, disheveled feathers, and enlarged liver with numerous bleeding points upon dissection. The control group of ducklings showed normal behavior, as shown in Figure 2, A: the beak of the dead duckling after challenge turned purple and black; B: the duckling after challenge was depressed; C: the state of the dead duckling; D, E: the liver of the duckling after challenge was bleeding; F: the control liver showed no lesions. Figure 6

[0084] Example 6: Challenge and protection test of RD240820B strain 1. Experimental method: Take 600 specific pathogen-free 7-day-old ducklings and randomly divide them into 4 groups, weigh, Group 1, 150 ducklings, is the negative control group; Group 2, 150 ducklings, is the challenge non-treatment control group, 7-day-old ducklings are inoculated with RD240820B strain virus, 0.5 mL per duckling; Group 3, 150 ducklings, is the challenge treatment group, 7-day-old ducklings are inoculated with RD240820B strain virus, 0.5 mL per duckling, and 12 hours later, yolk antibody is injected, 0.5 mL per duckling; Group 4, 150 ducklings, is the challenge prevention group, 7-day-old ducklings are injected with yolk antibody, 0.5 mL per duckling, and 24 hours later, RD240820B strain virus is inoculated, 0.5 mL per duckling. ​

[0085] Isolation feeding, the specific operation as shown in Table 3.

[0086] Table 3: RD240820B strain challenge and protection test Group Scheme Group 1 Negative control group Intramuscular injection of 0.5ml PBS buffer. Group 2 Challenge without treatment Intramuscular inoculation of RD240820B strain 0.5ml. Group 3 Challenge treatment group Intramuscular inoculation of RD240820B strain 0.5ml, 12h injection of yolk antibody 0.5ml. Group 4 Challenge prevention group Intramuscular injection of yolk antibody 0.5ml, 24h intramuscular inoculation of RD240820B strain 0.5ml. After the challenge, the clinical observation was carried out every day, and the incidence and death were counted. On the 7th day after the challenge, all the ducklings were euthanized, and the autopsy was performed. The judgment of lesions: ducklings were in a depressed state, and died acutely. Autopsy showed liver hemorrhage.

[0087] 2. Experimental results and analysis: The experimental results are shown in Table 4: Table 4: Duckling RD240820B strain challenge and protection test scheme

[0088] Note: 1 / 1, / before represents the number of cases, / after represents the number of deaths.

[0089] As can be seen from Table 4, the control group, 0% of the ducklings were sick within 7 days; the second group, the challenge non-treatment group, 150 / 150 of the ducklings were sick within 48 hours, and the mortality rate was 100%; the third group, the challenge treatment group, 1 / 150 of the ducklings were sick within 7 days, and the protection rate was 99.3%; the fourth group, the challenge prevention group, 1 / 150 of the ducklings were sick within 7 days, and the protection rate was 99.3%.

[0090] On the 7th day after the challenge, all the surviving ducklings were euthanized, and the liver tissue was autopsied for PCR identification. The results showed that the PCR band of the challenge group was bright and clear, and the PCR detection of the other three groups showed negative.

[0091] Example 7: RD240820B strain large group test 1. Experimental method: A large duck test area in Shandong Province was selected, and two duck houses with disease were selected as test objects, each raising 5000 2-week-old ducks. The sick ducks in the two areas were treated respectively. Ducks in area 1: inject duck viral hepatitis type III yolk antibody 1 mL per duck purchased in the market; ducks in area 2: inject RD240820B strain virus yolk antibody 0.5 mL per duck. Observe for 7 days and record the incidence of ducklings. Among them, the judgment method of duck viral hepatitis type III is: depressed, loss of appetite, acute death.

[0092] Table 5: RD240820B strain large group test

[0093] 2. Experimental results and analysis: As can be seen from Table 5: after 7 days of injection of duck viral hepatitis type III yolk antibody treatment, the protection rate of ducks in area 1 after treatment was 88.3%, and the protection rate of ducks in area 2 after treatment was 97.6%. Compared with the existing yolk antibody of the control group, under the condition of halving the dose, the duck viral hepatitis type III yolk antibody in the application still has a significant prevention and control effect.

[0094] Therefore, in the face of the attack of duck viral hepatitis type III virus RD240820B, the injection of the duck viral hepatitis type III yolk antibody of the application has a better protection effect than the commercially available yolk antibody, and has a significant prevention and control effect.

[0095] The above-mentioned embodiments of the application do not constitute a limitation on the protection scope of the application. Any modification, equivalent replacement and improvement made within the spirit and principle of the application shall be included in the protection scope of the claims of the application.

Claims

1. A highly virulent Duck Hepatitis A Virus Type 3 (DHAV-3) characterized in that: The virus strain was deposited in the China General Microbiological Culture Collection Center on December 24, 2024, and the deposit number is CGMCC No. 46271, and the name is RD240820B.

2. The highly virulent duck viral hepatitis type III virus according to claim 1, characterized in that: The DHAV-3 VP1 gene sequence of the strong pathogenic duck viral hepatitis type III virus is shown in SEQ ID NO:

1.

3. The highly virulent duck viral hepatitis type III virus according to claim 1, characterized in that: The strong pathogenic duck viral hepatitis type III virus of claim 1 .

4. The highly virulent duck viral hepatitis type III virus according to claim 1, characterized in that: The strong pathogenic duck viral hepatitis type III virus strain still has a 60% mortality rate at a dilution of 10 -8 ​ 5. An egg yolk antibody, characterized by: The egg yolk antibody is prepared by using the strong pathogenic duck viral hepatitis type III virus strain of claim 1 as an antigen.

6. The use of the egg yolk antibody of claim 5 in the preparation of a preparation for preventing or treating duck viral hepatitis type III.

7. A product for the prevention or treatment of duck viral hepatitis type III, characterized in that: The preparation contains the egg yolk antibody of claim 5 in a pharmacologically effective concentration.

8. A method for preventing or treating duck viral hepatitis type III, characterized by: An effective amount of the egg yolk antibody of claim 5 is administered to a duck, and the effective amount is 0.5 mL per duck.

9. The method of claim 5-8, wherein: The preparation process includes egg yolk pretreatment: in the egg yolk pretreatment step, the egg yolk is separated by an egg beater; then, the egg yolk: 0.02 mol / L sodium phosphate dibasic solution is mixed at a volume ratio of 1:1 and stirred uniformly; filtration is performed to remove impurities in the egg yolk liquid; the impurity-removed egg yolk liquid is transferred to a settling tank, and the remaining 2 times the volume of 0.02 mol / L sodium phosphate dibasic solution is added; stirring is performed at a uniform speed of 500-1500 rpm for 30-90 min to obtain pretreated egg yolk.

10. The method of claim 9, wherein the yolk antibody is prepared by: Stirring is performed at a uniform speed of 1000 rpm for 60 min to obtain pretreated egg yolk.

Images