Application of OsAAT2 protein and coding gene thereof in regulating and controlling salt tolerance of rice

Abstract

The invention relates to the field of plant genetic engineering, and discloses an application of OsAAT2 protein and a coding gene thereof in regulating and controlling the salt tolerance of rice. The gene of the OsAAT2 protein is edited on the basis of a CRISPR / Cas9 technology, a rice ZH11 variety is introduced by utilizing an agrobacterium-mediated method, and a knockout mutant is obtained through screening; tests prove that the rice mutant with the OsAAT2 gene knocked out is rehydrated for 4 days after being subjected to stress treatment of 150 mM NaCl salt, and the survival rate is remarkably higher than that of a wild type ZH11 plant. And a simple and effective technical means is provided for rapidly creating a new salt-tolerant rice strain. Therefore, the OsAAT2 protein and the coding gene thereof disclosed by the invention can regulate and control the salt tolerance of the rice, and are of great significance to the cultivation of salt-tolerant transgenic rice.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of OsAAT2 protein and its encoding gene in regulating salt tolerance in rice. Background Technology

[0002] Soil salinization is a major abiotic stress problem facing global agricultural production. Statistics show that more than one-third of the world's irrigated land is affected by salinization, with nearly 100 million hectares of saline-alkali land in my country, and this area is expanding annually. The saline-alkali environment disrupts the normal physiological metabolism of rice through a triple effect of osmotic stress, ion homeostasis imbalance, and oxidative stress: high salt concentrations increase soil osmotic pressure, making it difficult for rice roots to absorb water and hindering cell expansion and growth; excessive Na⁺ entering the plant disrupts intracellular ion balance, inhibits enzyme activity, and interferes with nutrient absorption; simultaneously, salt stress induces a large accumulation of reactive oxygen species, causing cell membrane damage, chlorophyll degradation, and decreased photosynthetic efficiency, ultimately leading to slow rice growth, sharp yield reduction, and even death.

[0003] Rice, a staple food crop for more than half the world's population, is also a moderately salt-sensitive crop. Improving its salt tolerance is crucial for ensuring food security and expanding arable land resources. On the one hand, cultivating salt-tolerant rice varieties can effectively utilize marginal lands such as coastal mudflats in southeastern China and saline-alkali lands in northwestern China, increasing the area of ​​grain production. On the other hand, rice's leaching of soluble salts and alkalis in the soil can help improve the soil structure of saline-alkali lands, promoting ecological restoration and sustainable agricultural development. Therefore, identifying salt-tolerant genes in rice and elucidating their salt tolerance regulatory mechanisms has become a core breakthrough for cultivating new salt-tolerant rice varieties through molecular design breeding.

[0004] Currently, numerous rice salt tolerance-related genes have been identified and applied in breeding practices. For example, the OsNHX1 gene, which encodes the vacuolar Na⁺ / H⁺ antitransporter, can reduce cytoplasmic toxicity by isolating Na⁺ into vacuoles; overexpression of the CCCH-type zinc finger protein transcription factor gene OsC3H47 can significantly enhance seedling salt tolerance; and the branched-chain amino acid transaminase gene OsBCAT2 enhances rice salt tolerance by regulating amino acid metabolism. Functional studies of these genes indicate that rice salt tolerance is a complex trait regulated by multiple genes and pathways, involving multiple physiological processes such as ion transport, osmotic regulation, signal transduction, and antioxidant defense.

[0005] However, there are still many areas to be explored in the current research on the salt tolerance mechanism of rice. The applicability of the identified salt tolerance genes under different genetic backgrounds and the synergistic regulation of salt tolerance and yield traits have not been fully resolved. There is an urgent need to discover more novel salt tolerance genes with clear functions and high regulatory efficiency.

[0006] OsAAT2 is a gene encoding aspartate aminotransferase (AAT), which is involved in the regulation of amino acid and protein metabolism. Studies have shown that overexpression of OsAAT2 can significantly increase the amino acid and protein content in rice seeds. The expression of AAT gene family members (including OsAAT1, OsAAT2, and OsAAT3) is affected by various stresses (such as low nitrogen, NaCl, and ABA stress), but their specific roles in salt tolerance remain unclear. Summary of the Invention

[0007] The purpose of this invention is to provide the application of the OsAAT2 protein and its encoding gene in regulating rice salt tolerance and in creating salt-tolerant rice varieties.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] The first aspect of this invention provides the application of genes that knock out the OsAAT2 protein, said application being any of the following:

[0010] A1) Application in improving salt tolerance in rice;

[0011] A2) Application in the preparation of products that improve the salt tolerance of rice;

[0012] A3) Application in the cultivation of salt-tolerant rice;

[0013] A4) Application in the preparation of products for cultivating salt-tolerant rice;

[0014] A5) Application in salt-tolerant breeding of rice or improvement of salt-tolerant rice germplasm resources;

[0015] The amino acid sequence of the OsAAT2 protein is shown in SEQ ID NO. 3.

[0016] A second aspect of the present invention provides the application of biomaterials related to the OsAAT2 protein, wherein the application is any of the following:

[0017] B1) Application in improving salt tolerance in rice;

[0018] B2) Application in the preparation of products that improve the salt tolerance of rice;

[0019] B3) Application in the cultivation of salt-tolerant rice;

[0020] B4) Application in the preparation of products for cultivating salt-tolerant rice;

[0021] B5) Application in salt-tolerant breeding of rice or improvement of salt-tolerant rice germplasm resources;

[0022] The biomaterial is any one of the following C1) to C3):

[0023] C1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the OsAAT2 protein;

[0024] C2) An expression cassette containing the nucleic acid molecule described in C1);

[0025] C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2);

[0026] C4) A recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3), wherein the microorganism is Agrobacterium.

[0027] Furthermore, the nucleotide sequence of the nucleic acid molecule encoding the OsAAT2 protein is shown in SEQ ID NO. 2.

[0028] A third aspect of the present invention provides a method for improving the salt tolerance of rice, the method comprising knocking out the gene for the OsAAT2 protein in rice to obtain a mutant OsAAT2 gene with a nucleotide sequence as shown in SEQ ID NO.10, thereby obtaining rice with improved salt tolerance; the amino acid sequence of the OsAAT2 protein is shown in SEQ ID NO.3.

[0029] In the above method, knocking out the OsAAT2 protein gene in rice involves using gene knockout technology to reduce the expression level of the gene encoding the OsAAT2 protein.

[0030] In the above method, the expression level of the gene encoding the OsAAT2 protein is reduced by using gene knockout technology. This is achieved by using a CRISPR / Cas9 system containing the target site shown in SEQ ID NO 5 to perform targeted knockout of the OsAAT2 protein gene.

[0031] The fourth aspect of the present invention provides a method for breeding salt-tolerant rice varieties, comprising: using the salt-tolerant rice obtained by the above method as a parent, hybridizing it with a target material, and backcrossing the obtained F1 generation with the target material so that the backcross offspring acquire the same salt tolerance trait as the parent.

[0032] The beneficial effects of this invention are:

[0033] (1) This invention is the first to discover and confirm that the OsAAT2 gene negatively regulates the salt tolerance of rice. Inhibiting or knocking out this gene actually enhances the salt tolerance of rice. This invention provides a new perspective and target for the molecular mechanism of rice response to salt stress, enriching the theoretical basis of plant salt tolerance.

[0034] (2) This invention specifically provides a method for precisely knocking out the OsAAT2 gene using CRISPR / Cas9 gene editing technology, including a specific target site (SEQ ID NO.7) and a corresponding targeting vector. This method is targeted, efficient, and has a short cycle, overcoming the bottleneck of the difficulty and long cycle of selecting salt tolerance traits in traditional breeding.

[0035] (3) Using the above method, the OsAAT2 gene knockout mutant was successfully obtained. Rigorous physiological experiments showed that after treatment with 150mM NaCl salt stress, the survival rate of the mutant (58.54%) was significantly higher than that of the wild type (30.95%). This provides genetic materials and gene resources with direct application value for rice salt tolerance breeding. Attached Figure Description

[0036] Figure 1 The results of the relative expression level of OsAAT2 in the rice variety Zhonghua 11 (ZH11) provided in the embodiments of the present invention after salt stress treatment.

[0037] Figure 2 This is a plasmid map of the overexpression vector pJC34.

[0038] Figure 3 This is a plasmid map of the CRISPR / Cas9 system expression vector PJE045.

[0039] Figure 4 To detect the expression level of OsAAT2 in OsAAT2_OE plants.

[0040] Figure 5 Sequencing alignment of the osaat2 mutant.

[0041] Figure 6 Phenotypic results of wild-type plants, OsAAT2_OE and osaat2 knockout mutants before and after 150 mM salt treatment.

[0042] Figure 7 The results show the survival rates of wild-type plants, OsAAT2_OE and osaat2 knockout mutant plants after treatment with 150 mM salt. Detailed Implementation

[0043] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0044] Explanation of the sequence list:

[0045] SEQ ID NO.1:

[0046]

[0047] SEQ ID NO.2:

[0048] MPSANVRGAQPSADRRLSTLVRHLLPSSARTATTTSTSSSAADADSSLQAFPTMASSSVFAGLAQAPEDPILGVTVAYNKDPSPVKVNLGVGAYRTEEGKPLVLNVVRRAEQMLINNPSRVKEYLPITGLADFNKLSAKLIFGADSPAIQENRVATVQCLSGTGSLRVGGEFLARHYHERTIYIPQPTWGNHPKVFTLAGLTVRSYRYYDPATRGLDFQGLLEDLGSAPSGAIVLLHACAHNPTGVDPTLDQWEQIRQLMRSKALLPFFDSAYQGFASGSLDQDAQSVRMFVADGGELLMAQSYAKNMGLYGERVGALSIVCGSADVAVRVESQLKLVIRPMYSNPPIHGASIVATILKDSAMFNEWTVELKGMADRIISMRQQLFDALKTRETPGDWSHIIKQIGMFTFTGLNSDQVAFMRQEYHIYMTSDGRISMAGLSGRTIPHLADAIHAAVTKLK*

[0049] SEQ ID NO.3:GCCTATGTATTCAAACCCTCCT

[0050] SEQ ID NO.4:TTCAGCTCCACAGTCCATTC

[0051] SEQ ID NO.5:attB1- ACGATGCCATCCGCTAACGT

[0052] SEQ ID NO.6:attB2- TGCTCAGCCAGCAAACATCAC

[0053] SEQ ID NO.7:ATCTCGGCGTCGGCGCCTAC

[0054] SEQ ID NO.8:GAACAGCAACCACCACCAGC

[0055] SEQ ID NO.9:CCCTTCCTACTCCGATCAGACC

[0056] SEQ ID NO.10:

[0057]

[0058] Example 1: Analysis of OsAAT2 gene expression induced by salt stress.

[0059] The response of the OsAAT2 gene to salt stress was detected using quantitative real-time PCR (qRT-PCR).

[0060] Rice cultivar ZH11 seeds were dried, germinated, and then sown in moist sand. When the rice seedlings reached approximately 10 cm in height, they were carefully removed from the sand, their roots wrapped with a sponge, and fixed in a plant culture box containing nutrient solution. After two weeks of growth, 150 mmol / L NaCl was added to the culture solution. Rice leaves were sampled at 3 h, 6 h, 12 h, and 24 h after treatment. Total RNA was extracted and reverse transcribed for quantitative PCR analysis. The OsAAT2 gene-specific PCR primer sequences used in the qRT-PCR analysis were SEQ ID NO.3 and SEQ ID NO.4. Quantitative RT-PCR analysis showed that the OsAAT2 gene was induced under salt stress. This suggests that OsAAT2 participates in the salt stress response. (See attached table). Figure 1 .

[0061] SEQ ID NO.3: 5′-GCCTATGTATTCAAACCCTCCT-3′

[0062] SEQ ID NO.4: 5′-TTCAGCTCCAGTCCATTC-3′

[0063] Example 2: Construction of OsAAT2 overexpression vector

[0064] OsAAT2_OE is an overexpression plant created in the japonica rice variety Zhonghua 11 (ZH11) under the background of OsAAT2 expression driven by the Ubi strong promoter. The plasmid vector used to construct the overexpression vector is PJC034 / pH2GW7 OE + pUbipromoter (see plasmid vector map). Figure 2Specifically, RNA was extracted from the japonica rice variety Nipponbare and reverse transcribed into cDNA. Using the obtained cDNA as a template, amplification primers were designed using Oligo7 software based on the sequence of SEQ ID NO.2. The primer sequences are shown in SEQ ID NO.5 and SEQ ID NO.6. Amplification was performed using KOD-FX (Toyobo) PCR enzyme, with an annealing temperature of 58 ℃ and an extension time of 2 min for 35 cycles. The PCR product of the correctly sequenced OsAAT2 gene was ligated into the expression vector pJC034 using a gateway system. The recombinant vector was named PJE673 / ExC / PJC34 / LOC_Os01g55540.cds. The constructed plasmid was sent to Qingke Sequencing Company. Sequencing results were compared with the map file, and the ligated fragment showed no base mutations in the vector, confirming the successful construction of the PJE673 vector.

[0065] SEQ ID NO.5: attB1-ACGATGCCATCCGCTAACGT

[0066] SEQ ID NO.6: attB2- TGCTCAGCCAGCAAACATCAC

[0067] Example 3: Construction of osaat2 mutant lines (knockout vector)

[0068] The osaat2 mutant was created in the context of the japonica rice variety ZH11 using the CRISPR-Cas9 system.

[0069] The target site for knockout was designed based on the osaat2 gene cDNA sequence, using the website: http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR; the target site sequence is SEQ ID NO.7. Adapters were added, and the primers were synthesized by a primer synthesis company and then amplified. The target site was ligated into the laboratory vector PJE045_CAS9_QLJ using the Gateway system LR reaction. The plasmid vector map is shown below. Figure 3(The vector was obtained from Qu Lijia's laboratory and is described in the paper: Jin M, Guo D, Zhang J, et al. Targeted mutagenesis in rice using CRISPR-Cas system[J]. Cell Research, 2013, 23(10): 1233-1236). The recombinant vector was named PJE937 / ExC / PJE045 / Os01g55540_spacer-1. The constructed plasmid was sent to Qingke Sequencing Company. The sequencing results were compared with the map file, and the inserted fragment had no base mutations in the vector, proving that the PJE937 vector was successfully constructed.

[0070] SEQ ID NO.7: ATCTCGGCGTCGGCGCCTAC

[0071] SEQ ID NO.8:GAACAGCAACCACCACCAGC

[0072] SEQ ID NO.9: CCCTTCCTACTCCGATCAGACC

[0073] Example 4: Obtaining OsAAT2 transgenic positive plants

[0074] The overexpression vector PJE673 and the knockout vector PJE937 were transformed into Agrobacterium EHA105 competent cells using a freeze-thaw method, and positive plaques were identified by PCR. Rice seed-induced callus was infected with Agrobacterium containing the overexpression vector PJE673 and the knockout vector PJE937. Callus was screened for hygromycin resistance, and OsAAT2 transgenic plants were obtained after differentiation and rooting culture. The cDNA of the obtained overexpression plants was analyzed by real-time quantitative PCR using primers SEQ ID NO.3 and SEQ ID NO.4. The results are as follows: Figure 4 As shown, the expression level of OsAAT2 was significantly increased. Using the upstream primer shown in SEQ ID NO.8 and the downstream primer shown in SEQ ID NO.9, the DNA of the obtained mutant material was amplified as a template. The product was sent to Qingke Sequencing Company, and the sequencing results were compared with the map file. The transgenic plant sequence showed base mutations or deletions, proving it to be a positive plant. The results are as follows. Figure 5 As shown.

[0075] Example 5: Phenotypic Analysis of OsAAT2 Overexpression and Salt Stress Treatment in Mutant Materials

[0076] Wild-type ZH11, osaat2 mutant, and OsAAT2_OE overexpression seeds were dried, germinated, and then sown in hydroponic containers. After 10 days of growth, the culture medium was treated with 150 mmol / L NaCl salt stress, and physiological phenotypic changes were observed. Figure 6 The experimental results showed that rice plants with the OsAAT2 gene knocked out exhibited less leaf wilting than the wild type, while plants overexpressing OsAAT2 showed more severe wilting. Therefore, OsAAT2 negatively regulates the ability of rice to resist salt stress.

Claims

1. Use of a gene for knocking out OsAAT2 protein, characterized in that, The application is any of the following: A1) application in improving salt tolerance of rice; A2) application in preparing a product for improving salt tolerance of rice; A3) application in breeding salt-tolerant rice; A4) application in preparing a product for breeding salt-tolerant rice; A5) application in salt-tolerant breeding of rice or improvement of salt-tolerant germplasm resources of rice; The amino acid sequence of the OsAAT2 protein is shown in SEQ ID NO.

2.

2. Use of a biological material related to the OsAAT2 protein as described in claim 1, characterized in that, The application is any of the following: B1) application in improving salt tolerance of rice; B2) application in preparing a product for improving salt tolerance of rice; B3) application in breeding salt-tolerant rice; B4) application in preparing a product for breeding salt-tolerant rice; B5) application in salt-tolerant breeding of rice or improvement of salt-tolerant germplasm resources of rice; The biological material is any of the following C1) to C3): C1) a nucleic acid molecule for inhibiting or reducing the expression of the gene encoding the OsAAT2 protein in claim 1; C2) an expression cassette containing the nucleic acid molecule of C1); C3) a recombinant vector containing the nucleic acid molecule of C1) or the expression cassette of C2); C4) a recombinant microorganism containing the nucleic acid molecule of C1), or the expression cassette of C2), or the recombinant vector of C3), wherein the microorganism is Agrobacterium.

3. Use according to claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule encoding the OsAAT2 protein is shown in SEQ ID NO.

1.

4. A method for improving salt tolerance in rice, the method comprising introducing into a rice plant a nucleic acid molecule encoding a protein having the amino acid sequence of SEQ ID NO:

2. The method comprises knocking out the gene of the OsAAT2 protein in rice to obtain a mutant OsAAT2 gene with a nucleotide sequence shown in SEQ ID NO. 10, and then obtaining rice with improved salt tolerance; the amino acid sequence of the OsAAT2 protein is shown in SEQ ID NO.

2.

5. The method of claim 4, wherein, The gene of the OsAAT2 protein in rice is knocked out by using a gene knockout technology to reduce the expression amount of the gene encoding the OsAAT2 protein.

6. The method of claim 5, wherein, The use of a gene knockout technology to reduce the expression amount of the gene encoding the OsAAT2 protein is achieved by using a CRISPR / Cas9 system containing a target site shown in SEQ ID NO. 7 to perform directional knockout on the gene of the OsAAT2 protein.

7. A method for breeding a salt-tolerant line of rice, characterized by, It comprises: The salt-tolerant rice obtained by the method of any one of claims 4-6 is used as a parent to cross with a target material, the F1 generation obtained is backcrossed with the target material, and thus a backcross progeny with salt tolerance is obtained.

Images