Dendrobium nobile small RNA miR421 and application thereof

By cloning the precursor sequence pre-miR421 of Dendrobium miR421 and overexpressing it in Dendrobium, the problem of uncontrolled polysaccharide synthesis in orchids was solved, resulting in a reduction in polysaccharide content and an increase in glucose content.

CN121343992APending Publication Date: 2026-01-16SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511703658.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-19
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively regulate the polysaccharide synthesis process in orchid plants, especially in Dendrobium, resulting in uncontrolled polysaccharide synthesis.

Method used

The precursor sequence pre-miR421 of Dendrobium miR421 was cloned, and miR421 was overexpressed in Dendrobium through transgenic technology to inhibit polysaccharide synthesis.

Benefits of technology

Overexpression of miR421 significantly reduced polysaccharide content and increased glucose content in transgenic Dendrobium leaves, and regulated the polysaccharide synthesis process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121343992A_ABST
    Figure CN121343992A_ABST
Patent Text Reader

Abstract

The invention discloses a dendrobe small RNA (Ribonucleic Acid) miR421 and an application thereof. According to the application of the miR421 in regulation and control of synthesis of the plant polysaccharide, the mature sequence of the miR421 is as shown in SEQ ID NO. 1. According to the invention, miR421 belonging to dendrobium is cloned from dendrobium officinale leaves, the miR421 is used as a negative regulatory factor to participate in regulating the synthesis process of dendrobium polysaccharide, and transient expression and functional identification prove that the polysaccharide content of transgenic dendrobium is reduced when the miR421 is excessively expressed. Therefore, the miR421 has important theoretical guidance significance and application value in the fields of synthesis of secondary metabolites of orchid plants and medical application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plants, specifically relating to the application of Dendrobium miR421 in regulating polysaccharide synthesis in orchid plants. Background Technology

[0002] Orchidaceae is the second largest plant family after Asteraceae, possessing significant commercial, medicinal, and ornamental value. Polysaccharides are one of the main active substances in Dendrobium orchids, composed of glucomannan. Their primary structure consists of mannose and glucose units, exhibiting antioxidant, antitumor, and immunomodulatory activities (Xing et al. 2014; Teixeira daSilva et al. 2017). Studies have found that polysaccharide biosynthesis is influenced not only by structural genes in the biosynthetic pathway but also by transcription factors and epigenetic modifications (Diao et al. 2014; He et al. 2020). miRNAs can specifically bind to target genes, cleaving target gene mRNA and thus inhibiting target gene expression. In Amorphophallus konjac leaves, miR156 can inhibit the UDP-glucose pyrophosphorylase gene. UGP Expression of miRNAs influences mannan synthesis (Diao et al. 2014). Furthermore, 1257 miRNA-target gene combinations were identified from degradome data of different tissues of *Dendrobium officinale*. These studies indicate that the synthesis of plant polysaccharides is regulated by miRNAs. Summary of the Invention

[0003] The purpose of this invention is to provide the application of Dendrobium miR421 in regulating polysaccharide synthesis in orchid plants.

[0004] This invention cloned the precursor sequence pre-miR421 of miR421 from Dendrobium officinale. miR421, as a negative regulator, participates in the polysaccharide synthesis process of Dendrobium officinale. Through transgenic and functional identification, it was confirmed that overexpression of miR421 inhibits polysaccharide synthesis in transgenic Dendrobium officinale.

[0005] The first objective of this invention is to provide miR421, whose mature nucleotide sequence is shown as AAGCCUCAGGAGGGAUAGCGCC.

[0006] A second objective of this invention is to provide a precursor sequence pre-miR421 that encodes miR421.

[0007] The mature nucleotide sequence of miR421 is shown in AAGUCAGGAGGGAUAGCGCC.

[0008] A third objective of this invention is to provide the application of miR421 in regulating the synthesis of Dendrobium polysaccharides, wherein the precursor sequence pre-miR421 of miR421 is shown in SEQ ID NO.1.

[0009] The preferred application is the use of overexpressing miR421 in Dendrobium to reduce the synthesis of transgenic polysaccharides.

[0010] Preferably, the polysaccharide is a polysaccharide from Dendrobium leaves.

[0011] The mature nucleotide sequence of miR421 is shown in AAGUCAGGAGGGAUAGCGCC.

[0012] Preferably, the application of overexpressing miR421 in Dendrobium to reduce the mannose content in Dendrobium leaves and increase the glucose content in Dendrobium leaves is preferred.

[0013] The dendrobium mentioned is Dendrobium officinale.

[0014] This invention cloned the precursor sequence pre-miR421 containing the mature miR421 sequence from *Dendrobium officinale*. miR421 acts as a negative regulator in the synthesis of *Dendrobium officinale* polysaccharides. Transgenic and functional identification confirmed that overexpression of miR421 reduced the polysaccharide content in the leaves of transgenic lines. Therefore, miR421 has significant theoretical guidance and application value in the synthesis of secondary metabolites in orchids and in medicinal applications. Attached Figure Description

[0015] Figure 1 It is a DNA fragment containing the pre-miR421 precursor sequence, where 1 is the DL2000 DNA Marker and 2 is the target fragment.

[0016] Figure 2 This is an analysis of the expression patterns of miR421 in different tissues (roots, stems, leaves, and flowers).

[0017] Figure 3 The relative expression level of miR421 in overexpressing Dendrobium strains was determined by quantitative real-time PCR analysis; pEAQ-empty represents wild-type Dendrobium, and pEAQ-pre-miR421 represents the selected transgenic Dendrobium strains that transiently overexpressed miR421.

[0018] Figure 4 The polysaccharide content is found in wild-type and miR421-overexpressing Dendrobium; pEAQ-empty represents wild-type Dendrobium, and pEAQ-pre-miR421 represents the selected miR421 transient overexpressing transgenic Dendrobium.

[0019] Figure 5 The values ​​represent the monosaccharide content of wild-type and miR421-overexpressing Dendrobium; pEAQ-empty represents wild-type Dendrobium, and pEAQ-pre-miR421 represents the selected miR421 transient overexpressing transgenic Dendrobium.

[0020] Figure 6 It is a real-time quantitative PCR analysis of polysaccharide synthesis genes DoCSLA5 The relative expression levels in overexpressing Dendrobium strains; where pEAQ-empty represents wild-type Dendrobium and pEAQ-pre-miR421 represents the selected miR421 transient overexpression transgenic Dendrobium. Detailed Implementation

[0021] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0022] Example 1: Amplification of the precursor sequence of miR421 (pre-miR421)

[0023] Unless otherwise specified, all experimental methods described in the following examples can be performed using conventional methods, such as those described in J. Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or F. Osborne et al., *A Concise Laboratory Manual of Molecular Biology*, or the manufacturer's instructions for use of the products used.

[0024] The Dendrobium used in these examples was preserved in a greenhouse at the South China Botanical Garden, Chinese Academy of Sciences. DNA was extracted from Dendrobium officinale leaves. The plant DNA extraction kit was purchased from Beijing Huayueyang Biotechnology Co., Ltd. (catalog number: 0419-50 bb); the standard PCR reaction buffer, 2×TSINGKE Master Mix (blue), was purchased from Qingke Biotechnology Co., Ltd. (catalog number: TSE004-5ML); the overexpression vector was constructed using a high-fidelity enzyme, KOD, purchased from Toyobo (Shanghai) Biotechnology Co., Ltd. (catalog number: KFX-101); the pMD18-T vector and restriction endonuclease were purchased from Baoriyi Biotechnology (Beijing) Co., Ltd. (TaKaRa China) (catalog number: 6011); LB medium is a commonly used medium in this field, and its formulation is based on J. Sambrook et al., *Molecular Cloning: A Laboratory Manual*. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0025] DNA was extracted from Dendrobium officinale leaves using a plant DNA extraction kit from Beijing Huayueyang Biotechnology Co., Ltd., following the instructions for use. The purified DNA was subjected to agarose gel electrophoresis to check its integrity. Then, the concentration and purity of the DNA were measured using a NanoDrop2000 micro-volume nucleic acid and protein analyzer. The qualified DNA was stored at -20℃ for later use. The precursor sequence pre-miR421 containing miR421 was identified in the Dendrobium officinale whole genome Scaffold file. Forward primers (5′-TTTGTAGCCTGCCCTTCTTC-3′) and reverse primers (5′-GCAAAGAAATACAGAATCAACAGTACG-3′) were designed 100 bp upstream and downstream of this sequence. Using this DNA as a template, conventional PCR amplification was performed under the following conditions: 94 ℃ for 4 min; 94 ℃ for 30 sec, 55 ℃ for 30 sec, 72 ℃ for 1 min, 40 cycles; 72 ℃ for 5 min. After agarose gel electrophoresis, the target fragment is recovered. Figure 1 The PCR product was ligated into the pMD18-T vector. The ligation reaction consisted of 4.5 μL of PCR product, 0.5 μL of pMD18-T vector, and 5 μL of Solution I, totaling 10 μL. Ligation was carried out overnight at 16 ℃. The 10 μL ligation product was transferred to 100 μL of *E. coli* DH5α competent cells, incubated on ice for 30 min, followed by a heat shock at 42 ℃ for 90 s, and then incubated on ice for 2 min. 700 mL of LB liquid medium was added, and the mixture was incubated at 37 ℃ with shaking at 200 rpm for 60 min. The bacterial culture was then spread onto LB solid medium (100 mg / L Amp) and incubated upside down at 37 ℃ for 12–16 h. Single colonies were picked and expanded on LB liquid medium (100 mg / L Amp) for bacterial PCR. Positive recombinants were sent to Sangon Biotech Co., Ltd. for sequencing. The target fragment amplified, the mature miR421 sequence is shown as AAGUCAGGAGGGAUAGCGCC, and the pre-miR421 nucleotide sequence is shown as SEQ ID NO.1. The mature miR421 sequence is 21 bp long, and this sequence is named *Dendrobium officinale* miR421; its precursor sequence, pre-miR421, is shown as SEQ ID NO.1, and this sequence is named *Dendrobium officinale* pre-miR421.

[0026] Example 2: Analysis of miR421 expression patterns in different tissues

[0027] Sequence alignment revealed that miR421 belongs to the MIR390 family. Sequence comparison using the medicinal plant miRNA database (mepmirdb.cn / mepmirdb / index.html) showed that miR421 and MeP-dof-miR480 in the database are identical sequences. In the database, we analyzed the relative expression levels of miR421 (MeP-dof-miR480) in different tissues (Meng et al. 2016), finding that its expression level was highest in roots and lowest in stems. Figure 2 ).

[0028] Example 3: Obtaining and identifying Dendrobium officinale with miR421 transient transduction overexpression

[0029] 1. Construction of miR421 overexpression vector

[0030] Based on the pEAQ vector sequence (published in Peyret H, Lomonossoff GP. The pEAQ vector series: the easy and quick way to produce recombinant proteins in plants. Plant Molecular Biology, 2013, 83: 51-58.), two adapter primers were designed. The upstream primer adapter is 5′-CAAATTCGCG. ACCGGT -3′, downstream primer adapter: 5′-TGCTAGTCAT ACCGGT-3′. Primers were designed 100 bp upstream and downstream of the pre-miR421 precursor sequence. The amplification primers were miR421-pEAQ-F (5′-CAAATTCGCGACCGGTTTTGTAGCCTGCCCTTCTTC-3′) and miR421-pEAQ-R (5′-TGCTAGTCATACCGGTGCAAAGAAATACAGAATCAACAGTACG-3′). Using Dendrobium officinale leaf DNA as a template, a full-length fragment containing the pre-miR421 sequence was amplified using KOD high-fidelity enzyme. The amplified product was subjected to agarose gel electrophoresis, and the target DNA fragment was recovered. The pEAQ plasmid vector was digested with Age I to obtain a linear plasmid vector containing sticky ends, following the instructions. The linear plasmid vector was recovered and stored at -20℃ for later use. Vector construction was performed using the Takara In-Fusion HD Cloning Kit. After reacting at 50 °C for 15 min, the cells were immediately placed on ice. The reaction product was transformed into DH5α competent cells and plated on LB solid medium (50 mg / L Kan). The cells were incubated upside down at 37 °C for 12–16 h. Once colonies grew, single colonies were picked and transferred to LB liquid medium (50 mg / L Kan). The cells were incubated at 37 °C with shaking at 200 rpm for 14 h. Positive recombinant clones were then verified by PCR. Positive clones were sent to Sangon Biotech for sequencing. Stranded cells with correct sequencing results were inoculated onto LB liquid medium (50 mg / L Kan) and incubated at 37 °C with shaking at 200 rpm for 14 h. The plasmid was extracted and stored at -20 °C for later use. This recombinant expression vector was named pEAQ-pre-miR421.

[0031] 2. Transformation of Agrobacterium GV3101 with empty vector and recombinant plasmid pEAQ-pre-miR421

[0032] The recombinant plasmid pEAQ-pre-miR421 was transformed into Agrobacterium GV3101 cells using a freeze-thaw method. 1 μg of pEAQ-empty and the recombinant expression vector pEAQ-pre-miR421 were mixed with Agrobacterium GV3101 competent cells and incubated sequentially on ice for 5 min, then flash-frozen in liquid nitrogen for 5 min, then incubated in a 37 ℃ water bath for 5 min, and finally incubated on ice for 5 min. 700 μL of antibiotic-free LB broth was added, and the mixture was incubated at 28 ℃ with shaking at 200 rpm for 3 h. The culture was then evenly spread onto LB solid medium (50 mg / L Kan) and incubated upside down at 28 ℃ for at least 48 h until colonies appeared. Single colonies were picked for PCR identification using the primers miR421-pEAQ-F and miR421-pEAQ-R. Colonies that amplified the target band were considered positive clones and cultured on LB broth (50 mg / L Kan) until OD. 600 = Approximately 1, add an equal volume of 80% sterile glycerol (final concentration 40%), flash freeze in liquid nitrogen for 2 min, and store at -80℃ for later use. This yields Agrobacterium containing pEAQ-empty and the recombinant plasmid pEAQ-pre-miR421.

[0033] 3. Agrobacterium-mediated transient transformation of Dendrobium leaves

[0034] The preserved bacterial strain was removed from the -80℃ freezer and Agrobacterium was streaked onto LB solid medium (50 mg / L Kan) containing pEAQ-empty and the recombinant plasmid pEAQ-pre-miR421. Single colonies were picked and cultured in 100 mL of LB liquid medium (50 mg / L Kan) at 28 ℃ with shaking at 180 rpm for 16 h until OD was reached. 600 = 0.8-1.0. Collect the bacterial suspension by centrifugation at 5000 rpm for 10 min at room temperature. Resuspend Agrobacterium in osmotic medium (20 mM MgCl2; 20 mM morpholine ethanesulfonic acid, pH=5.7; 0.2 mM acetylsuccinone) and adjust the bacterial concentration to OD0.05. 600 = Approximately 0.6. Use a 1 mL syringe to draw up the bacterial solution and inject it into the back of the Dendrobium officinale leaf. Generally, it is sufficient if the solution is completely absorbed into the leaf. After co-culturing in the dark for 2 days, culture under light conditions.

[0035] 4. Identification of transiently transformed plants

[0036] Three days after leaf dorsal injection, around 10:00 AM, leaves of uniform morphology and size were selected from the empty vector pEAQ-empty and the transiently transduced overexpression vector pEAQ-pre-miR421. These leaves were flash-frozen in liquid nitrogen for 30 min and stored at -80°C. miRNAs were extracted from the overexpression vector and empty leaf leaves using the plant miRNA enrichment kit (Catalog No. R4312-02) from Guangzhou Meiji Biotechnology Co., Ltd. miRNAs were reverse-transcribed using the miRNA 1st Strand cDNA Synthesis Kit (Catalog No. MR201) from Nanjing Novizan Biotechnology Co., Ltd. Primer sequences for miR421 were designed using the tailing method. Quantitative real-time PCR was performed using the Dendrobium U6 gene as an internal control. Among them, U6-F (5′-CTTCGGAGACATCCGATAAA-3′) and U6-R (5′-TATGCGTGTCATCCTTGC-3′); the real-time PCR primers for miR421 are miR421-QF (5′-AAGCTCAGGAGGGATAGCGCC-3′), and miR421-QR is the reverse universal primer sequence in the kit. Figure 3 As shown, the expression level of miR421 in all transient overexpression lines was significantly higher than that in the wild type, indicating that miR421 has been successfully overexpressed in transgenic Dendrobium leaves.

[0037] Example 4: Effect of miR421 overexpression on polysaccharide content in transgenic Dendrobium leaves

[0038] Leaves of uniform morphology and size were selected from pEAQ-empty and the overexpression vector pEAQ-pre-miR421, dried at -80℃ for 12 h, and then ground into powder using a ball mill. 3.7 mg of the sample was weighed and added to 5 mL of 80% ethanol, vortexed, and extracted at 80℃ for 2 h. The mixture was then centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded. 3 mL of ultrapure water was added, and the mixture was extracted at 100℃ for 3 h, shaking 1-2 times every 1.5 h. The extracted solution was then centrifuged at 12,000 rpm for 10 min. 0.2 mL of the extract was taken and added to 1.8 mL of ultrapure water and 1 mL of 5% phenol solution. After vortexing, 5 mL of concentrated sulfuric acid was added, and the mixture was boiled in a water bath for 20 min, cooled, and the absorbance was measured at 488 nm. The results showed that the polysaccharide content in the miR421 transient overexpression line was significantly lower than that in the wild type. Figure 4 ).

[0039] Example 5: Effect of miR421 overexpression on monosaccharide content in transgenic Dendrobium leaves

[0040] Take 0.5 mL of the extract from Example 4, add 0.25 mL of 3 mol / L hydrochloric acid, hydrolyze at 110 °C for 60 min, and after cooling, add 0.25 mL of 3 mol / L NaOH solution for neutralization. Take 0.4 mL of the mixture, add 0.4 mL of 0.5 mol / L PMP and 0.3 mol / L NaOH sequentially, and incubate at 70 °C for 100 min. After cooling, add 0.5 mL of 0.3 mol / L HCl. Extract the solution three times with chloroform, to a final volume of 300 µL. Inject 10 µL of the supernatant into the HPLC system. The mobile phase was acetonitrile:0.02 mol / L ammonium acetate = 23:77 (v / v); wavelength = 250 nm; column temperature = 40 °C. The results showed that ( Figure 5 The water-soluble polysaccharides in the leaves are mainly composed of mannose and glucose. The mannose content in the miR421 transient overexpression lines is significantly lower than that in the wild type, while the glucose content is significantly higher than that in the wild type.

[0041] Example 6: Overexpression of miR421 affects the polysaccharide synthesis gene in transgenic Dendrobium leaves DoCSLA5 Effect of relative expression levels

[0042] RNA was extracted from leaves of the empty vector pEAQ-empty and the transient overexpression vector pEAQ-pre-MYB59 using a polysaccharide-polyphenol plant RNA extraction kit. The purified RNA was subjected to agarose gel electrophoresis to check its integrity; then, the concentration and purity of the RNA were measured using a NanoDrop2000 ultra-micro nucleic acid and protein analyzer. Qualified RNA was stored at -80 °C for later use. cDNA was obtained by reverse transcription using the All-in-One First-Strand SynthesisMaster Mix kit from Guangzhou Meiji Biotechnology Co., Ltd. The Actin gene from *Dendrobium officinale* (NCBI accession number: JX294908) was used as an internal control, with the quantitative PCR primers ActinF (5′-TCCCAAGGCAAACAGAGAAA-3′) and ActinR (5′-GGCCACTAGCATATAGGGAAAG-3′). The primers for quantitative real-time PCR of DoCSLA5 were DoCSLA5-QF (5′-GATGGGATTTGCGAGTCTTTATTC-3′) and DoCSLA5-QR (5′-CTCCCAAGCTCTTCATCTTCTT-3′). Quantitative real-time PCR was performed using Aptamer technology from Beijing Novogene Co., Ltd. TM qPCR SYBR ®Green Master Mix reagents, PCR plates, and membranes were all products of Guangzhou Baiweizhen Biotechnology Co., Ltd. The reaction system and procedure were performed according to the manufacturer's instructions. Each sample was tested in 3-4 replicates, and the reaction system for each tube was as follows:

[0043] The reaction was performed on a qTOWER Touch qPCR System. The reaction program was: 95 °C pre-denaturation for 2 min; 95 °C denaturation for 15 sec; 60 °C annealing and extension for 1 min; 40 cycles. Using 2... −ΔΔCT The relative expression level of DoCSLA5 was calculated using the method (Livak and Schmittgen. 2001). The results showed ( Figure 6 The relative expression level of DoCSLA5 in all transient overexpression lines was significantly lower than that in the wild type.

[0044] SEQ ID NO.1

[0045] AAGCTCAGGAGGGATAGCGCCATTGTTCATCGGAGCGCTCAGGAATTTACTGAAATTTTCTCTTCCTTTGATCTGTGACGCTGTCTATCCTGAGCTTTA.

Claims

1. miR421 characterized in that, The precursor sequence pre-miR421 is shown as SEQ ID NO.

1.

2. A miR421 encoding the miR421 of claim 1.

3. The miR421 of claim 2, wherein, The mature nucleotide sequence is shown as AAGCUCAGGAGGGAUAGCGCC.

4. The miR421 of claim 1 is used for regulating the synthesis of Dendrobium polysaccharide.

5. Use according to claim 4, characterized in that, The miR421 is used for reducing the polysaccharide content of the transgenic Dendrobium by overexpressing the miR421 in the Dendrobium.

6. Use according to claim 4, characterized in that, The polysaccharide is the polysaccharide in the Dendrobium leaves.

7. Use according to claim 5, characterized in that, The miR421 has the nucleotide sequence shown as AAGCUCAGGAGGGAUAGCGCC.

8. Use according to claim 4, characterized in that, The miR421 is used for reducing the mannose content and increasing the glucose content in the Dendrobium leaves by overexpressing the miR421 in the Dendrobium.

9. Use according to claim 4, 5, 6, 7 or 8, characterized in that, The Dendrobium is Dendrobium candidum.