Application of Arabidopsis thaliana WAKL10 gene and cell wall-like associated protein kinase WAKL10 coded by Arabidopsis thaliana WAKL10 gene in improvement of plant disease resistance

Abstract

The invention discloses an arabidopsis thaliana WAKL10 gene and application of cell wall-like associated protein kinase WAKL10 coded by the arabidopsis thaliana WAKL10 gene in improvement of plant disease resistance, and belongs to the technical field of plant genetic engineering. According to the application of the arabidopsis thaliana WAKL10 gene in improving the disease resistance of plants, the nucleotide sequence of the arabidopsis thaliana WAKL10 gene is shown as SEQ ID NO.1, the amino acid sequence of cell wall-like associated protein kinase WAKL10 is shown as SEQ ID NO.2, and the plants are selected from arabidopsis thaliana, oilseed rape, rice, tomatoes, potatoes, peanuts, soybeans, cotton, tobacco, cucumbers, watermelons and the like. It is clear that the Arabidopsis thaliana WAKL10 gene and the cell-wall-like associated protein kinase WAKL10 coded by the Arabidopsis thaliana WAKL10 gene can remarkably enhance the infection resistance of plants to pseudomonas syringae for the first time, the defense capacity of the plants to immunity triggered by a bacterial flagellin induction mode is enhanced, and an effective path is provided for reducing chemical pesticide application and promoting agricultural green development.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the Arabidopsis thaliana WAKL10 gene and its encoded cell wall-associated protein kinase WAKL10 in improving plant disease resistance. Background Technology

[0002] When plants grow in their natural environment, they are constantly threatened by various pathogenic microorganisms such as bacteria, fungi, oomycetes, and viruses. Infection by these pathogens hinders crop growth and development, reduces yield, and degrades quality. Statistics show that global food losses due to plant diseases reach 30%-40% of total production annually, severely restricting sustainable agricultural development. Currently, traditional control technologies for plant pathogen infection mainly include: chemical control, which uses fungicides and other chemical pesticides to directly inhibit or kill pathogens; agricultural control, which reduces pathogen populations through crop rotation, selection of disease-resistant varieties, soil disinfection, and sanitation; biological control, which regulates pathogen populations by introducing antagonistic microorganisms, natural enemy insects, or applying microbial / plant-derived pesticides; physical control, which uses methods such as traps, insect nets, heat treatment, and irradiation for physical barrier or inactivation; and plant quarantine, which legally implements port quarantine and regional supervision to block pathogen transmission.

[0003] Currently, the control of plant pathogenic microorganisms mainly relies on a comprehensive technical system. Chemical control, with its rapid and efficient characteristics, remains indispensable in responding to sudden outbreaks, but issues such as pesticide residues, environmental pressures, and the development of pesticide resistance limit its sustainability. Agricultural control reduces the pathogen population at its source through crop rotation, soil management, and other agricultural practices, but its effectiveness is limited by region and farming habits. Biological control utilizes natural enemy insects or microbial agents, demonstrating good environmental friendliness, but its stability and applicability still need improvement. Physical control achieves precise control through methods such as trapping and isolation, but often faces challenges in cost and efficiency in field applications. Plant quarantine, as a preventative measure, can effectively block the invasion of alien pests, but it is difficult to deal with the threat of native pests and diseases. While these traditional methods each have their advantages, none of them fundamentally improve the plant's own disease resistance, and their control effects are easily affected by external environmental factors, mostly representing passive response strategies. Therefore, utilizing modern biotechnology to explore the potential disease-resistant genetic resources of plants and directly modifying the genetic background of plants through genetic engineering to cultivate highly resistant new varieties has become a key direction for breaking through the current bottlenecks in the control of pathogenic microorganisms.

[0004] Over a long period of evolution, plants have developed sophisticated innate immune systems to defend against pathogen invasion. In studies elucidating immune mechanisms, *Pseudomonas syringae* (Pst DC3000) and bacterial flagellin (flg22), as typical model pathogens and signal peptides in plant pathology research, have become key research subjects for exploring plant immune signaling pathways and developing green control strategies due to their ability to infect *Arabidopsis thaliana* and many other important crops. In this immune system, cell wall-associated protein kinases (WAKLs) play a bridging role between extracellular stimuli and intracellular responses, playing an irreplaceable role in sensing pathogen invasion and initiating defensive responses. Therefore, in-depth analysis of the mechanisms of action of these proteins not only helps to reveal the principles of plant disease resistance at the molecular level but also lays a theoretical foundation for breeding new crop varieties with broad-spectrum and durable disease resistance, demonstrating broad application prospects. Summary of the Invention

[0005] In view of the above-mentioned shortcomings of the prior art, the purpose of this invention is to provide the application of the Arabidopsis thaliana WAKL10 gene and its encoded cell wall-associated protein kinase WAKL10 in improving plant disease resistance. It can significantly improve the overall resistance of Arabidopsis thaliana and tomato plants transgenic with the WAKL10 gene to Pseudomonas syringae and enhance their defense against bacterial flagellin-induced immune response.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides the application of the Arabidopsis thaliana WAKL10 gene in improving plant disease resistance, wherein the nucleotide sequence of the Arabidopsis thaliana WAKL10 gene is shown in SEQ ID NO.1, and the specific sequence is as follows:

[0008]

[0009] In a second aspect, the present invention also provides the application of the cell wall-associated protein kinase WAKL10 encoded by the Arabidopsis thaliana WAKL10 gene in improving plant disease resistance, wherein the amino acid sequence of the cell wall-associated protein kinase WAKL10 is shown in SEQ ID NO.2, and the specific sequence is as follows:

[0010] (SEQ ID NO.2).

[0011] Preferably, the Arabidopsis thaliana WAKL10 gene is derived from Arabidopsis thaliana.

[0012] Preferably, the plant includes crops.

[0013] More preferably, the crop is selected from one or more of Arabidopsis thaliana, rapeseed, rice, tomato, potato, peanut, soybean, cotton, tobacco, cucumber and watermelon.

[0014] Preferably, the plant's disease resistance is characterized by resistance to infection by *Pseudomonas syringae* and pattern-triggered immunity induced by bacterial flagellin.

[0015] In a second aspect, the present invention also provides a plant expression vector comprising a nucleotide molecule encoding the Arabidopsis thaliana WAKL10 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0016] In a third aspect, the present invention also provides an engineered Agrobacterium, comprising the plant expression vector.

[0017] In a fourth aspect, the present invention also provides the application of the Agrobacterium engineered strain in improving plant disease resistance.

[0018] Preferably, the plant's disease resistance is improved by infecting the plant with the engineered Agrobacterium, and the plant includes crops selected from one or more of Arabidopsis thaliana, rapeseed, rice, tomato, potato, peanut, soybean, cotton, tobacco, cucumber and watermelon.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] 1. This invention reveals the function of cell wall-associated protein kinase WAKL10 in enhancing the pattern-triggered immune response induced by *Pseudomonas syringae* and bacterial flagellin in plants. Real-time quantitative PCR analysis showed that both *P. syringae* infection and bacterial flagellin treatment significantly induced the upregulation of the WAKL10 gene in *Arabidopsis thaliana*. Further functional experiments confirmed that WAKL10 expression can activate the immune response in *Arabidopsis thaliana*, positively regulating the plant's response to the aforementioned pathogen-associated molecular patterns. Furthermore, overexpression of WAKL10 significantly improved the immune resistance of transgenic *Arabidopsis thaliana* to *P. syringae*.

[0021] 2. The Arabidopsis thaliana WAKL10 gene and its encoded protein, cell wall-associated protein kinase WAKL10, of the present invention can be extended to improve the disease resistance of other crops to Pseudomonas syringae and bacterial flagellin. Using tissue culture and transgenic technology, a new transgenic tomato line with significant resistance to Pseudomonas syringae and bacterial flagellin has been successfully bred.

[0022] 3. This invention helps reduce the amount of chemical pesticides used by improving the plant's own immune resistance to disease, thereby reducing the risk of environmental pollution. It is applicable to the fields of green agriculture and environmental protection engineering. Attached Figure Description

[0023] Figure 1 The results of rapid activation of the WAKL10 gene expression in Arabidopsis thaliana by *Pseudomonas syringae* and bacterial flagellin in the examples are shown below. A: Relative expression level of WAKL10 gene in wild-type Arabidopsis thaliana seedlings after treatment with *Pseudomonas syringae* for 0, 3, 6, 12 and 24 hours; B: Relative expression level of WAKL10 gene in wild-type Arabidopsis thaliana seedlings after treatment with bacterial flagellin for 0, 15 and 30 minutes. Data are presented as mean ± SD (n≥3), and different letters represent significant differences (P<0.01; P<0.05).

[0024] Figure 2 The following data represent the results of WAKL10 positively regulating the immune response of Arabidopsis thaliana to *Pseudomonas syringae* and bacterial flagellin in the examples: A: Ethylene release from WAKL10-overexpressing Arabidopsis thaliana seedlings after 12 and 24 hours of treatment with *Pseudomonas syringae*; B: Phytoalexin accumulation from WAKL10-overexpressing Arabidopsis thaliana seedlings after 24 hours of treatment with *Pseudomonas syringae*; C: Analysis of bacterial count in WAKL10-overexpressing Arabidopsis thaliana leaves 72 hours after *Pseudomonas syringae* infection; D: Ethylene yield from WAKL10-overexpressing Arabidopsis thaliana seedlings after 3, 6, 9, 12, and 24 hours of treatment with bacterial flagellin; E: Immunoblot analysis of mitogen-activated protein kinase from WAKL10-overexpressing Arabidopsis thaliana seedlings after 0, 15, and 30 minutes of treatment with bacterial flagellin; All data are expressed as mean ± SD (n≥3), with significance markers *P < 0.05, **P < 0.01, ***P < 0.05. 0.001.

[0025] Figure 3 The following are the results of the WAKL10-enhanced immune response of tomatoes to *Pseudomonas syringae* and bacterial flagellin in the examples: A: Analysis of the number of bacteria in tomato leaves overexpressing WAKL10 72 hours after infection with *Pseudomonas syringae*; B: Ethylene yield of tomato seedlings overexpressing WAKL10 after treatment with bacterial flagellin for 3, 6, 9, 12 and 24 hours; All data are mean ± SD (n≥3), with **P < 0.01 and ***P < 0.001 as significant differences. Detailed Implementation

[0026] To more fully understand and demonstrate the technical solutions, objectives, and advantages of the present invention, the technical effects produced by the present invention will be further described in detail and completely below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. It should be noted that other embodiments obtained by those skilled in the art without departing from the concept of the present invention are all within the protection scope of the present invention.

[0027] Example 1: Analysis of WAKL10 gene expression pattern in Arabidopsis thaliana in response to Pseudomonas syringae and bacterial flagellin infection using RT-qPCR

[0028] Healthy and plump wild-type (Col-0) Arabidopsis seeds were selected, sterilized with chlorine and vernalized at low temperature, and then evenly sown on 1 / 2 MS solid medium plates and placed in a plant incubator at 22℃ with 24 hours of light. After 5 days of cultivation, seedlings with uniform growth were selected and transferred to glass vials containing 6 mL of SW liquid medium and hydroponically cultured for another 7 days under the same conditions. Subsequently, the following treatments were performed: (1) using OD200 solution with a final concentration of 1000 oz. 600 Seedlings were infected with a 0.02 μg suspension of *Pseudomonas syringae*, and samples were taken at 0, 3, 6, 12 and 24 hours after treatment; (2) Seedlings were treated with 100 nM bacterial flagellin, and samples were taken at 0, 15 and 30 minutes after treatment. All samples were quick-frozen in liquid nitrogen and ground, and total RNA was extracted using a plant total RNA extraction kit. The relative expression level of the WAKL10 gene was then analyzed by RT-qPCR. The primer sequences used are as follows:

[0029] WAKL10-qPCR-F: TCGTGAATACGGAATAGGTTGC

[0030] WAKL10-qPCR-R: GGTTTCCATCAATGCCTCTTAC

[0031] The results are as follows Figure 1 As shown, treatment with both Pseudomonas syringae and bacterial flagellin can induce a significant upregulation of the WAKL10 gene in Arabidopsis thaliana.

[0032] Example 2: Analysis of the activation of the immune response in Arabidopsis thaliana by WAKL10 expression

[0033] (I) Construction and identification of transgenic Arabidopsis thaliana lines overexpressing WAKL10

[0034] Using wild-type Arabidopsis thaliana cDNA as a template, the complete coding sequence (CDS) of WAKL10 was amplified using specific primers. The primers were designed with SalI-BglII restriction sites at the 5′ end and XbaI-StuI restriction sites at the 3′ end to facilitate subsequent cloning operations. The primer sequences are as follows:

[0035] WAKL10-F: ACGCGTCGACAGATCTATGAGCTCTAATTGTAGTTGTTCTCTT

[0036] WAKL10-R: GCTCTAGAAGGCCTCCGAGGAAACAATGGGTTCA

[0037] The amplified WAKL10 fragment was digested with SalI and XbaI and then cloned into the estradiol-inducible expression vector pER8, which was digested with the same enzymes XhoI and SpeI, to construct a plant expression vector pER8-Est:WAKL10-HA with a C-terminal fused HA tag. The nucleotide sequence of the amplified WAKL10 fragment is shown in SEQ ID NO.1.

[0038] The correctly constructed pER8-Est:WAKL10-HA vector was transformed into Agrobacterium GV3101 strain via electroporation. Unopened flower buds of wild-type Col-0 Arabidopsis thaliana were then infected with Agrobacterium high-efficiency transformation solution, and T0 generation seeds were harvested. After thorough drying, the T0 generation seeds underwent surface sterilization with chlorine and low-temperature vernalization treatment, and were evenly sown in 1 / 2 MS solid medium containing appropriate antibiotics, and cultured under suitable light conditions for approximately 9 days. Seedlings with normal growth, true leaves, and obvious resistance were selected and transplanted to nutrient soil as initial positive plants. At approximately 3 weeks of age, the expression of WAKL10 protein in the leaves was detected using Western blotting, and seedlings with suitable expression levels were selected for further culture until maturity. Self-pollinated seeds from T0 plants (T1 generation) were collected, and resistance screening was performed as above, and the ratio of resistant to non-resistant seedlings was statistically analyzed. Lines meeting a 3:1 Mendelian segregation ratio (i.e., single copy insertion) were selected, transplanted, and cultured until maturity, with individual plants harvested as T2 generation seeds. Resistance screening was continued on T2 generation seeds to select fully resistant lines, and stable expression of the WAKL10 protein was verified by Western blotting. Finally, homozygous and stably expressing WAKL10 transgenic lines (T3 generation) were obtained for subsequent experiments.

[0039] (II) Determination of ethylene production in WAKL10 overexpressing transgenic Arabidopsis thaliana under treatment with Pseudomonas syringae and bacterial flagellin

[0040] Select an appropriate amount of fully dried T3 generation seeds, sterilize them with chlorine and vernalize them at low temperature, then spread them evenly on 1 / 2 MS solid medium plates containing the appropriate antibiotics and place them in a plant light incubator for cultivation. After 6 days, select healthy and uniform Arabidopsis seedlings and transfer them to 25 mL transparent glass bottles containing 6 mL SW liquid medium for gas chromatography, and continue to cultivate them for 7 days under continuous light conditions at 22℃ for 24 h.

[0041] All Estradiol-induced transgenic plants were treated with 10 μM Estradiol inducer 24 h before bacterial treatment, while the control group received an equal amount of DMSO. Pst DC3000 was cultured on Pseudomouas Agar F solid medium, with glycerol as the carbon source, and grown at 28°C for 24 h. The working concentration was OD. 600 =0.02; flg22 working concentration was 100 nM. Immediately after bacterial treatment, the glass vials were sealed with GC-specific rubber caps. Ethylene production was measured at specified time points using a gas chromatograph (PANNA). In the set GC program, the detector and injection port temperatures reached 250°C, the column oven temperature was 95°C, the air flow rate was 400 mL / min, the hydrogen flow rate was 40 mL / min, and the nitrogen flow rate was 25 mL / min. The gas injection volume for each use of the closed sampling system was 1.5 mL. The seedling weight used for ethylene content calculation was fresh weight.

[0042] The results are as follows Figure 2 As shown in Figures A and 2D, at 12 and 24 hours after treatment with *Pseudomonas syringae*, the ethylene release from the WAKL10 overexpressing lines was significantly higher than that from the control group. After treatment with flg22, at 3, 6, 9, 12, and 24 hours, the ethylene release from the overexpressing plants was more than 80% higher than that from the control group, with highly significant differences. These results indicate that the WAKL10 gene participates in the immune response of *Arabidopsis thaliana* to *Pseudomonas syringae* and the flagellin flg22, and positively regulates the ethylene signaling pathway.

[0043] (III) Determination of phytoalexin accumulation in WAKL10-overexpressing transgenic Arabidopsis thaliana after treatment with Pseudomonas syringae

[0044] Camalexin, a phytoalexin unique to cruciferous plants, can activate the plant's immune system through synthesis and accumulation, exhibiting significant inhibitory effects against various pathogens. It can also act as a signaling molecule, inducing ethylene and jasmonic acid signaling pathways, further enhancing the plant's disease resistance. In this example, after determining the ethylene content in section (II) above, the accumulation of camalexin in the same batch of materials was analyzed. Arabidopsis thaliana WAKL10 overexpression seedlings were infected with *Pseudomonas syringae* for 24 hours. Metabolites were collected from SW liquid culture medium, and the camalexin content was determined using a microplate reader (SPARK). The detection parameters were set as follows: excitation wavelength 310 nm, emission wavelength 390 nm. Fluorescence values ​​were measured after gradient dilution of the camalexin standard sample solution, a standard curve was plotted, and the absolute content of camalexin in the sample was calculated based on the fresh weight of the seedlings. The results are as follows: Figure 2 As shown in Figure B, the accumulation of camalexin in the experimental group was significantly higher than that in the control group, indicating that WAKL10 overexpression can positively enhance the immune response of Arabidopsis thaliana to Pseudomonas syringae infection by regulating phytoalexin signaling.

[0045] (iv) Analysis of the effect of WAKL10 overexpression on Arabidopsis thaliana resistance to Pseudomonas syringae.

[0046] Transgenic Arabidopsis thaliana pER8-Est:WAKL10-HA strains with stable expression were sown in soil and grown for 3-4 weeks to the seedling stage in a culture room at 22℃ with 14 hours of light / 10 hours of darkness. Healthy 3rd-4th pairs of true leaves were selected. The experimental group was injected with 10 μM Estradiol inducer (containing DMSO solvent), while the control group was injected with an equal volume of sterile water (containing an equal volume of DMSO). After culturing under normal conditions for 24 hours, resistance to *Pseudomonas syringae* was tested. OD was prepared. 600 A fresh Pst DC3000 bacterial suspension at a concentration of 0.0005 (solvent: 10 mM magnesium chloride) was gently injected into the treated leaves, minimizing physical damage. Three days after inoculation, circular leaves of the same size (5 mm in diameter, 3 circular leaves per treatment, with at least 3 replicates per treatment) were collected from different plants using a perforator. The leaves were thoroughly ground with an appropriate amount of sterile water, serially diluted, and homogenized. The homogenate was then spotted onto KB medium containing 50 µg / mL rifampicin and incubated at 28°C for 48 hours. The number of colonies was then counted.

[0047] The host's ability to suppress pathogens can be assessed by comparing the amount of bacterial proliferation within the leaves. Figure 2The results showed that the amount of Pst DC3000 in the leaves of plants overexpressing WAKL10 was approximately 31.67% of that in the control group, with a highly significant difference (P < 0.01), further confirming that WAKL10 can effectively enhance the resistance of Arabidopsis thaliana to Pst DC3000.

[0048] (V) Detection of MAPK activity in WAKL10-overexpressing transgenic Arabidopsis thaliana after treatment with bacterial flagellin

[0049] Estradiol-induced WAKL10 transgenic Arabidopsis seedlings were cultured under sterile conditions to 10 days of age (culture method same as in Experiment 2). The experimental group received 10 µM Estradiol inducer, while the control group received an equal volume of DMSO. After 24 hours of treatment, the samples were treated with 100 nM flg22 for 0, 15, and 30 minutes, respectively. Samples were collected and immediately flash-frozen in liquid nitrogen. After preliminary disruption of the samples with a grinder, 20 mg was weighed and added to 60 µL of Co-IP lysis buffer, then rapidly ground into powder. The powder was centrifuged at 13000 rpm for 5 minutes at 4°C. 30 µL of the supernatant was mixed with an equal volume of 2×SDS solution and boiled at 100°C for 5 minutes. 8 µL of the denatured protein sample was then subjected to electrophoresis on a 10% (v / v) SDS-PAGE gel, followed by transfer to a membrane and immunoblotting analysis. The phosphorylation levels of MPK3 and MPK6 were analyzed using pERK antibody (1:3000 dilution) as the primary antibody and rabbit secondary antibody (1:10000 dilution) as the secondary antibody. The primary antibody dilution was a TBST solution containing 5% bovine serum albumin (BSA), and the secondary antibody dilution was a TBST solution containing 5% skim milk (same as the blocking buffer). All antibody incubation steps were performed in a shaker at 4°C.

[0050] The results are as follows Figure 2 As shown in Figure E, phosphorylation bands of MPK3 and MPK6 were detected in all groups after 15 and 30 minutes of flg22 treatment. Furthermore, the phosphorylation levels of MPK3 / MPK6 in Estradiol-induced WAKL10 overexpression plants were significantly higher than those in the control group. This indicates that WAKL10 can enhance the activation and transmission of MAPK cascade signals during flg22-induced immune responses, thereby improving plant disease resistance.

[0051] Example 3: Analysis of the activation of the tomato immune response by WAKL10 expression

[0052] (I) Construction and identification of WAKL10 overexpression transgenic tomato lines

[0053] The WAKL10 transgenic tomato line was obtained through plant tissue culture technology. The specific steps are as follows: Healthy and plump Micro-Tom tomato seeds were selected, surface-sterilized with 75% ethanol and sodium hypochlorite, and grown for about 10 days. Healthy seedling leaves were selected, cut into 5 mm × 5 mm explants, and immersed in T2-1 liquid medium. They were then transferred face down to T1 solid medium lined with filter paper and pre-cultured at 25°C for 1 day (photoperiod 16 hours light / 8 hours dark, light intensity 120-150 μmol·m⁻¹). -2 ·s -1 The pER8-Est:WAKL10-HA plasmid was electroporated into Agrobacterium GV3101. After washing, the bacterial cells were resuspended in T2-1 liquid medium (T2-2) containing 100 μM acetylsyleugenol. The OD was adjusted. 600 To a concentration of 0.3, soak the pre-cultured explants in this bacterial solution for 10 minutes, then blot dry and place them face down back onto T1 medium. Incubate in the dark for 2 days to complete co-culture (T3). After co-culture, transfer the explants to T4 selection medium containing antibiotics, with cotyledons facing upwards, and culture at 25°C under normal photoperiod. Subculture every 1-2 weeks to induce adventitious shoot differentiation. When the adventitious shoots reach 2-3 cm in length and have complete apical meristem, cut them off and transfer them to rooting medium (Tr). Culture for 1-4 weeks to induce rooting.

[0054] After the rooted seedlings were verified to express WAKL10 protein by Western blotting, they were transplanted into soil and field-managed. After harvesting T1 generation seeds, transgenic positive plants were initially screened using antibiotics and genetic segregation ratio. The qualified tomato seedlings were then transferred to soil cultivation. Subsequently, T1 generation lines with stable WAKL10 expression were screened using Western blotting for subsequent propagation and experiments (the screening process for T2 / T3 generation was the same as for T1).

[0055] (II) Analysis of the effect of WAKL10 overexpression on resistance of tomato to Pseudomonas syringae.

[0056] Transgenic tomatoes stably expressing pER8-Est:WAKL10-HA were cultured under sterile conditions for 10 days, then transplanted into soil and grown in a culture room at 25℃ with 14 h light / 10 h darkness for 5 weeks. Healthy true leaves were selected, and injection treatments were performed at symmetrical positions on the leaves: the experimental group was injected with 10 μM estrogen inducer containing DMSO, and the control group was injected with sterile water containing an equal amount of DMSO. Resistance to *Pseudomonas syringae* was analyzed 24 hours after treatment. Freshly prepared Pst DC3000 bacterial suspension (OD... 600=0.0005 (using 10 mM MgCl2 as solvent) was gently injected into the treated leaves to minimize mechanical damage. Three days after inoculation, leaf discs with a diameter of 5 mm were collected using a punch, with three discs constituting one biological replicate, and at least three replicates per group. The leaf discs were thoroughly ground with sterile water, homogenized, serially diluted, and spread on KB medium containing 50 μg / mL rifampicin. After incubation at 28°C for 48 hours, the colony count was recorded.

[0057] The colony count results showed that ( Figure 3 A) Overexpression of WAKL10 significantly inhibited the proliferation of Pst DC3000 cells in tomato leaves (P < 0.001), indicating that this gene plays an important role in enhancing the immune response of tomatoes to bacterial pathogens.

[0058] (III) Determination of ethylene production in WAKL10 overexpressing transgenic tomatoes under bacterial flagellin treatment

[0059] Healthy and plump pER8-Est:WAKL10-HA transgenic tomato seeds were selected, surface-sterilized with 75% ethanol and sodium hypochlorite, and then placed in MS solid medium. The seeds were cultured at 25°C for 10 days (the first 4 days in the dark, followed by 6 days under a 14-hour light / 10-hour dark cycle). Healthy seedlings with consistent growth were selected and transferred to 65 mL transparent glass vials containing 35 mL of SW liquid medium. These were then cultured for another 7 days at 25°C under continuous light.

[0060] All Estradiol-induced transgenic plants were treated with 10 μM Estradiol inducer 24 hours prior to flgII-28 treatment, while the control group received an equal volume of DMSO. The concentration of flgII-28 used was 100 nM. Immediately after treatment, the vials were sealed with gas chromatography-specific rubber stoppers, and the ethylene accumulation in the vials was measured at specified time points using a gas chromatography system (PANNA). The chromatographic conditions were: detector and injection port temperature 250℃, column temperature 95℃, air flow rate 400 mL / min, hydrogen flow rate 40 mL / min, nitrogen flow rate 25 mL / min, and 1.5 mL of gas injected per injection. Ethylene content was standardized based on plant fresh weight.

[0061] The results are as follows Figure 3 As shown in Figure B, within 3 to 24 hours of flgII-28 treatment, the ethylene release of Estradiol-induced WAKL10 overexpressing plants was consistently significantly higher than that of the uninduced transgenic control group (P < 0.01), indicating that WAKL10 participates in the immune recognition process of tomato against flgII-28 and positively regulates the ethylene signaling pathway.

[0062] In summary, the WAKL10 transgenic Estradiol induction system demonstrated excellent performance in disease resistance verification, proving its feasibility and application potential in enhancing immunity in Arabidopsis and tomato. This provides important reference for controlled immunity breeding in other crops and lays a technical foundation for research on its field stability, ecological safety, and cross-species applicability in different crops, thereby promoting crop disease resistance engineering from "precision design" to "green application".

[0063] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of Arabidopsis WAKL10 gene in improving plant disease resistance, wherein the nucleotide sequence of the Arabidopsis WAKL10 gene is shown as SEQ ID NO.

1.

2. Application of cell wall-associated protein kinase WAKL10 encoded by Arabidopsis WAKL10 gene in improving plant disease resistance, wherein the amino acid sequence of the cell wall-associated protein kinase WAKL10 is shown as SEQ ID NO.

2.

3. Use according to claim 1 or 2, characterized in that, The plant includes crops.

4. Use according to claim 3, characterized in that, The crops are selected from one or more of Arabidopsis, rape, rice, tomato, potato, peanut, soybean, cotton, tobacco, cucumber and watermelon.

5. Use according to claim 1 or 2, characterized in that, The plant disease resistance includes resistance to Pseudomonas syringae infection and pattern-triggered immunity induced by bacterial flagellin.

6. A plant expression vector, characterized by, The nucleotide molecule encoding the Arabidopsis WAKL10 gene, wherein the nucleotide sequence is shown as SEQ ID NO.

1.

7. An Agrobacterium engineered bacterium, characterized in that, The plant expression vector of claim 6.

8. Application of the Agrobacterium engineering bacteria of claim 7 in improving plant disease resistance.

9. Use according to claim 8, characterized in that, The plant is infected by the Agrobacterium engineering bacteria to improve plant disease resistance.

10. Use according to claim 9, characterized in that, The plant includes crops, which are selected from one or more of Arabidopsis, rape, rice, tomato, potato, peanut, soybean, cotton, tobacco, cucumber and watermelon.

Images