A method for site-specific replacement of the Huaxi bovine gene promoter with the creatine kinase promoter
By using CRISPR/Cas12i-mediated homologous recombination technology and replacing the FTO gene promoter with the MCK promoter, the problem of low FTO gene expression efficiency in Huaxi cattle muscle tissue was solved, achieving high-efficiency expression of the FTO gene in muscle tissue and promoting the genetic improvement of Huaxi beef quality.
Patent Information
- Application Number
- CN202511756169.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-26
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2045-11-26
AI Technical Summary
Existing technologies make it difficult to efficiently and precisely regulate the expression of genes related to fat development in the muscle tissue of West China cattle using traditional breeding methods, especially the low expression efficiency of the FTO gene, which affects meat quality improvement.
Using CRISPR/Cas12i-mediated homologous recombination technology, the FTO gene promoter was replaced with a creatine kinase (MCK) promoter. Through upstream and downstream crRNA knockout and the Cas12i nuclease expression vector, the FTO gene was specifically and efficiently expressed in muscle tissue.
It significantly improved the expression efficiency of the FTO gene in muscle tissue, providing a new approach for improving the genetic traits of beef in West China beef and enhancing the precision and efficiency of breeding.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of animal gene editing and genetic breeding technology, specifically relating to a method for site-specific replacement of the creatine kinase promoter with the gene promoter of the Huaxi bovine gene. Background Technology
[0002] Huaxi cattle are a superior beef cattle breed independently developed in my country, possessing outstanding advantages such as excellent growth performance and strong environmental adaptability. Continuous selective breeding based on Huaxi cattle, focusing on growth and development, environmental adaptability, and specific selection in terms of meat quality, flavor, and taste, will help enhance the market competitiveness of Huaxi cattle. Currently, the improvement of genetic traits in beef cattle still largely relies on traditional breeding methods. These methods have long breeding cycles, low selection efficiency, and difficulty in achieving precise and targeted regulation of target traits. In recent years, with the rapid development of genome editing technology, especially the widespread application of the CRISPR / Cas12i system in the animal and plant fields, it has become possible to precisely edit and replace the promoter regions of specific genes.
[0003] However, the current problem in Huaxi cattle is that the promoter activity of genes related to fat development in muscle tissue is insufficient and the expression efficiency is low. There are no reports on replacing the natural promoters of specific endogenous genes (such as genes related to fat metabolism, muscle development or meat quality formation) using promoters. Summary of the Invention
[0004] The purpose of this invention is to provide a method and reagents for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene, using CRISPR / Cas12i-mediated homologous recombination technology to replace the MCK promoter in muscle tissue. FTO Gene promoters enable specific enhancement of muscle tissue. FTO The purpose of gene expression.
[0005] This invention provides a way to improve bovine muscle cells FTO Gene expression reagents include crRNA for upstream site knockout, crRNA for downstream site knockout, a Cas12i nuclease expression vector, and an FTO homologous substitution vector; the FTO homologous substitution vector includes... FTO upstream homologous arm of gene promoter, MCK gene promoter and FTO Downstream homologous arm of gene promoter;
[0006] The nucleotide sequence of the crRNA used for upstream site knockout is shown in SEQ ID NO:23;
[0007] The nucleotide sequence of the crRNA used for downstream site knockout is shown in SEQ ID NO:24.
[0008] Preferably, the upstream site knockout crRNA or the downstream site knockout crRNA exists in the form of a recombinant vector;
[0009] The backbone vector of the recombinant vector is the pUC19-U6-Cas12i-crRNA plasmid.
[0010] Preferably, the FTO The nucleotide sequence of the upstream homologous arm of the gene promoter is shown in SEQ ID NO:25.
[0011] Preferably, the FTO The nucleotide sequence of the downstream homologous arm of the gene promoter is shown in SEQ ID NO:26.
[0012] Preferably, the Cas12i nuclease expression vector further includes a fluorescent reporter gene.
[0013] This invention provides the reagent in West China bovine cells. FTO Applications in gene promoter replacement.
[0014] Preferably, the Huaxi bovine cells include muscle cells and / or fibroblasts.
[0015] This invention provides a method for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene, comprising the following steps:
[0016] Recombinant vectors containing crRNA for upstream site knockout, recombinant vectors containing crRNA for downstream site knockout, Cas12i nuclease expression vectors, and FTO The homologous substitution vector was co-transformed into West China bovine cells.
[0017] Preferably, the mass ratio of the recombinant vector containing upstream site knockout crRNA, the recombinant vector containing downstream site knockout crRNA, the Cas12i nuclease expression vector, and the FTO homologous substitution vector is 1~1.5:1~1.5:2~2.5:1~1.5.
[0018] This invention provides the reagent for cultivating muscle. FTO Application in the Huaxi cattle breed with upregulated gene expression.
[0019] This invention provides a way to improve bovine muscle cells FTO Gene expression reagents include crRNA for upstream site knockout, crRNA for downstream site knockout, a Cas12i nuclease expression vector, and an FTO homologous substitution vector; the FTO homologous substitution vector includes... FTO upstream homologous arm of gene promoter, MCK gene promoter and FTOThe gene promoter downstream homologous arm; the nucleotide sequence of the upstream site knockout crRNA is shown in SEQ ID NO:23; the nucleotide sequence of the downstream site knockout crRNA is shown in SEQ ID NO:24. The reagents described in this invention are based on CRISPR / Cas12i-mediated homologous recombination technology, utilizing upstream and downstream site knockout crRNAs to target bovine muscle cells. FTO The gene promoter is knocked out, and then the MCK gene promoter is precisely inserted under the guidance of an FTO homologous substitution vector. FTO By determining the gene promoter location, efficient promoter replacement can be achieved, and muscle-specific MCK promoters can be used for specific activation in muscle. FTO Gene expression was significantly improved, significantly enhancing its expression efficiency and providing a new approach for the genetic improvement of Huaxi cattle. Attached Figure Description
[0020] Figure 1 The spectrum of the pCAG-Cas12i-x12-2AeGFP v4 plasmid;
[0021] Figure 2 This is a pUC19-U6-Cas12i-crRNA plasmid pattern;
[0022] Figure 3 This is a flowchart of the experimental process of the present invention;
[0023] Figure 4 For target FTO Results of crRNA knockout efficiency assay for gene promoters;
[0024] Figure 5 for FTO Electrophoresis results of PCR amplification products from the upstream homologous arm of the gene promoter;
[0025] Figure 6 for FTO Electrophoresis results of PCR amplification products downstream homologous arms of gene promoter;
[0026] Figure 7 for MCK Electrophoresis results of promoter PCR amplification products;
[0027] Figure 8 Electrophoresis results of the product connecting the upstream homologous arm to the MCK promoter;
[0028] Figure 9 and Figure 10 for FTO upstream homologous arm of gene promoter - MCK promoter- FTO Sanger sequencing results of the gene promoter downstream homologous arm ligation product;
[0029] Figure 11 The results of observing fibroblasts under white light after electroporation;
[0030] Figure 12 The results of fluorescence observation of fibroblasts after electroporation;
[0031] Figure 13 For electroporated fibroblasts (FB) and muscle cells (MuSC) FTO Results of gene mRNA expression level analysis. Detailed Implementation
[0032] This invention provides a way to improve bovine muscle cells FTO Gene expression reagents include upstream site knockout crRNA, downstream site knockout crRNA, Cas12i nuclease expression vector, and FTO homology substitution vector. The nucleotide sequence of the upstream site knockout crRNA is shown in SEQ ID NO:23 (CAUUGGCAGGUGGGUUCUUU); the nucleotide sequence of the downstream site knockout crRNA is shown in SEQ ID NO:24 (CCGCGGUGCACCCUGGGAGU).
[0033] In this invention, the FTO homologous substitution vector includes FTO upstream homologous arm of gene promoter, MCK gene promoter and FTO Downstream homologous arm of the gene promoter. In this invention, the... FTO The preferred nucleotide sequence of the upstream homologous arm of the gene promoter is shown in SEQ ID NO:25. FTO The preferred nucleotide sequence of the downstream homologous arm of the gene promoter is shown in SEQ ID NO:26. The nucleotide sequence of the MCK gene promoter is shown in SEQ ID NO:27. The MCK gene promoter is a tissue-specific promoter, capable of specifically initiating the expression of the target gene in muscle cells, thereby increasing the expression level of the target gene.
[0034] In this invention, the Cas12i nuclease expression vector contains the Cas12i coding sequence for expressing the Cas12i enzyme, and knocks out the FTO gene under the guidance of upstream and downstream knockout crRNAs. The Cas12i nuclease expression vector preferably also includes a fluorescent reporter gene. The fluorescent reporter gene includes a gene encoding green fluorescent protein, a gene encoding red fluorescent protein, or a gene encoding orange fluorescent protein. In embodiments of this invention, the backbone vector of the FTO homologous substitution vector is preferably a pCAG-Cas12i-x12-2AeGFPv4 plasmid containing the green fluorescent protein coding gene. The Cas12i nuclease expression vector described in this invention refers to the prior art (Chen, Y., Y. Hu, X. Wang, S. Luo, N. Yang, Y. Chen, Z. Li, Q. Zhou, and W. Li. 2022. 'Synergistic engineering of CRISPR-Cas nucleases enables robust mammalian genome editing', Innovation (Camb), 3: 100264.). The Cas12i nuclease expression vector in the aforementioned prior art is named Cas12iMax. The spectrum is shown below. Figure 1 .
[0035] In this invention, the upstream or downstream site knockout crRNA is preferably in the form of a recombinant vector; the backbone vector of the recombinant vector is preferably the pUC19-U6-Cas12i-crRNA plasmid. The pUC19-U6-Cas12i-crRNA plasmid was purchased from Beijing Huayueyang Co., Ltd., catalog number VECT90023, and its chromatogram is shown below. Figure 2 The cloning sites of the recombinant vector include Bsa I. Restriction site. This invention does not impose any particular limitation on the construction method of the recombinant vector; any method well-known in the art can be used, such as homologous recombination ligation, followed by screening and sequencing identification using a culture medium containing ampicillin to obtain a recombinant vector containing the target fragment.
[0036] In this embodiment of the invention, in order to screen for knockout FTO Highly efficient crRNA promoters were found in West China cattle. FTOEight crRNAs were designed targeting the gene promoter region (NCBI reference sequence: NC_037346.1, -100 bp to 0 bp and -1400 bp to -1300 bp upstream of the transcription start site). The results showed that crRNA-F2 and crRNA-F7 were the crRNAs with the highest gene knockout efficiency upstream and downstream, respectively.
[0037] This invention provides the reagent in West China bovine cells. FTO Applications in gene promoter replacement.
[0038] In this invention, the Huaxi bovine cells preferably include muscle cells and / or fibroblasts.
[0039] This invention provides a method for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene, the flowchart of which is shown below. Figure 3 This includes the following steps:
[0040] Recombinant vectors containing crRNA for upstream site knockout, recombinant vectors containing crRNA for downstream site knockout, Cas12i nuclease expression vectors, and FTO The homologous substitution vector was co-transformed into West China bovine cells.
[0041] In this invention, the mass ratio of the recombinant vector containing upstream site knockout crRNA, the recombinant vector containing downstream site knockout crRNA, the Cas12i nuclease expression vector, and the FTO homologous substitution vector is preferably 1~1.5:1~1.5:2~2.5:1~1.5, or can be 1:1:1:1.
[0042] This invention does not impose any particular limitation on the conversion method; conversion methods well known in the art, such as electroconversion, can be used. This invention also does not impose any particular limitation on the parameters of the single conversion; electroconversion conditions well known in the art can be used.
[0043] The present invention does not have any particular limitation on the type of Huaxi bovine cells, and any Huaxi bovine system well known in the art can be used, such as fibroblasts.
[0044] In this invention, the transformation process preferably includes positive screening, somatic cell nuclear transfer, genotyping, and expression analysis to verify the transformed Huaxi bovine cells. The positive screening method is preferably fluorescent protein flow cytometry screening of positive cells and PCR identification to obtain cell clones with successfully replaced promoters. Positive screening involves culturing transfected Huaxi bovine cells in 10% FBS DMEM medium for 48 hours. Somatic cell nuclear transfer involves isolating cells from the successfully replaced promoter cell clones and transferring them into oocytes to activate recombinant embryos, preparing gene-edited Huaxi bovine embryos, and then transferring them into the uterus of a synchronized estrus recipient cow to produce offspring. The offspring are preferably verified using genotyping and expression analysis to verify the expression level of the target gene driven by the MCK promoter.
[0045] This invention provides the reagent for cultivating muscle. FTO Application in the Huaxi cattle breed with upregulated gene expression.
[0046] In this invention, the reagent can effectively improve the muscle tissue of West China cattle. FTO Upregulation of genes has laid the foundation for improving the genetic traits of beef quality in West China.
[0047] The following detailed description, in conjunction with embodiments, illustrates a method for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0048] Reagent source description in the examples:
[0049] Gel Extraction Kit (purchased from Omega Bio-tek), Fast Digest Bsa I (purchased from Fermentas), T4 Ligase (purchased from Fermentas), competent Escherichia coli (purchased from TransGen), plasmid extraction kit (purchased from OMEGA).
[0050] Example 1
[0051] Replace Huaxi Niu with MCK promoter FTO Gene promoter
[0052] (1) Regarding Huaxi cattle FTO Four crRNAs were designed for each of the gene promoter regions (NCBI reference sequence: NC_037346.1, -100 bp to 0 bp and -1400 bp to -1300 bp upstream of the transcription start site). The DNA sequences of the crRNAs are shown in Table 1.
[0053] Table 1. crRNA at the FTO upstream promoter substitution site
[0054]
[0055] Note: The underlined parts are the added enzyme cleavage sites.
[0056] (2) Use Bsa I. Endonuclease pUC19-U6-Cas12i-cr RNA plasmid (see...) Figure 2 The enzyme digestion system is shown in Table 2.
[0057] Table 2 Enzyme digestion system
[0058]
[0059] (3) After reacting at 37°C for 5 hours, the DNA was purified using a DNA purification kit. The purification process was based on the Omega Biotek Gel Extraction Kit.
[0060] (4) Ligation of recovered products: Each crRNA in Table 1 was ligated to the purified linear pUC19-U6-Cas12i-crRNA vector using sticky ends. Ligation system: 1 μL pUC19-U6-Cas12i-crRNA vector, 5 μL 2×solution Ⅰ, 4 μL crRNA. The mixture was incubated at 16℃ for 3 h.
[0061] (5) Transform the above-mentioned or ligation products into competent Escherichia coli cells: Take out competent Escherichia coli cells from the -80℃ freezer, thaw them on ice, add the ligation product to 33 μL of competent cells with a sterile pipette tip, incubate on ice for 30 min, heat shock at 42℃ for 30 s, incubate on ice again for 2 min, then spread the competent bacterial culture on a solid culture medium containing 100 μg / ml ampicillin, and incubate upside down for 12~16 h.
[0062] (6) Screening and sequencing identification of positive clones: Using a sterilized pipette tip, a single clone was picked up from the plate and inoculated into 400 μl of liquid culture medium containing 100 μg / ml ampicillin. The culture was then placed in a shaker at 220 rpm and 37°C for 6 h to expand the culture. The bacterial culture was sent to Beijing Liuhe Huada Genomics Co., Ltd. for sequencing and comparison. The plasmid was extracted from the correctly sequenced positive clones using a plasmid extraction kit. The plasmid was named FTO-pUC19-U6-Cas12i-crRNA.
[0063] (7) Validation of crRNA efficiency: The FTO-pUC19-U6-Cas12i-crRNA plasmid and the pCAG-Cas12i-x12-2AeGFP v4 plasmid (see...) were used to verify the efficiency of crRNA. Figure 1Cells were electroporated into fibroblasts at a 1:1 mass ratio and cultured in DMEM medium containing 10% FBS for 48 h. Green fluorescent cells were sorted by flow cytometry, and the sorted cells were lysed using Lysis cell lysis buffer to extract genomic DNA. Primers targeting the region around the target site were designed for PCR amplification. The purified products were sent to Beijing Liuhe BGI Genomics Co., Ltd. for sequencing and comparison. Efficiency was predicted using the online tool https: / / decodr.org / , and the screening efficiency is shown in [link to efficiency chart]. Figure 4 .
[0064] Depend on Figure 4 It can be seen that the upstream crRNA with higher knockout rate is the F-2-U group (FTO-crRNA-F2 / FTO-crRNA-R2), and the downstream crRNA with higher knockout rate is the F-7-D group (FTO-crRNA-F7 / FTO-crRNA-R7).
[0065] (8) Construction of homologous arm cloning vector: Primers were designed based on the target sites of F-2-U and F-7-D selected above (800 bp upstream and downstream) and the MCK promoter (1354 bp). Primers are shown in Table 3. PCR amplification. FTO upstream homologous arm of gene, FTO The downstream homologous arm of the gene and the MCK promoter fragment were purified by gel extraction and PCR amplification. The amplified fragment is shown below. Figures 5-10 .
[0066] Table 3 FTO Gene recombination fragment primers
[0067]
[0068] Note: The underlined part is pUC57 Hind III enzyme digestion.
[0069] The three amplified sequences were ligated using 2× MultiF Seamless Assembly Mix, and the resulting ligation product (SEQ ID NO:28) was cloned into pUC 57 plasmid. For detailed instructions, refer to the manual. After ligation, the product was named FTO homologous substitution vector.
[0070] (9) Replace FTO homology vector, FTO-pUC19-U6-Cas12i-crRNA F-2-U Plasmid, FTO-pUC19-U6-Cas12i-crRNA F-7-DThe plasmid and pCAG-Cas12i-x12-2AeGFP v4 plasmid were co-electroporated into fibroblasts at a mass ratio of 1:1:1:1 and cultured in DMEM medium containing 10% FBS for 48 h. Green fluorescent cells were sorted by flow cytometry. Figures 11-12 Cells were cultured in 96-well plates. They were passaged every 48 hours and transferred to 24-well plates for sequencing to screen for successfully replaced promoter fibroblast cell lines. These lines were then used as donor cells for nuclear transfer. The transplanted oocytes were then activated into recombinant embryos and transferred to the uterus of a surrogate mother in estrus at the same time for implantation and development, ultimately resulting in the birth of cloned offspring.
[0071] (10) Detect the fibroblast cell lines and muscle cells of the cloned offspring, respectively. FTO Gene expression levels. The specific methods are as follows:
[0072] Total RNA was extracted from the target cell line using the Nanjing Novizan FreeZol Reagent (cat: R711-02) RNA extraction kit. The RNA was then reverse transcribed according to the following procedure:
[0073] Table 4 Reaction System
[0074]
[0075] Table 5 Reaction Procedure:
[0076]
[0077] The product obtained from the reaction can be stored at -20°C and used within six months.
[0078] The cDNA was detected by RT-qPCR. The primers and reaction system are as follows:
[0079] Table 6 Primers for detection
[0080]
[0081] Table 7 Reaction System
[0082]
[0083] Table 8 Reaction Procedure
[0084]
[0085] The relative gene expression levels among different cell lines were obtained by calculating the Ct values obtained from the reaction.
[0086] See results Figure 13 .Depend on Figure 13It can be seen that in wild-type fibroblasts and fibroblast lines with successfully replaced promoters... FTO Gene expression levels were consistent. However, compared to wild-type muscle cells, muscle cells that successfully replaced the promoter... FTO Gene expression levels were significantly increased. This indicates that after the MCK promoter replaced the FTO gene promoter in muscle cells, the MCK promoter specifically activated the gene. FTO The upregulation of gene expression lays the foundation for subsequent genetic engineering modifications of West China cattle.
[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method to enhance bovine muscle cells FTO A gene expression reagent, characterized in that, It includes upstream site knockout crRNA, downstream site knockout crRNA, Cas12i nuclease expression vector, and FTO homologous substitution vector; the FTO homologous substitution vector includes FTO upstream homologous arm of gene promoter, MCK gene promoter and FTO Downstream homologous arm of gene promoter; The nucleotide sequence of the crRNA used for upstream site knockout is shown in SEQ ID NO:23; The nucleotide sequence of the crRNA used for downstream site knockout is shown in SEQ ID NO:24; The FTO The nucleotide sequence of the upstream homologous arm of the gene promoter is shown in SEQ ID NO:25; The FTO The nucleotide sequence of the downstream homologous arm of the gene promoter is shown in SEQ ID NO:26; The nucleotide sequence of the MCK gene promoter is shown in SEQ ID NO:
27.
2. The reagent according to claim 1, characterized in that, The upstream site knockout crRNA or the downstream site knockout crRNA exists in the form of a recombinant vector; The backbone vector of the recombinant vector is the pUC19-U6-Cas12i-crRNA plasmid.
3. The reagent according to claim 1 or 2, characterized in that, The Cas12i nuclease expression vector also includes a fluorescent reporter gene.
4. The reagent according to any one of claims 1 to 3 in West China bovine cells FTO Application in gene promoter replacement, wherein the Huaxi bovine cells are muscle cells.
5. A method for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene, characterized in that, Includes the following steps: Recombinant vectors containing crRNA for upstream site knockout, recombinant vectors containing crRNA for downstream site knockout, Cas12i nuclease expression vectors, and FTO Homologous substitution vectors were co-transformed into West China bovine cells; The nucleotide sequence of the crRNA used for upstream site knockout is shown in SEQ ID NO:23; The nucleotide sequence of the crRNA used for downstream site knockout is shown in SEQ ID NO:24; The FTO homologous substitution vector includes FTO upstream homologous arm of gene promoter, MCK gene promoter and FTO Downstream homologous arm of gene promoter; The FTO The nucleotide sequence of the upstream homologous arm of the gene promoter is shown in SEQ ID NO:25; The FTO The nucleotide sequence of the downstream homologous arm of the gene promoter is shown in SEQ ID NO:26; The nucleotide sequence of the MCK gene promoter is shown in SEQ ID NO:
27.
6. The method according to claim 5, characterized in that, The mass ratio of the recombinant vector containing upstream site knockout crRNA, the recombinant vector containing downstream site knockout crRNA, the Cas12i nuclease expression vector, and the FTO homologous substitution vector is 1:1:1:
1.
7. The reagent according to any one of claims 1 to 3 in the culture of muscle cells FTO Application in the Huaxi cattle breed with upregulated gene expression.
Citation Information
Patent Citations
Cattle FTO gene promoter mutation site and application thereof
CN119842717A
Engineered muscle targeting compositions
US20220243226A1