Application of SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 9 and related to nitrogen apparent digestibility

By identifying and selecting the SNP molecular marker rs337541051 on pig chromosome 9, the problem of low efficiency in improving apparent nitrogen digestibility in pigs has been solved, enabling rapid genetic improvement and environmentally friendly farming.

CN121344206APending Publication Date: 2026-01-16SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511437073.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-09
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Existing technologies are insufficient to efficiently improve the apparent nitrogen digestibility of pigs, resulting in high breeding costs and severe environmental pollution. Traditional breeding methods are inefficient and time-consuming.

Method used

The SNP molecular marker rs337541051 located on chromosome 9 of pigs is provided for the identification and selection of nitrogen apparent digestibility traits. By detecting pigs with the genotype CC of this SNP molecular marker, genetic improvement can be carried out to improve nitrogen apparent digestibility.

Benefits of technology

It has accelerated the genetic improvement process of pigs, improved the apparent digestibility of nitrogen, reduced feed costs, reduced nitrogen emissions, and enhanced economic benefits and environmental protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344206A_ABST
    Figure CN121344206A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP molecular marker located on a pig chromosome 9 and related to nitrogen apparent digestibility and application of the SNP molecular marker, the site of the SNP molecular marker is rs337541051 and corresponds to the 133972770bp site on a chromosome 9 of an international pig reference genome version 11.1, and Cgt exists at the site; t mutation. The SNP molecular marker provided by the invention is remarkably related to the nitrogen apparent digestibility character of the pig, the identification of the nitrogen apparent digestibility character of the pig can be realized by identifying the genotype of the SNP molecular marker, and the identification of the nitrogen apparent digestibility character of the pig can be realized by breeding the pig with the genotype of the SNP molecular marker CC. The nitrogen apparent digestibility of offspring can be improved, and the protein digestion and utilization capability and feed conversion efficiency of the offspring can be improved, so that the breeding process of pigs is accelerated, and genetic improvement of the pigs is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding technology and relates to the application of SNP molecular markers located on chromosome 9 of pigs that are associated with apparent nitrogen digestibility. Background Technology

[0002] Protein is one of the most expensive nutrients in animal feed, and its efficient utilization is crucial for animal growth, production performance, and reproductive capacity. Providing sufficient and high-quality protein in feed is key to ensuring animal health, growth, production performance, and reproductive capacity. However, there are differences in protein digestibility and utilization among individuals. Through genetic selection, individuals with strong protein digestibility and utilization can be selected and retained, thereby improving the overall nutrient utilization efficiency of the pig herd and reducing the expensive feed costs in the breeding process. At the same time, nitrogen excretion is also an environmental problem that the livestock industry urgently needs to address. Pigs retain only about 30% of the ingested nitrogen, with the majority being excreted in excrement, where it is transformed by microorganisms into nitrogen oxides, nitrates, and other forms that pollute the atmosphere and water bodies. Therefore, improving the apparent nitrogen digestibility of pigs not only helps reduce production costs but also has important significance for achieving green farming. The determination of apparent nitrogen digestibility is time-consuming and labor-intensive, and this trait is regulated by multiple genes, making it a complex quantitative trait. Furthermore, it can usually only be measured after pigs have reached a certain age. Therefore, relying on traditional breeding methods to improve this quantitative trait often results in problems such as long cycles, low efficiency, and limited effects. Summary of the Invention

[0003] The purpose of this invention is to provide a SNP molecular marker located on pig chromosome 9 that is associated with apparent nitrogen digestibility in pigs and its application.

[0004] According to one aspect of the present invention, a SNP molecular marker associated with apparent nitrogen digestibility located on pig chromosome 9 is provided at the site rs337541051, corresponding to position 133972770 bp on chromosome 9 in International Pig Reference Genome Version 11.1. This site contains a C>T mutation, the nucleotide type of which is C or T, and the genotype of the SNP molecular marker is CC, CT, or TT.

[0005] The SNP molecular marker provided by this invention is significantly correlated with the apparent nitrogen digestibility trait in pigs, mainly reflected in the following: pigs with genotype CC or genotype CT have a higher apparent nitrogen digestibility than pigs with genotype TT, and pigs with genotype CC have a higher apparent nitrogen digestibility than pigs with genotype CT. Higher apparent nitrogen digestibility means that pigs can absorb nutrients from feed more efficiently, thus achieving better growth performance and economic benefits. By detecting this SNP molecular marker, specifically by detecting the single nucleotide polymorphism and / or genotype of rs337541051, the apparent nitrogen digestibility trait in pigs can be identified. Furthermore, by selecting pigs with the CC genotype of the SNP molecular marker, the breeding process can be accelerated, achieving genetic improvement in pigs.

[0006] Therefore, the SNP molecular markers related to apparent nitrogen digestibility on pig chromosome 9 provided by this invention can be applied to: (1) Identify the apparent nitrogen digestibility trait in pigs; (2) Prepare products for identifying the apparent nitrogen digestibility traits of pigs; (3) Pig genetic improvement: Based on the selection of pigs with the SNP molecular marker genotype CC to improve the apparent nitrogen digestibility of pigs, thus achieving pig genetic improvement; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0007] The apparent nitrogen digestibility of pigs is a direct or indirect reflection of productive traits such as nitrogen deposition level and nitrogen metabolism efficiency. Higher apparent nitrogen digestibility indicates stronger nitrogen deposition and higher nitrogen metabolism efficiency. Therefore, identifying the apparent nitrogen digestibility trait in pigs can help identify / evaluate nitrogen deposition level and nitrogen metabolism efficiency. Consequently, the SNP molecular markers related to apparent nitrogen digestibility in pigs provided by this invention can also be used to assist in evaluating nitrogen deposition level and / or nitrogen metabolism efficiency in pigs, as well as in preparing products that assist in evaluating nitrogen deposition level and / or nitrogen metabolism efficiency in pigs.

[0008] According to another aspect of the invention, there is an application for detecting SNP molecular markers located on porcine chromosome 9 that are associated with apparent nitrogen digestibility, the application comprising at least one of the following (1) to (8): (1) Identify the apparent nitrogen digestibility trait in pigs; (2) Prepare products for identifying the apparent nitrogen digestibility traits of pigs; (3) To assist in the evaluation of nitrogen deposition levels in pigs, the nitrogen deposition levels in pigs are evaluated based on the identification of apparent nitrogen digestibility traits. (4) Prepare a product to assist in evaluating the nitrogen deposition level in pigs. This product is based on identifying the apparent nitrogen digestibility trait of pigs to assist in evaluating the nitrogen deposition level in pigs. (5) To assist in the evaluation of nitrogen metabolism efficiency in pigs, and to achieve the auxiliary evaluation of nitrogen metabolism efficiency in pigs based on the identification of apparent nitrogen digestibility traits; (6) Prepare a product to assist in evaluating the nitrogen metabolism efficiency of pigs. This product is based on identifying the apparent nitrogen digestibility trait of pigs to assist in evaluating the nitrogen metabolism efficiency of pigs. (7) Pig genetic improvement, based on the selection of pigs with SNP molecular marker genotype CC to improve the apparent nitrogen digestibility of pigs; (8) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0009] In some embodiments, products for detecting SNP molecular markers associated with apparent nitrogen digestibility located on porcine chromosome 9 may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers associated with apparent nitrogen digestibility located on porcine chromosome 9.

[0010] In some embodiments, the reagents for detecting SNP molecular markers associated with apparent nitrogen digestibility located on pig chromosome 9 may include at least one of the following: primers or probes for detecting SNP molecular markers associated with apparent nitrogen digestibility located on pig chromosome 9.

[0011] In some embodiments, the primers used to detect SNP molecular markers associated with apparent nitrogen digestibility on pig chromosome 9 include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify an amplified fragment containing the single nucleotide polymorphism at position 92 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to identify whether the single nucleotide at position 92 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1 is T or C.

[0012] In some embodiments, the kit for detecting SNP molecular markers associated with apparent nitrogen digestibility located on porcine chromosome 9 may include: primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0013] In some implementations, the apparent nitrogen digestibility trait is the apparent nitrogen digestibility of pigs at approximately 140 days of age.

[0014] In some implementations, the pigs are preferably American Duroc strains or their synthetic lines.

[0015] According to another aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular marker located on chromosome 9 of pigs, which is associated with apparent nitrogen digestibility, at locus rs337541051; (2) Select individuals with the SNP molecular marker genotype CC and eliminate individuals with the genotypes TT and CT, and increase the frequency of the allele C at this locus generation by generation; thereby improving the apparent nitrogen digestibility of the offspring and the feed conversion efficiency of the offspring.

[0016] In some embodiments, step (1), determining the genotype of the SNP molecular markers on chromosome 9 of pigs that are associated with apparent nitrogen digestibility, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the genotypes of SNP molecular markers related to apparent nitrogen digestibility located on pig chromosome 9 were determined based on the sequencing results.

[0017] In some implementations, the pigs are American Duroc breeds and their synthetic lines. The Duroc × Landrace × Large White (Duroc × Landrace × Large White) crossbreed is currently the most widely used three-way crossbred commercial pig breed. Duroc pigs are often used as the terminal sire, directly determining the production performance of commercial pigs, which is closely related to the economic benefits of the farm. By genetically modifying the apparent nitrogen digestibility of the core Duroc herd, the nitrogen use efficiency and overall production performance of their offspring commercial pigs can be effectively improved, thereby enhancing their market competitiveness and promoting the economic benefits of the farm.

[0018] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides a SNP molecular marker located on the nucleotide sequence of pig chromosome 9 that is related to the apparent nitrogen digestibility of pigs. The SNP molecular marker is located at rs337541051. Its effect on the apparent nitrogen digestibility trait of pigs has been verified. This invention helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the apparent nitrogen digestibility trait of pigs and improve the breeding process of Duroc and its synthetic lines.

[0019] (2) This invention provides a method for genetic improvement of pigs by selecting the dominant alleles of SNP molecular markers related to the apparent nitrogen digestibility of pigs. This method can accelerate the genetic progress of Duroc pigs, shorten the Duroc improvement time, and thus effectively improve the economic benefits of breeding pigs. Specifically, if all individuals with the TT and CT genotypes of SNP molecular markers that affect the apparent nitrogen digestibility of pigs are selected and bred into CC genotype individuals, the apparent nitrogen digestibility of each pig can be increased by 0.0212. Increasing the apparent nitrogen digestibility can reduce feed costs, improve feed conversion efficiency, and improve the economic benefits of commercial pigs. At the same time, it can reduce the emission of nitrogen from pig manure and reduce the pollution of the environment caused by breeding. Attached Figure Description

[0020] Figure 1 This is a genome-wide association (GWAS) diagram of apparent nitrogen digestibility in American Duroc pigs on chromosome 9 at approximately 140 days of age. Figure 2 This is a graph showing the apparent nitrogen digestibility of pigs with different genotypes. One-way ANOVA was used to test the significance of differences in apparent nitrogen digestibility among different genotypes. When the ANOVA results showed a significant difference (…),… P <0.05, further post-hoc multiple comparisons were performed using Duncan's test; different lowercase letters above the data points in the graph indicate the... P Differences at the <0.05 level are statistically significant, while differences between different genotypes sharing the same letter are not significant. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0022] Example 1: Identification and Validation of SNP Loci Related to Apparent Nitrogen Digestibility in Pigs (1) Experimental pig herd The experimental pig herd used in this invention consisted of purebred American Duroc pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., representing the core herd of the company, with detailed pedigree records. A total of 784 American Duroc pigs from this resource group were selected for this experiment. The pigs were raised under standardized feeding conditions, with free access to feed and water, until approximately 140 days of age.

[0023] (2) Phenotypic measurement In this invention, the phenotypic determination of apparent nitrogen digestibility in pigs employs the endogenous indicator method (acid-insoluble ash method). Fecal samples from pigs are collected over 2-3 days and treated with nitrogen fixation by adding 10% hydrochloric acid solution at a ratio of 25 mL / kg. Feed samples from the corresponding pig herd are also collected. The fecal samples are mixed in equal proportions and then dried, ground, and sieved. The feed samples are ground and sieved, and their dry matter (GB / T 6435-2014), acid-insoluble ash (GB / T23742-2009), and crude protein content (GB / T 6432-2018) are determined according to national standards.

[0024] The formula for calculating apparent nitrogen digestibility is as follows: Apparent nitrogen digestibility (%) = 100% - (A1 / A2 × F2 / F1) × 100% In the formula: A1 is the acid-insoluble ash content (%) in the feed sample; A2 is the acid-insoluble ash content (%) in the fecal sample; F1 is the nitrogen content (%) in the feed sample; F2 is the nitrogen content (%) in the fecal sample.

[0025] (3) Extraction of porcine genomic DNA After sampling the ears of American Duroc pigs, whole-genome DNA was extracted using the standard phenol-chloroform method. The DNA from the American Duroc population was then subjected to quality testing and concentration determination using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. For DNA samples that passed quality control, the DNA concentration was determined using a Matrix Arrayer instrument, and the concentration of all samples was normalized to 20 ng / μL.

[0026] (4) Detection of 50K SNP genotypes in the whole pig genome Genotyping was performed using the PorcineWENS 55K chip independently developed by Wens Foodstuff Group. The scan data after discharging were genotyped using the Axiom best practices workflow (referencing the SNPolisher™ Package User Guide). Furthermore, PLINK v1.9 was used to rigorously quality control the obtained genotypic data, removing data with a deletion rate higher than 10%, a minor allelic frequency (MAF) lower than 1%, or deviations from the Hardy-Weinberg Equilibrium (HWE) test. P Value less than 1×10 -6The SNPs were identified by excluding those located at unknown sites, on sex chromosomes, and those with a missing data rate higher than 10%. Ultimately, valid genotype data for 46,053 SNPs were obtained.

[0027] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis is then performed using GCTA software, with the first five principal components used as covariates to correct for population structure. Individual sex and age are also considered. Finally, GWAS analysis is performed using a univariate mixture model in GCTA software. This invention uses the Bonferroni method to correct the results and determine the significance thresholds at the whole-genome and chromosome levels. The significance threshold at the whole-genome level is 0.05 / N; the significance threshold at the chromosome level is 1 / N. N represents the number of SNPs after quality control. The final significance thresholds for the genome and chromosome levels are set to 1.08E-06 (0.05 / 46053) and 2.17E-05 (1 / 46053), respectively.

[0028] GWAS analysis results are as follows Figure 1 As shown.

[0029] from Figure 1 It is known that there is a SNP site on Duroc pig chromosome 9 that significantly affects apparent nitrogen digestibility, with the strongest association being g.133972770 C>T ( P = 6.29×10 -6 That is, the 92nd nucleotide from the 5' end in SEQ ID NO.1, which corresponds to the C>T mutation at 133972770bp on chromosome 9 in International Pig Reference Genome Version 11.1.

[0030] (6) Analyze the association between different genotypes and the apparent nitrogen digestibility phenotype of breeding pigs at approximately 140 days of age to verify the influence of SNP loci on the apparent nitrogen digestibility trait in pigs. The results are shown in Table 1. Figure 2 As shown, the SNP site g.133972770 C>T of the molecular marker was highly significantly correlated with the apparent nitrogen digestibility trait. PThe value <0.001 indicates that this molecular marker significantly affects the apparent nitrogen digestibility of pigs. Specifically, pigs with genotypes CC or CT had higher apparent nitrogen digestibility than those with genotype TT, and pigs with genotype CC had higher apparent nitrogen digestibility than those with genotype CT. This suggests that homozygous TT is detrimental to the apparent nitrogen digestibility of breeding pigs. Apparent nitrogen digestibility is an important indicator of nutrient digestibility and utilization in breeding pigs; a higher apparent nitrogen digestibility indicates better nutrient digestibility and utilization. Therefore, during breeding, it is necessary to gradually cull TT and CT genotype pigs while retaining CC genotype pigs to increase the frequency of the C allele at this locus through successive generations.

[0031] Table 1. Correlation analysis between SNP site g.133972770 C>T and traits.

[0032] (7) Effect analysis This invention provides a SNP molecular marker significantly associated with the apparent nitrogen digestibility trait in Duroc pigs. Using this SNP molecular marker for marker-assisted selection can accelerate the breeding process for improved apparent nitrogen digestibility in Duroc pigs. If all TT-type individuals with the molecular marker affecting apparent nitrogen digestibility are selected to become CC-type individuals, the apparent nitrogen digestibility per pig can increase by 0.0212 at approximately 140 days of age. Since apparent nitrogen digestibility has a favorable positive correlation with feed conversion efficiency, improving apparent nitrogen digestibility during breeding can effectively enhance feed utilization efficiency, reduce nitrogen emissions, and thus lower the risk of environmental pollution. This improvement not only brings higher economic benefits to pig breeding enterprises but also aligns with the needs of green and sustainable development in the livestock industry, demonstrating the enormous potential of apparent nitrogen digestibility in industrial applications. The SNP molecular marker provided by this invention, through the selection of the dominant allele (C) in American Duroc pigs, can effectively improve the production performance of commercial pigs, enhance the economic benefits of farming, and to a certain extent reduce the environmental impact of nitrogen emissions.

[0033] Example 2: Methods for genetic improvement of pigs The target fragment containing SNP loci significantly associated with the apparent nitrogen digestibility trait of the American Duroc strain is a 162 bp nucleotide sequence from chromosome 9, the specific sequence of which is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0034] SEQ ID NO:1 AATTTTCCTCAGGAAGCCATATTATTATATGATCAACGAAAATATTGTTATCTAAGTTCAATTGCTAGTTACGTTTTATTTTTACATGACAG Y TTTCCAATGTGAACATAAACTATGTATATTTTAATGTATTACTTAACTTTTTCACCAAGTCCATAAAATT The Y marked in the sequence is the mutation site, which is C or T, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0035] Upstream primer-F: 5'-AATTTTCCTCAGGAAGCCA-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-AATTTTATGGACTTGGTGAA-3' (SEQ ID NO:3).

[0036] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of SNP molecular markers associated with apparent nitrogen digestibility in pigs. (1) Samples were taken from the ears of pigs, and whole genome DNA of pigs was extracted according to the standard phenol-chloroform method. Then the extracted DNA was subjected to quality testing and concentration determination.

[0037] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0038] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0039] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were measured in both forward and reverse reactions. Based on the sequencing results, the genotype of the pig SNP site g.133972770 C>T was determined.

[0040] S2. Select pigs with the SNP locus genotype CC as parents for breeding, and increase the frequency of the allele C at this locus generation by generation.

[0041] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. Use of a product for detecting a SNP molecular marker associated with nitrogen apparent digestibility located on pig chromosome 9, characterized in that, The SNP molecular marker is rs337541051, and the application includes at least one of the following (1)-(8): (1) identifying the nitrogen apparent digestibility trait of a pig; (2) preparing a product for identifying the nitrogen apparent digestibility trait of a pig; (3) assisting in evaluating the nitrogen deposition level of a pig, and achieving the assisted evaluation of the nitrogen deposition level of a pig based on the identified nitrogen apparent digestibility trait of a pig; (4) preparing a product for assisting in evaluating the nitrogen deposition level of a pig, and achieving the assisted evaluation of the nitrogen deposition level of a pig based on the identified nitrogen apparent digestibility trait of a pig; (5) assisting in evaluating the nitrogen metabolic efficiency of a pig, and achieving the assisted evaluation of the nitrogen metabolic efficiency of a pig based on the identified nitrogen apparent digestibility trait of a pig; (6) preparing a product for assisting in evaluating the nitrogen metabolic efficiency of a pig, and achieving the assisted evaluation of the nitrogen metabolic efficiency of a pig based on the identified nitrogen apparent digestibility trait of a pig; (7) pig genetic improvement, and selecting pigs with the SNP molecular marker genotype CC to improve the nitrogen apparent digestibility of pigs; (8) preparing a product for assisting in pig genetic improvement, and achieving the assisted pig genetic improvement based on the identified genotype of the SNP molecular marker.

2. Use according to claim 1, characterized in that, The product for detecting the SNP molecular marker related to the nitrogen apparent digestibility on pig chromosome 9 includes at least one of the following: reagents, kits, chips and devices for detecting the SNP molecular marker.

3. Use according to claim 2, characterized in that, The reagents for detecting the SNP molecular marker include at least one of the following: primers and probes for detecting the SNP molecular marker.

4. Use according to claim 3, characterized in that, The primers for detecting the SNP molecular marker include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The use according to any one of claims 1 to 4, characterized in that, The nitrogen apparent digestibility trait is the nitrogen apparent digestibility of a pig at about 140 days of age.

6. Use according to claim 5, characterized in that, The pig is a Duroc of the American line and its synthetic line.

7. A method for genetic improvement of pigs, characterized by, The method includes the following steps: (1) determining the genotype of a pig at the SNP molecular marker related to the nitrogen apparent digestibility on pig chromosome 9; (2) selecting individuals with the SNP molecular marker genotype CC and eliminating individuals with the genotypes TT and CT; The SNP molecular marker is rs337541051.

8. The method of genetic improvement of swine according to claim 7, wherein, In step (1), the method for determining the genotype of a pig at the SNP molecular marker related to the nitrogen apparent digestibility on pig chromosome 9 includes the following steps: Extracting the whole genome DNA of a pig, performing PCR amplification using a primer pair with the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3, sequencing the amplification product, and determining the genotype of a pig at the SNP molecular marker related to the nitrogen apparent digestibility on pig chromosome 9 based on the sequencing results.

9. The method of genetic improvement of pigs according to claim 7 or 8, characterized in that, The pig is a Duroc of the American line and its synthetic line.