KASP marker closely linked with wheat scab resistance gene and application of KASP marker

Abstract

The invention discloses a KASP marker closely linked with a wheat scab resistance gene and application of the KASP marker, and belongs to the technical field of wheat molecular breeding. Two new gibberellic disease resistant sites are identified, CCCACCG / GCACAT nucleotide polymorphisms exist at the two sites, based on the gibberellic disease resistant sites, the KASP marker closely linked with the wheat gibberellic disease resistant gene is developed, different genotypes of wheat can be distinguished through PCR amplification and fluorescence signal detection, the molecular breeding efficiency is greatly improved, and the application prospect is wide. And a new germplasm material is provided for cultivation of a new disease-resistant variety of wheat.

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, specifically to a KASP marker closely linked to wheat scab resistance genes and its application. Background Technology

[0002] Fusarium head blight, often called "wheat cancer," causes wheat ears to rot, eventually resulting in half of the wheat ear drying out, producing shriveled, whitish grains. It is caused by various Fusarium fungi, a fungal disease primarily affecting wheat, including: *Fusarium graminearum*, *Fusarium graminearum*, *Fusarium equisetifolium*, *Fusarium nobilis*, *Fusarium pyrifolium*, and *Fusarium oxysporum*. *Fusarium graminearum* can live on living plants or as a saprophytic organism on plant debris in the field. The life cycle of Fusarium fungi has two stages: sexual reproduction and asexual reproduction. Sexual reproduction produces basidiospores, while asexual reproduction produces conidia. These spores can be spread by wind, water, and insects. Conidia are the primary mode of transmission and infection for Fusarium wilt fungi. Therefore, wheat is infected with Fusarium head blight through several routes: spores falling onto wheat leaves with rainwater infect the leaves; water containing the pathogen is used when irrigating wheat; and insects spreading the pathogen to the leaves while feeding on wheat sap. Fusarium head blight occurs during the wheat flowering period, and rainy weather at this time accelerates the spread of the pathogen, making it a typical climate-dependent disease.

[0003] One method for resisting wheat scab is disease-resistant breeding, and the discovery and screening of resistance genes are extremely important for this process. With the development of molecular marker technology and the deepening of wheat genomics research, at least 100 scab resistance genes have been reported to date, distributed across all wheat chromosomes. However, very few of these resistance genes have been formally named, which greatly limits the progress of marker-assisted breeding and the application of map-based cloning of resistance genes. Continuously searching for molecular markers closely linked to or co-segregating with superior scab resistance genes is of great significance for improving the progress and selection efficiency of disease-resistant breeding. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a KASP marker closely linked to wheat scab resistance genes and its application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a polynucleotide fragment associated with resistance to wheat scab, the nucleotide sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.2; specifically as follows: SEQ ID NO.1: AGTCGGCAGGGACATGCACATGCAGCTGCTCATCCCGCTGTCCGAGATTTGCGCATCACCAGAGCTCGCAGACTACCCACGCGCCCGCTTCAACAACAACGTTGA.

[0006] SEQ ID NO.2: AGTCGGCAGGGACATCCCACGGCAGCTGCTCATCCCGCTGTCCGAGATTTGCGCATCACCAGAGCTCGCAGACTACCCACGCGCCCGCTTCAACAACAACGTTGA.

[0007] In the above sequence, the nucleotides in the bold shaded area represent polymorphic regions related to the resistance gene.

[0008] The inventors discovered that the St and H chromosomes of the *Agropyron cristatum* genome carry genes for wheat resistance to Fusarium head blight. Fhb7 homologous genes Fhb7 RkaSt , Fhb7 RkaH Both showed good resistance to Fusarium head blight, and the aggregation of these two genes produced a significant dose-response effect. The polynucleotide fragment shown in SEQ ID NO.1 is related to the resistance gene. Fhb7 RkaSt Related; the polynucleotide fragment shown in SEQ ID NO.2 is associated with the resistance gene. Fhb7 RkaH Related.

[0009] In a second aspect, the invention provides the use of the aforementioned polynucleotide fragment in identifying or assisting in the identification of plant resistance to wheat scab.

[0010] A third aspect of the invention provides the use of a substance for detecting the aforementioned polynucleotide fragment or a substance for detecting that the 16th-21st bases of the aforementioned polynucleotide fragment are CCCACG or GCACAT in any of the following: (1) To identify or assist in the identification of plant resistance to wheat scab; (2) Breeding for wheat scab resistance genes; (3) Select wheat varieties resistant to Fusarium head blight.

[0011] In the above applications, the substance is a set of primers or a reagent or kit containing the set of primers.

[0012] In some preferred embodiments of the present invention, the substance used to detect the above-mentioned polynucleotide fragment is a sequencing primer; the substance used to detect that the 16th-21st bases of the above-mentioned polynucleotide fragment are CCCACG or GCACAT is a typing primer, such as the KASP typing primer.

[0013] In a fourth aspect, the present invention provides a KASP marker closely linked to a wheat scab resistance gene, named Kasp- Fhb7 The markers include the primers shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, as detailed below: Kasp- Fhb7 RkaH -F (Add HEX signal sequence): 5'-GAAGGTCGGAGTCAACGGATTTCGGCAGGGACATCCCACG-3'; (SEQ ID NO.3) Kasp- Fhb7 RkaSt -F (Add FAM signal sequence): 5'- GAAGGTGACCAAGTTCATGCTTCGGCAGGGACATGCACAT-3'; (SEQ ID NO.4) Kasp- Fhb7 -R: 5'- TGTTGAAGCGGGCGTAGTCT -3'. (SEQ ID NO.5) Of the primers mentioned above, Kasp- Fhb7 RkaH -F and Kasp- Fhb7 RkaSt -F is the upstream typing primer, Kasp- Fhb7 -R is a downstream universal primer.

[0014] A fifth aspect of the invention provides the application of the above-described KASP mark in any one of (1)-(3): (1) To identify or assist in the identification of plant resistance to wheat scab; (2) Breeding for wheat scab resistance genes; (3) Select wheat varieties resistant to Fusarium head blight.

[0015] A sixth aspect of the present invention provides a method for identifying or assisting in the identification of wheat resistance to Fusarium head blight, comprising the following steps: Using genomic DNA from the wheat sample as a template, PCR amplification was performed using KASP markers, and the fluorescence signal of the amplification product was detected. If a FAM fluorescence signal was detected, it indicates that the wheat sample contains a resistance gene. Fhb7 RkaSt The phenotype is resistance to Fusarium head blight; if a HEX fluorescence signal is detected, it indicates that the tested wheat contains a resistance gene. Fhb7 RkaH The phenotype is resistance to Fusarium head blight; if both FAM and HEX fluorescent signals are detected, it indicates that the tested wheat contains a resistance gene. Fhb7 RkaSt and resistance genes Fhb7 RkaH The polymer exhibits a phenotype resistant to Fusarium head blight.

[0016] Furthermore, the PCR reaction system was as follows: 1 μL DNA template, 5 μL 2×Taq Master Mix, 0.15 μL each of the primers shown in SEQ ID NO.3 and SEQ ID NO.4, 0.4 μL of the primer shown in SEQ ID NO.5, and double-distilled water to a final volume of 10 μL.

[0017] The PCR reaction conditions were: 95℃ for 10 min; 95℃ for 20 s, 67-57℃ for 1 min, with a decrease of 0.8℃ per cycle, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 30 cycles.

[0018] The beneficial effects of this invention are: (1) This invention identifies two novel resistance loci to Fusarium head blight, at which CCCACG / GCACAT nucleotide polymorphisms exist. Based on these two resistance loci, this invention develops polynucleotide fragments associated with wheat resistance to Fusarium head blight. Using these polynucleotide fragments, wheat genotypes can be distinguished. This is particularly important for variety improvement work, especially in selective breeding, to ensure the accurate transmission of superior genes.

[0019] (2) The present invention also developed and designed two KASP markers that are closely linked to the Fusarium head blight resistance gene, which enabled the simple operation of predicting phenotype through genotype. Individuals carrying the resistance gene can be efficiently screened by PCR amplification and fluorescence signal detection, which greatly improves the efficiency of molecular breeding and provides new germplasm materials for the breeding of disease-resistant wheat varieties. Attached Figure Description

[0020] Figure 1 KASP tag Kasp- Fhb7 Genotyping results in transgenic wheat; the X-axis represents the FAM signal, with blue indicating the GCACAT genotype, meaning the tested wheat contains the resistance gene. Fhb7RkaSt The Y-axis represents the HEX signal, with red indicating the CCCACG genotype, meaning the wheat being tested contains the resistance gene. Fhb7 RkaH The green dot in the middle represents the presence of these two genes in the wheat sample being tested.

[0021] Figure 2 Results of phenotypic identification of transgenic wheat and Fielder wheat against Fusarium head blight; T3- Fhb7 RkaH Contains resistance genes Fhb7 RkaH Genetically modified wheat; T3- Fhb7 RkaSt Contains resistance genes Fhb7 RkaSt Genetically modified wheat; F3- Fhb7 RkaH + Fhb7 RkaSt It contains a polymer of resistance genes. Fhb7 RkaH and Fhb7 RkaSt Wheat. Detailed Implementation

[0022] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0023] As mentioned earlier, the discovery and screening of resistance genes are extremely important for disease-resistant breeding. Currently, the number of reported Fusarium head blight resistance genes is small, and most of these genes have not been cloned or molecularly marked, which seriously hinders the application of resistance genes in the control of wheat Fusarium head blight.

[0024] Fhb7 Decapodiploid wheatgrass (from wheat's close relative, *Leymus chinensis*) T. ponticum Chromosome 7E of the decaploid long-spike wheatgrass 7el2 substitution line for wheat 7D was identified as highly resistant to Fusarium head blight. The gene was initially mapped to the long arm of 7el2 and named Fhblop (Kim et al., 1997). Later studies renamed the Fhblop gene to Fhb7 and created a RIL population from a hybrid of resistant and susceptible substitution lines. By constructing a genetic linkage map, the gene was mapped to... XsdauK66 ~ Xcfa2240 The genetic distance between them is 1.7 cM; currently Fhb7It has been successfully cloned, and its effects not only improve resistance to the spread of Fusarium head blight but also effectively inhibit the growth of Fusarium head blight fungi. Furthermore, the glutathione-S-transferase encoded by DON toxin specifically binds to it, which can effectively reduce the toxicity of DON.

[0025] The inventors discovered that the St and H chromosomes of the *Agropyron cristatum* genome carry genes for wheat resistance to Fusarium head blight. Fhb7 homologous genes Fhb7 RkaSt , Fhb7 RkaH Both showed good resistance to Fusarium head blight, and the aggregation of these two genes produced a significant dose-response effect.

[0026] To better utilize resistance genes Fhb7 RkaSt and Fhb7 RkaH This invention identifies two novel Fusarium head blight resistance loci and, based on these loci, develops two polynucleotide fragments associated with wheat Fusarium head blight resistance, with nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. Specifically, the polynucleotide fragment shown in SEQ ID NO.1 corresponds to the resistance gene. Fhb7 RkaSt Related; the polynucleotide fragment shown in SEQ ID NO.2 is associated with the resistance gene. Fhb7 RkaH Related. The region between positions 16 and 21 of the polynucleotide fragment is the site of resistance to Fusarium head blight.

[0027] Furthermore, this invention has developed and designed two Kasp markers closely linked to the Fusarium head blight resistance gene, which can detect the genotype of wheat materials at the Fusarium head blight resistance locus. By detecting the genotype at this locus, the Fusarium head blight resistance phenotype can be predicted, thereby efficiently screening individuals carrying the novel Fusarium head blight resistance gene in wheat and accelerating the breeding process. This invention is thus proposed.

[0028] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0029] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0030] Example 1: Development of KASP markers closely linked to wheat scab resistance genes The seventh homologous group chromosomes of the St and H genomes of *Agrostis spp.* carry wheat scab resistance genes.Fhb7 homologous genes Fhb7 RkaSt , Fhb7 RkaH Both showed good resistance to Fusarium head blight, and the aggregation of these two genes produced a significant dose-response effect.

[0031] To better utilize this disease-resistant gene, the homologous gene was sequenced in this invention. Fhb7 RkaSt The nucleotide sequence is shown in SEQ ID NO. 6; homologous genes Fhb7 RkaH The nucleotide sequence is shown in SEQ ID NO.7. The sequencing results are compared with... Fhb7 The gene sequences were compared. The results identified two new resistance loci (CCCACG or GCACAT).

[0032] Two polynucleotide fragments related to wheat scab resistance were designed based on this scab resistance locus, and their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. Specifically, the polynucleotide fragment shown in SEQ ID NO.1 corresponds to the resistance gene. Fhb7 RkaSt Related; the polynucleotide fragment shown in SEQ ID NO.2 is associated with the resistance gene. Fhb7 RkaH Related. The region from position 16 to 21 of the polynucleotide fragment is the site of resistance to Fusarium head blight. Fhb7 RkaSt The base at the corresponding position in the sequence is GCACAT. Fhb7 RkaH The corresponding bases are CCCACG.

[0033] To effectively detect wheat scab resistance loci, this invention further developed and designed a KASP marker closely linked to wheat scab resistance genes, named Kasp- Fhb7 Mark; specifically: Kasp- Fhb7 RkaH -F (Add HEX signal sequence): 5'-GAAGGTCGGAGTCAACGGATTTCGGCAGGGACATCCCACG-3'; (SEQ ID NO.3) Kasp- Fhb7 RkaSt -F (Add FAM signal sequence): 5'- GAAGGTGACCAAGTTCATGCTTCGGCAGGGACATGCACAT-3'; (SEQ ID NO.4) Kasp- Fhb7 -R: 5'- TGTTGAAGCGGGCGTAGTCT -3'. (SEQ ID NO.5) Example 2: Genotypic and phenotypic identification of transgenic plants against Fusarium head blight 1. Construction of transgenic materials: Two wheat scab resistance genes carried on chromosomes of the seventh homologous group of the St and H genomes of *Cephalotaxus fortunei* were identified. Fhb7 The homologous gene was transferred into wheat, and in March 2024, at the National Key Laboratory of Wheat Breeding of Shandong Agricultural University, it was used to carry out additional generations in an artificial climate chamber to produce a resistance gene. Fhb7 RkaH Wheat was used as the male parent to carry the resistance gene. Fhb7 RkaSt Wheat was used as the female parent to produce the F1 generation, and then self-crossed to the F3 generation.

[0034] 2. Genotyping: Genotyping of transgenic wheat materials was performed using the Kasp marker from Example 1, and the specific steps are as follows: (1) Genomic DNA was extracted from the samples using the CTAB method; Wheat leaves, 2.0-3.0 cm long, were cut and placed in 2 mL centrifuge tubes (containing two small steel balls). After liquid nitrogen freezing, the leaves were rapidly ground into powder (using a plant cell disruptor set to 41 Hz frequency and 40 sec time). 800 μL of CTAB extraction buffer (preheated to 65°C in a water bath) was added, and the mixture was incubated at 65°C for 30 min. Then, an equal volume of a three-component mixture (phenol:chloroform:isoamyl alcohol = 25:24:1, volume ratio) was added, mixed, and allowed to stand for 3 min. After centrifugation at 12000 rpm for 10 min, 700 μL of the supernatant was aspirated, and 700 μL of isopropanol and 70 μL of sodium acetate were added, mixed, and allowed to stand for 15 min. Subsequently, the mixture was centrifuged at 12000 rpm for 10 min, and the supernatant was discarded. The white precipitate was DNA. After washing twice with 600 μL of 70% ethanol, the DNA precipitate was dissolved using ddH2O and stored at low temperature for later use.

[0035] (2) PCR amplification; The PCR reaction system consisted of: 1 μL DNA template, 5 μL 2×Taq Master Mix, and 10 μmol / L Kasp primers. Fhb7 RkaH -F and Kasp-Fhb7 RkaSt The universal reverse primer Kasp-, with 0.15 μL of each of the - and F groups and a concentration of 10 μmol / L, consists of 0.15 μL of the primer. Fhb7 Add 0.4 μL of R to double-distilled water to a final volume of 10 μL.

[0036] The PCR reaction conditions were: 95℃ for 10 min; 95℃ for 20 s, 65-57℃ for 1 min, with a decrease of 0.8℃ per cycle, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 30 cycles.

[0037] (3) KASP tagging results analysis.

[0038] After centrifugation, the PCR products were used to acquire fluorescence data using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0039] If a FAM signal is detected (near the X-axis, blue), the gene sequence at the Fusarium head blight resistance site in the wheat material is GCACAT, indicating that the tested wheat contains the resistance gene. Fhb7 RkaSt This indicates resistance to Fusarium head blight; if a HEX signal (close to the Y-axis, red) is detected, the gene sequence at the Fusarium head blight resistance site in the wheat material is CCCACG, representing that the tested wheat contains the resistance gene. Fhb7 RkaH This indicates resistance to Fusarium head blight; if both FAM and HEX signals (green) are detected, it means that the wheat being tested has aggregated expression of the resistance gene. Fhb7 RkaSt and Fhb7 RkaH This produces a significant dose effect.

[0040] 3. Phenotypic identification: Selected for identification containing only the resistance gene. Fhb7 RkaSt or Fhb7 RkaH Using transgenic materials and transgenic materials expressing both resistance genes as samples, as well as Fielder, we identified their resistance to Fusarium head blight phenotypes by single-flower injection.

[0041] Phenotypic identification results are as follows Figure 2 As shown in Table 1.

[0042] Table 1: Results of wheat genotype resistance to Fusarium head blight phenotype The results show that: Kasp- Fhb7The results of the marker genotyping and the identification results of the Fusarium head blight resistance phenotype were completely consistent.

[0043] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A polynucleotide fragment associated with resistance to wheat scab, characterized in that, The nucleotide sequence of the polynucleotide fragment is shown in SEQ ID NO. 1 or SEQ ID NO.

2.

2. Use of the polynucleotide fragment of claim 1 in identifying or assisting in identifying the resistance of a plant to wheat scab.

3. Use of a substance for detecting the polynucleotide fragment of claim 1 or a substance for detecting that the 16th-21st base of the polynucleotide fragment of claim 1 is CCCACG or GCACAT in any one of the following: (1) identifying or assisting in identifying the resistance of a plant to wheat scab; (2) wheat scab resistance gene pyramiding breeding; (3) breeding a wheat variety resistant to scab.

4. Use according to claim 3, characterized in that, The substance is a set of primers or a reagent or kit containing the set of primers.

5. A KASP marker tightly linked to the Fusarium head blight resistance gene, characterized in that, It comprises: primers shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO.

5.

6. Use of the KASP marker of claim 5 in any one of (1)-(3): (1) identifying or assisting in identifying the resistance of a plant to wheat scab; (2) wheat scab resistance gene pyramiding breeding; (3) breeding a wheat variety resistant to scab.

7. A method of identifying or aiding in the identification of resistance to scab in wheat, characterized in that, It comprises the following steps: The KASP marker of claim 5 is used for PCR amplification with the genomic DNA of the wheat to be detected as a template, and the fluorescence signal of the amplification product is detected; if FAM fluorescence signal is detected, it represents that the wheat to be detected contains the resistance gene Fhb7 RkaSt , and the phenotype is resistant to scab; if HEX fluorescence signal is detected, it represents that the wheat to be detected contains the resistance gene Fhb7 RkaH , and the phenotype is resistant to scab; if both FAM and HEX fluorescence signals are detected, it represents that the wheat to be detected contains the resistance gene Fhb7 RkaSt and the resistance gene Fhb7 RkaH polymerization, and the phenotype is resistant to scab.

8. The method of claim 7, wherein The PCR reaction system is as follows: 1 μL of DNA template, 5 μL of 2 × TaqMaster Mix, 0.15 μL of each of the primers shown in SEQ ID NO. 3 and SEQ ID NO. 4, 0.4 μL of the primer shown in SEQ ID NO. 5, and adding double-distilled water to 10 μL.

9. The method of claim 7, wherein, The PCR reaction conditions are as follows: 95℃ for 10 min; 95℃ for 20 s, 67-57℃ for 1 min, decreasing by 0.8℃ for each cycle, 10 cycles; 95℃ for 20 s, 57℃ for 1 min, 30 cycles.

Images