LAMP (loop-mediated isothermal amplification) primer probe combination and kit for identifying gracilaria lemaneiformis culture strain 981 and application of LAMP primer probe combination and kit

Abstract

The invention belongs to the technical field of marine organisms, and relates to an LAMP (loop-mediated isothermal amplification) primer probe combination and a kit for identifying a gracilaria lemaneiformis culture strain 981 and application of the LAMP primer probe combination and the kit, the nucleotide sequence of FIP of an inner primer is as shown in SEQ ID NO.1, the nucleotide sequence of BIP of the inner primer is as shown in SEQ ID NO.2, the nucleotide sequence of F3 of an outer primer is as shown in SEQ ID NO.3, and the nucleotide sequence of B3 of the outer primer is as shown in SEQ ID NO.4. The method is applied to large red alga strain identification for the first time, a four-primer LAMP system is developed on the basis that two sites are inserted into one InDel specific to the 981 strain, and during LAMP amplification, FIP primer modification biotin and BIP primer labeling FAM are combined with a streptavidin detection line of an LFD test strip, so that naked eye interpretation without electrophoresis is realized, the identification time is greatly shortened, and on-site rapid detection can be performed.

Description

Technical Field

[0001] This invention belongs to the field of marine biotechnology, specifically relating to a LAMP primer-probe combination, kit, and its application for identifying Gracilaria pulverata culture strain 981. Background Technology

[0002] Gracilaria, an important large-scale economic red algae, demonstrates significant economic value through its wide applications in abalone farming, industry, medicine, and food. Simultaneously, it plays a crucial ecological role in mitigating the greenhouse effect and promoting carbon cycling. Given its broad market prospects, large-scale cultivation has commenced in the waters of Guangdong, Fujian, Shandong, and Hainan, bringing substantial economic benefits to local fishermen. However, with the continuous expansion of aquaculture, the Gracilaria cultivation industry faces numerous challenges, among which the problem of seedling mixing is particularly prominent. Since Gracilaria is primarily propagated using algal seedling segments, seedlings from different strains, such as the currently mainstream improved varieties "981," "2007," "Lulong No. 1," and the "CB" strain, are easily mixed, directly impacting yield and quality. Therefore, establishing an efficient method for strain identification is key to solving this problem.

[0003] Existing methods for identifying crop varieties mainly include morphological identification, physicochemical identification, biochemical identification, and molecular markers. Traditional morphological identification methods for Gracilaria strains are time-consuming and labor-intensive due to the low genetic diversity and small degree of differentiation among populations, making them insufficient to meet current needs. Biochemical identification methods utilize protein differences for variety identification, using electrophoretic patterns of isoenzymes and storage proteins as genetic markers to identify varieties with different genetic backgrounds. However, due to the limited number of markers, their application in variety identification has decreased with the development of molecular markers. In contrast, molecular marker technology, as a novel genetic marker developed after morphological, cytological, and biochemical markers, exhibits significant advantages. It can reveal a rich variety of genetic variations, is less susceptible to environmental interference, and the inherent stability of DNA sequences ensures good reproducibility. Given the low genetic diversity of Gracilaria, selecting molecular markers with high gene polymorphism is a reliable way to effectively distinguish different strains.

[0004] Currently, molecular marker technologies used for germplasm identification mainly include conventional PCR, real-time quantitative PCR, and SSR. Among these, PCR technology requires expensive specialized equipment such as thermal cyclers and electrophoresis systems, making it difficult for grassroots units to implement. Its operation is complex, involving multiple steps such as DNA extraction, temperature cycling optimization, and product analysis. The reaction system contains up to eight components, each requiring precise micro-volume measurement, and the order of addition of these eight components is critical. The entire process takes 3-4 hours and demands high operator skill. Furthermore, PCR technology is sensitive to sample quality; the detection rate significantly decreases when the template DNA degrades or the concentration is below 10 ng / μL. While SSR markers possess codominant inheritance characteristics and rich polymorphism, their development cost is high, and microsatellite loci are prone to invalid allele mutations. Flanking sequence information is required before primer design, limiting its applicability. Real-time quantitative PCR for SNP detection requires TaqMan probes and a real-time PCR instrument, with a detection limit of 10 ng / μL DNA sample. All of these methods suffer from drawbacks such as complex operation, long processing time, and strong equipment dependence.

[0005] To address the problems of complex operation, expensive equipment, and cumbersome procedures in existing molecular marker technologies, this invention, through extensive testing, screened LAMP primer combinations from numerous sequences and combinations that can specifically distinguish the *Gnaphalium affine* strain, establishing a simple, rapid, and low-cost method for identifying *Gnaphalium affine* strains. Summary of the Invention

[0006] The purpose of this invention is to solve the aforementioned problems in the prior art, and to propose a LAMP primer-probe combination, kit, and application for identifying the cultivated red algae *Gracilaria rubra* strain 981. This invention develops a PCR-free isothermal detection system, integrating reaction components into a premixed reagent, eliminating the need for low-temperature operation and precise pipetting, and optimizing reaction conditions. It employs simple operating conditions (temperature maintenance) and uses lateral flow chromatography (LFD) strips instead of electrophoresis and sequencing equipment, requiring no specialized technical training or expensive instruments, allowing even untrained personnel to complete the procedure. By optimizing the reaction system, this invention reduces the total detection time from 2 hours using conventional techniques to within 1 hour, enabling the identification of large-scale cultivated red algae *Gracilaria rubra* strains in a shorter time.

[0007] The technical solution of this invention is:

[0008] This invention provides a LAMP primer-probe combination for identifying the cultivated strain 981 of Gracilaria fusiforme. The LAMP primer-probe combination includes an inner primer and an outer primer. The nucleotide sequence of the FIP of the inner primer is shown in SEQ ID NO.1, the nucleotide sequence of the BIP of the inner primer is shown in SEQ ID NO.2, the nucleotide sequence of the F3 of the outer primer is shown in SEQ ID NO.3, and the nucleotide sequence of the B3 of the outer primer is shown in SEQ ID NO.4.

[0009] Furthermore, the 5' end of the inner primer FIP is modified with biotin, and the 5' end of the inner primer BIP is marked with FAM.

[0010] This invention is based on highly specific detection using unique InDel markers: dual-marker primers are designed for the InDel site specific to the 981 strain, overcoming the limitations of traditional SSR markers which require multiple primer combinations (8 pairs of primers) and sex identification which relies on agarose gel electrophoresis. The FIP / BIP primers are modified with Biotin / FAM respectively, ensuring that the LFD test strip displays a single red line only for the 981 strain, eliminating cross-reactivity with other strains (such as "Lulong 1" and 2007).

[0011] Furthermore, the concentration ratio of the outer primer to the inner primer is 1:4 to 1:8. Preferably, the concentration ratio of the outer primer to the inner primer is 1:6.

[0012] Furthermore, through orthogonal experiments, the stepwise primer ratio was determined to be: 1.2 μM of FIP or BIP and 0.2 μM of F3 or B3. This solved the amplification competition problem caused by the addition of equal amounts of primers in the traditional method, which improved the color intensity of the target band by at least 2.5 times. The LFD test strip was interpreted more clearly and reliably, significantly improving the specificity and efficiency of the 981 strain detection.

[0013] The present invention also provides the application of the LAMP primer-probe combination in the identification of Gracilaria pulverata cultivated strain 981.

[0014] This invention provides a kit for identifying the cultivated strain 981 of Gracilaria fusiforme, the kit comprising the aforementioned LAMP primer-probe combination and a lateral flow chromatography test strip (LFD test strip).

[0015] Furthermore, the LFD test strip includes a nitrocellulose membrane (NC membrane) containing an anti-FAM antibody pre-immobilized on the NC membrane in detection zone 1 (T1) and a biotin ligand latex complex labeled on the test pad.

[0016] When using a reagent kit to identify the strains of *Asparagus officinalis*, the results are interpreted as follows:

[0017] Positive: A blue band appears on the control line (C) and a red band appears on the test line (T) T1; the positive result indicates that the sample to be tested is the "981" strain of Asparagus cochinchinensis.

[0018] Negative: A blue band appears on the control line (C), and no band appears on the test line (T); the negative result indicates that the sample is not the "981" strain of Asparagus cochinchinensis.

[0019] Invalid: No blue band appears on the control line (C), indicating improper operation or a faulty test card.

[0020] This invention also provides a method for identifying the cultivated strain of Gracilaria 981, comprising the following steps:

[0021] Extract DNA from the sample to be tested;

[0022] Using the obtained DNA as a template, an LAMP reaction system was established using the LAMP primer-probe combination described in any one of claims 1-3 to carry out the amplification reaction;

[0023] The amplification product was dropped onto an LFD test strip to induce a colorimetric reaction.

[0024] Furthermore, the LAMP reaction system comprises: 2.5 μL 10×1010 mM MgSO4, 3 μL 10 mM dNTPs, 3 μL 100 μM FIP, 3 μL 100 μM BIP, 0.5 μL 100 μM MF3, 0.5 μL 100 μM B3, 0.5 μL 8 U / μL Bst DNA polymerase, 1 μL DNA template, and ddH2O to make up to 25 μL; the isothermal amplification temperature of the reaction system is 60℃-65℃, and the isothermal amplification is performed for 40-50 min.

[0025] Furthermore, the LAMP reaction system is configured with a reaction temperature of 63℃-64℃ and a reaction time of 50 min. This invention optimizes the reaction system and reaction conditions (including reaction time and temperature) to enhance amplification efficiency and shorten the reaction time by 10-20 min.

[0026] The beneficial effects of this invention are:

[0027] (1) Based on the unique InDel insertion site of the 981 strain, the present invention developed a LAMP system containing four primers, namely F3 / B3 and FIP / BIP. During LAMP amplification, the FIP primer is modified with biotin and the BIP primer is labeled with FAM. They are combined with the streptavidin detection line of the LFD test strip, realizing naked-eye interpretation without electrophoresis. When the amplification product is dropped onto the test strip, the T1 line of anti-FAM appears red, and it is identified as the 981 strain, which greatly improves the accuracy.

[0028] (2) This invention combines the isothermal amplification advantage of LAMP (no need for thermal cycler) with the visual rapid detection advantage of LFD, and is applied for the first time to the identification of large red algae strains. It overcomes the bottleneck of long-term reliance on laboratory equipment for molecular identification of algae, and greatly shortens the time required for strain identification. It can also be used for rapid on-site detection. Specifically, crude DNA extraction takes 5 minutes, isothermal amplification takes 40-50 minutes, and the test strip can produce results in 2 minutes. Compared with the existing technology, the detection time is shortened by more than 60%, and the whole process is completed in 1 hour (the existing SSR and PCR technologies require 2-3 hours or more). Moreover, the aquaculture workers can operate on the raft, which is simple to operate. Not only is the time greatly shortened, but its convenience is also better than the existing molecular identification technology.

[0029] (3) In terms of cost, LAMP technology can complete the reaction with a constant temperature water bath (60℃-65℃), and the equipment cost is only 1 / 20 of that of PCR; 4-6 primers designed for the target gene enable a sensitivity of 0.01 ng / μL; the strong tolerance of Bst polymerase to sample inhibitors ensures that the accuracy of crude DNA detection remains above 98%; at the same time, the use of lateral flow chromatography strips (LFD) to replace electrophoresis and sequencing equipment keeps the detection equipment cost below 30 yuan; the material cost of a single detection is reduced to below 50 yuan (including the test strip), which is much less than the cost of existing molecular identification technology that can be performed on-site and isothermal amplification technology, thus overcoming the cost, equipment and operation bottlenecks of traditional labeling technology.

[0030] (4) In order to solve the problems of existing LAMP results display techniques such as turbidimetry and nucleic acid gel electrophoresis, whose detection limit of 10 ng / μL is difficult to meet the detection needs of early mixed algae in production, this invention proposes a LAMP-LFD technology, which breaks through the technical bottleneck of Gracilaria strain identification through three major innovations: First, four specific primers are designed for the InDel insertion site unique to the 981 strain, so that the detection sensitivity reaches 0.01 ng / μL, which is 1000 times higher than conventional PCR; Second, the reagent premixing technology is adopted, which simplifies the operation steps to three steps: "sample addition-incubation-result reading", which can be completed independently by non-professionals after 10 minutes of training; Third, a side-flow chromatography test strip with dual-labeled probes is introduced, and the results are interpreted through the visible red band, completely eliminating the dependence on expensive equipment such as electrophoresis instruments and fluorescence quantitative instruments. Tests have shown that the entire testing process takes no more than one hour. Compared with traditional methods, LAMP-LFD technology reduces the testing cost to 50 yuan per sample and increases efficiency by more than four times, providing reliable technical support for the breeding and large-scale cultivation of Gracilaria fuciformis. Attached Figure Description

[0031] Figure 1 Optimize LAMP reaction time;

[0032] Figure 2 Optimize LAMP temperature;

[0033] Figure 3 To optimize the magnesium ion concentration in LAMP;

[0034] Figure 4 To optimize the concentration of LAMP dNTPs;

[0035] Figure 5 To optimize the concentration of LAMP Bst polymerase;

[0036] Figure 6 To optimize the concentration ratio of inner and outer primers for LAMP;

[0037] Figure 7 For LAMP experiment sensitivity testing;

[0038] Figure 8 Here are gel electrophoresis images of nucleic acid amplification products at various LAMP concentrations;

[0039] Figure 9 Threshold testing for LAMP test strips;

[0040] Figure 10 A positive test strip for identifying the 981 strain of *Lysimachia christinae*. Detailed Implementation

[0041] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] To further understand the present invention, it will be further described in conjunction with the accompanying drawings and embodiments.

[0043] Example 1

[0044] Main reagents and instruments: Bst DNA polymerase, dNTPs (10 mmol / L), 10 x lsothermal Amp Buffer (Freeze-dryable) and MgSO4 (100 mmol / L) were purchased from Vazyme, and universal lateral flow test strips (LFD) were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0045] This embodiment provides a LAMP primer-probe combination for identifying Gracilaria faecium cultivar 981, wherein the LAMP primers are designed and synthesized as follows:

[0046] After verification through sequence alignment analysis, the target nucleic acid sequences were selected, and four specific primers were designed using PrimerExplorer V5 software (Table 1). The forward and reverse inner primers were FIP and BIP, respectively; the forward and reverse outer primers were F3 and B3, respectively. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0047] Table 1 LAMP primer sequences

[0048] Primers length Sequence(5′-3′) FIP 47 Biotin-CGCAGCACCAAATATATGACAAAAAGCGCAAAAGAAAAAAAATCGTA (SEQ ID NO.1) BIP 43 FAM-GGTTTGGTTTCGTTTTGTTTTGAGTCGAAGTGCAGAAATCCGG (SEQ ID NO.2) F3 18 ATTTAGTTTGCGCACAGC (SEQ ID NO.3) B3 22 GAAATTTCTCCTTTAGCATCA (SEQ ID NO.4)

[0049] In the above primer combinations, the concentration ratio of the outer primer to the inner primer is 1:4 to 1:8, preferably 1:6.

[0050] In this embodiment, the preferred primer ratio for the inner and outer primers is: the concentration of FIP or BIP is 1.2 μM, and the concentration of F3 or B3 is 0.2 μM.

[0051] The LAMP primer and probe combination described above is used in the kit, which also includes dNTPs, MgSO4, Bst DNA polymerase, reaction buffer, and ddH2O. The reaction buffer is preferably 10×101L Otheral Amp Buffer.

[0052] The LAMP system in the kit for detecting the *Lysimachia christinae* 981 strain is as follows: 2.5 μL 10×101 / L othermal Amp Buffer, 1.5 μL 100 mM MgSO4, 3 μL 10 mM dNTPs, 3 μL 100 μM FIP, 3 μL 100 μM BIP, 0.5 μL 100 μM F3, 0.5 μL 100 μM B3, 0.5 μL 8 U / μL Bst DNA polymerase, 1 μL DNA template, and ddH2O to make up to 25 μL.

[0053] The LAMP reaction system was set at a reaction temperature of 64℃ and a reaction time of 50 min.

[0054] The kit also includes a lateral flow chromatography test strip comprising a nitrocellulose membrane (NC membrane) containing an anti-FAM antibody pre-immobilized on the detection zone 1 (T1) of the NC membrane and a biotin-ligand latex complex labeled on the test pad.

[0055] The above-mentioned kit was used to identify the Gracilaria 981 strain, and the results were determined as follows:

[0056] S1, Positive: A blue band appears on the control line (C) and a red band appears on the test line (T1); the positive result indicates that the sample to be tested is the 981 strain of *Lysimachia christinae*.

[0057] S2, Negative: A blue band appears on the control line (C), and no band appears on the test line (T); a negative result indicates that the sample to be tested is not the Longxucai 981 strain.

[0058] S3, Invalid: No blue band appears on the quality control line (C), indicating improper operation or a faulty test card.

[0059] Example 2

[0060] This embodiment provides a method for detecting the 981 strain. The method uses the LAMP primer combination described in this embodiment and includes the following steps:

[0061] Extract DNA from the sample to be tested; using the obtained DNA as a template, establish a LAMP reaction system using a combination of LAMP primers for amplification; drop the amplification product onto an LFD test strip for colorimetric reaction. The specific operating steps of the kit are as follows: First, extract DNA from the sample to be tested according to the crude DNA extraction method. The crude DNA extraction steps are: place 1-2 0.5-1 cm algal fragments into a 1.5 ml EP tube, add 200 μl ddH2O, and grind for 5 min until the material is pulverized;

[0062] Then, take 1 μl of each and add it to the pre-prepared system tubes. Amplify at 63-64℃ for 40-50 min, then immediately dilute with ddH2O 10-10. 5 (For simple operation, add ddH2O to the mark on the tube), take 50 μl and drop it into the sample well of the transverse flow test strip, and observe the test strip results after 2-5 min;

[0063] When a blue band appears on the control line (C) and a red band appears on the test line (T) (T1), the result is positive, indicating that the sample is the Gracilaria 981 strain (see...). Figure 10 When a blue band appears on the control line (C) and no band appears on the test line (T), the result is negative, indicating that the sample to be tested is not the Longxucai 981 strain; when no blue band appears on the control line (C), it indicates improper operation or a faulty test card.

[0064] Experimental Example 1

[0065] The LAMP amplification system for detecting the Gracilaria 981 strain included: dNTP concentrations of 0–1.8 mM, Mg... 2+ The final concentration was 2–8 mM, and the Bst polymerase concentration was 160–480 U / ml. Optimization experiments were conducted on each component and parameter of this LAMP amplification system to determine the optimal LAMP reaction system.

[0066] (1) Optimization of LAMP reaction time:

[0067] The reaction time was set to six gradients: 10, 20, 30, 40, 50, and 60 min. The results are as follows: Figure 1 As shown, no reaction occurs between 10 and 30 minutes. The figure shows that LAMP amplification products can be detected after 40 minutes, but tend to stabilize after 50 minutes. Therefore, the optimal reaction time is determined to be 50 minutes.

[0068] (2) LAMP temperature range experiment

[0069] The reaction temperature was set to eight gradients: 60, 61, 62, 63, 64, 65, 66, 67, and 68 °C. The results are as follows: Figure 2 As shown, the target band can be amplified at 60℃-65℃, but no band can be amplified after 66℃. Therefore, the optimal temperature range is 60℃-65℃.

[0070] (3) Optimization of magnesium ion concentration

[0071] The LAMP magnesium ion concentrations were set at five gradients: 2, 4, 6, 8, and 10 mmol / L. The results are as follows: Figure 3As shown, slight amplification occurs at 2 mmol / L, and amplification can occur at concentrations of 2-10 mmol / L. The bands are brightest at concentrations of 6 mmol / L and 8 mmol / L. In order to reduce detection costs, the magnesium ion concentration of 6 mmol / L is preferred.

[0072] This experiment optimized the MgSO4 concentration to 6 mM, which increased polymerase activity by 30% and enhanced specificity.

[0073] (4) Optimization of dNTP concentration

[0074] The LAMP dNTP Mix concentration was set at eight gradients: 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, and 1.8 mmol / L. Figure 4 As shown, amplification can occur at a dNTP Mix concentration of 0.8 mM, and amplification can occur at concentrations of 0.8-1.8 mM. The bands are bright and clear at concentrations of 1.2 mM and 1.4 mM. Combined with the reduction of detection costs, a dNTP Mix concentration of 1.2 mmol / L is the optimal choice.

[0075] In this experiment, the concentration of dNTPs was adjusted to 1.2 mM, and with a constant temperature of 65℃, the limit of detection was reduced to 0.1 ng / μL, which is 10 times higher than that of the unoptimized system, significantly improving the detection sensitivity.

[0076] (5) Optimization of Bst polymerase concentration

[0077] Five gradients of LAMP Bst polymerase concentrations were set: 160, 240, 320, 400, and 480 U / mL. The results are as follows: Figure 5 As shown, amplification can occur in all cases, but the degree of amplification is almost unchanged at concentrations of 160 U / mL and above. In order to reduce detection costs, the Bst polymerase concentration of 160 U / mL was selected.

[0078] (6) Optimization of the ratio of inner to outer primer concentration:

[0079] Five gradients of LAMP primer concentrations were set: 4:1, 5:1, 6:1, 7:1, and 8:1. The results are as follows: Figure 6 As shown, amplification begins at a primer-to-inner-primer concentration ratio of 4:1, and amplification can occur at primer-to-inner-primer concentration ratios from 4:1 to 8:1. The bands are brightest and clearest at 6:1 and 7:1, which also reduces detection costs. Therefore, a primer-to-inner-primer concentration ratio of 6:1 is the optimal ratio.

[0080] Experimental Example 2

[0081] To facilitate use by algae farmers without experimental experience and to simplify the experimental process, this invention uses crudely extracted Asparagus DNA as a template for LAMP amplification.

[0082] The method for crude extraction of DNA from *Gracilaria fusiforme* was as follows: One to two 0.5-1 cm algal segments were placed in a 1.5 ml EP tube, and 200 μL of dH2O was added. The mixture was then ground for 5 min until the material was pulverized. To test whether the crude DNA concentration was sufficient for LAMP reaction, a LAMP sensitivity test was performed. The DNA concentration was adjusted to 1 ng / μl, 0.1 ng / μl, 0.01 ng / μl, and 0.001 ng / μl, with a total addition volume of 1 μl. The reaction was carried out at 63℃ for 45 min and then at 85℃ for 10 min. The amplification products were detected by 2% agarose gel electrophoresis. The results are as follows: Figure 7 As shown.

[0083] A 25 μl system with a DNA template content of 0.01 ng or higher is sufficient for LAMP amplification; therefore, the concentration of crudely extracted DNA is sufficient for LAMP amplification.

[0084] Experimental Example 3

[0085] To determine the threshold of the LAMP test strip, the reaction product was diluted 10-fold serially according to the above-mentioned preparation system at 63℃ for 45 min, 85℃ for 10 min. The concentration of the amplified product after a 10-fold dilution was 362.5 ng / μl. 2 The concentration was 37.55 ng / μl, diluted 10 times. 3 The concentration was 3.3 ng / μl, diluted 10 times. 4 The concentration was 0.3 ng / μl, diluted 10 times. 5 The concentration was 0.03 ng / μl, diluted 10 times. 6 The concentration was 0.003 ng / μl, diluted 10 times. 7 The concentration was 0.0003 ng / μl.

[0086] The amplification products for each gradient were detected by 2% agarose gel electrophoresis, with a loading volume of 3 μl for each gradient. The results are as follows: Figure 8 As shown in the gel electrophoresis image, a 10-fold dilution can be observed, with the highest dilution being 10. 2 The amplification product was increased by 10 times.

[0087] Add 50 μl of each concentration of amplification product to the test strip, as shown below. Figure 9 The results of the test strips shown indicate a dilution factor of 10-10. 3 The red line in the detection area is clearly visible, diluted 10 4 When diluted 10 times, the red line in the detection area becomes noticeably lighter in color.5 When the sample loading rate is increased by 10 times, the red line in the detection area disappears, and the blue line in the quality control area becomes clearly visible, indicating that the sample loading rate and the function of the test strip are normal. This proves that the test strip can detect amplification products with a maximum loading rate of 50 μl and a concentration of 0.3 ng / μl.

[0088] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, alterations, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A LAMP primer probe combination for identifying Gracilaria cultivation strain 981, characterized in that, The LAMP primer probe combination comprises inner primers and outer primers, the nucleotide sequence of FIP of the inner primers is shown as SEQ ID NO. 1, the nucleotide sequence of BIP of the inner primers is shown as SEQ ID NO. 2, the nucleotide sequence of F3 of the outer primers is shown as SEQ ID NO. 3, and the nucleotide sequence of B3 of the outer primers is shown as SEQ ID NO.

4. 2.The LAMP primer probe combination for identifying Gracilaria lemaneiformis breeding line 981 according to claim 1, characterized in that, The 5' end of the inner primer FIP is modified with Biotin, and the 5' end of the inner primer BIP is labeled with FAM. 3.The LAMP primer probe combination for identifying Gracilaria lemaneiformis breeding line 981 according to claim 1, characterized in that, The concentration ratio of the outer primers to the inner primers is 1:4-1:

8. 4.The LAMP primer probe combination for identifying Gracilaria lemaneiformis breeding line 981 according to claim 1, characterized in that, The concentration of FIP or BIP in the inner primers and the outer primers is 1.2 μM, and the concentration of F3 or B3 is 0.2 μM.

5. Use of the LAMP primer probe combination of any one of claims 1-4 in identifying the Gracilaria lemaneiformis breeding strain 981.

6. A kit for identifying a cultivated strain of Gracilaria lemaneiformis 981, characterized in that, The kit comprises the LAMP primer probe combination of any one of claims 1-4 and an LFD test strip.

7. The kit of claim 6, wherein The LFD test strip comprises an NC membrane, which contains an anti-FAM antibody pre-fixed to a detection area of the NC membrane and a biotin ligand latex compound labeled on a reagent pad.

8. A method for identifying a Gracilaria lemaneiformis 981 breeding line, characterized in that, The method comprises the following steps: extracting DNA from a sample to be tested; using the LAMP primer probe combination of any one of claims 1-3 to establish a LAMP reaction system for amplification reaction with the obtained DNA as a template; dropping the amplification product to an LFD test strip for color development reaction.

9. The method of claim 8, wherein, The LAMP reaction system comprises 2.5 μL 10×lsothermal Amp Buffer, 1.5 μL 100 mM MgSO4, 3 μL 10 mM dNTPs, 3 μL 100 μM FIP, 3 μL 100 μM BIP, 0.5 μL 100 μM F3, 0.5 μL 100 μM B3, 0.5 μL 8 U / μL Bst DNA polymerase, 1 μL DNA template, and ddH2O to make up 25 μL; the reaction temperature is 60-65℃, and the reaction time is 40-50 min.

10. The method of claim 9, wherein, The reaction temperature of the LAMP reaction system is 63-64℃, and the reaction time is 50 min.

Images