Soybean mosaic virus resistance gene Gm13g184900 and molecular marker and application thereof

Abstract

The invention belongs to the technical field of genetic breeding, and relates to a soybean mosaic virus resistance gene Gm13g184900 as well as a molecular marker and application thereof. According to the invention, the Gm13g184900 gene of a soybean variety Suweon 97 is cloned, the nucleotide sequence and the amino acid sequence of the Gm13g184900 gene are respectively shown as SEQ ID NO.1 and SEQ ID NO.2, and experiments prove that the gene inhibits the proliferation of SMV on a leguminous plant cowpea and reduces the protein accumulation amount of SMV on cowpea leaves. Meanwhile, a soybean plant which stably inherits and expresses the gene is obtained, and it is found that SMV infection can be resisted by expressing the gene on soybeans, so that the gene is indeed an effective anti-SMV gene. The invention also provides a specific molecular marker of the gene, and the molecular marker can specifically identify soybean varieties containing 13g184900R / S allele. The Gm13g184900 gene obtained by the invention can be used for improving the soybean mosaic virus resistance of soybeans, and has a great application prospect in the soybean antiviral breeding industry subsequently.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular genetics and breeding, and particularly relates to a soybean mosaic virus resistance gene Gm13g184900, a molecular marker thereof and application thereof. BACKGROUND

[0002] Disease-resistant breeding using disease-resistant genes is one of the most effective means for preventing and controlling crop diseases. The most valuable and widely used disease-resistant genes are a class of disease-resistant genes known as nucleotide-binding domain and leucine-rich repeat proteins (NLRs). NLR disease-resistant genes function in plants by directly or indirectly recognizing effectors in pathogenic organisms, and then mediating hypersensitive response (HR) to achieve the effect.

[0003] Soybean mosaic virus is one of the earliest viruses discovered on soybeans. It is widely distributed, highly harmful, and can persist in seeds for continuous transmission. Therefore, in order to prevent and control soybean mosaic virus disease, breeders began to select and plant disease-resistant varieties as early as the last century. Among them, the soybean variety Suweon 97 from South Korea was verified to be resistant to all SMV strains (G1-G7, G7A) in the United States. In 2002, Chen et al. first crossed Suweon 97 with the susceptible variety Lee 68, and according to the F2 representative results, they verified that Suweon 97 contains a single dominant disease-resistant gene against SMV. After that, they found that the F2 progeny population of Suweon 97 crossed with soybean varieties carrying Rsv1, Rsv3 and Rsv4 resistance genes did not segregate Rsv1 alleles sensitive to five SMV strains, so they inferred that the single dominant disease-resistant gene contained in Suweon 97 is an allele at the Rsv1 locus, and named it Rsv1-h. 2:3 In 2016, Ma et al. constructed F2 populations of Suweon 97 crossed with Williams 82, and found that the F2 population of Suweon 97 crossed with Williams 82 did not segregate Rsv1 alleles sensitive to five SMV strains, which further verified that Suweon 97 contains a single dominant disease-resistant gene against SMV, and named it Rsv1-h.

[0004] In 2016, Ma et al. constructed F2 populations of Suweon 97 crossed with Williams 82, and found that the F2 population of Suweon 97 crossed with Williams 82 did not segregate Rsv1 alleles sensitive to five SMV strains, which further verified that Suweon 97 contains a single dominant disease-resistant gene against SMV, and named it Rsv1-h. 2:3 In 2016, Ma et al. constructed F2 populations of Suweon 97 crossed with Williams 82, and found that the F2 population of Suweon 97 crossed with Williams 82 did not segregate Rsv1 alleles sensitive to five SMV strains, which further verified that Suweon 97 contains a single dominant disease-resistant gene against SMV, and named it Rsv1-h. 3:4The Rsv1-h was mapped between SSR markers BARCSOYSSR_13_1114 and BARCSOYSSR_13_1115, which are 97.5 kb apart on the Williams 82 reference genome. There are eight genes in this 97.5 kb region, two of which, Glyma13g184800 and Glyma13g184900, encode CC-NBS-LRR type of disease resistance genes, so they were considered as potential candidate genes for Rsv1-h.

[0005] In 2019, Wu et al. screened 12 soybean varieties by rubbing them with the source of Bean common mosaic virus (BCMV) and found that only Suweon 97 and Raidan could resist all four isolated strains of BCMV. To locate the anti-BCMV gene contained in Suweon 97, they crossed the resistant variety Suweon 97 with the susceptible variety Williams 82 and obtained F2, F 2:3 population, F 3:4 population, and finally they located the anti-BCMV gene in a 58.1 kb segment on chromosome 13 between SSR marker 13_1114 and SNP marker -49, which is highly coincident with and smaller than the segment containing the anti-SMV gene in Suweon 97. This segment contains only five genes, Glyma13g184800 listed above, but not Glyma13g184900, so they guessed that Suweon 97 relies on the same disease resistance gene Glyma13g184800 to resist both SMV and BCMV.

[0006] However, due to the limitations of traditional positioning methods, there have been many cases of non-functional genes obtained by map-based cloning, for example, the soybean growth period regulating gene E2 gene is obtained by classical map-based cloning method, but after knocking out E2 alone, the soybean plant only shows early flowering symptoms, and the growth period is not obviously affected, and after research, it is found that there are two analogues E2La and E2Lb of E2 family in the soybean genome which have not been cloned, and knocking out E2 and E2La / E2Lb simultaneously will make the soybean appear the phenotype of accelerating the transition to the reproductive stage. Therefore, the gene obtained by map-based cloning can only be a candidate gene, and the function verification of transgenic gene is the gold standard for determining the function of the gene. Therefore, the research on the function of the plant disease resistance gene is the final purpose of cloning the gene, and without the research on the function, the actual gene function that mediates the plant resistance to diseases cannot be determined, the basic principle why the disease-resistant varieties resist certain diseases cannot be determined, and more effective disease control strategies cannot be developed. Therefore, it has obvious economic value and breeding significance to clone the resistance gene in the Rsv1-h locus of Suweon 97 that actually mediates the resistance to SMV and verify the resistance function of the gene. SUMMARY

[0007] In view of the problems in the prior art, the present application provides a soybean mosaic virus resistance gene Gm13g184900 and a molecular marker and application thereof, an effective disease resistance gene 13g184900 in the Rsv1-h locus is cloned, and it is found that the disease resistance gene can recognize SMV and mediate hypersensitive response (HR), and it is further found that the gene can recognize P3 protein of SMV alone to produce HR; it is verified that the disease resistance gene 13g184900 indeed has resistance function to SMV, and the expression of the disease resistance gene can inhibit the proliferation and distribution of SMV on legume Vigna unguiculata; a soybean plant with stable genetic expression of the gene is obtained by transgenic technology, and it is found that the plant can resist the infection of SMV; the complete nucleotide sequence of the disease resistance gene 13g184900 is obtained by sequencing, and a specific molecular marker of the gene is designed according to the sequence.

[0008] In a first aspect, the present application provides a primer pair for detecting a soybean mosaic virus resistance gene Gm13g184900, the primer pair comprising an upstream primer R-F1 and a downstream primer R1, the nucleotide sequence of the upstream primer R-F1 is shown in SEQ ID No. 21, and the nucleotide sequence of the downstream primer R1 is shown in SEQ ID No. 22.

[0009] In a second aspect, the present application further provides a kit containing the primer pair.

[0010] In a third aspect, the application further provides the primer pair of the first aspect or the kit of the second aspect for use in detecting the soybean mosaic virus resistance gene Gm13g184900 or screening soybean varieties with soybean mosaic virus resistance.

[0011] In some embodiments, the primer pair of the first aspect is used to detect the sample, and the length of the amplified product is a 435 bp fragment, which indicates that the sample contains the soybean mosaic virus resistance gene Gm13g184900 or the sample has soybean mosaic virus resistance.

[0012] In a fourth aspect, the application further provides a primer set for identifying the genotype of Gm13g184900 in soybean varieties, which comprises the primer pair of the first aspect and an upstream primer S-F1, wherein the nucleotide sequence of the upstream primer S-F1 is shown in SEQ ID No. 23.

[0013] In a fifth aspect, the application further provides a kit comprising the primer set of the fourth aspect.

[0014] In a sixth aspect, the application further provides the primer set of the fourth aspect or the kit of the fifth aspect for use in identifying the genotype of Gm13g184900 in soybean varieties or screening soybean varieties with soybean mosaic virus resistance.

[0015] In some embodiments, the primer pair of the first aspect is used to detect the sample, and the length of the amplified product is a 435 bp fragment, which indicates that the sample contains the soybean mosaic virus resistance gene Gm13g184900 or the sample has soybean mosaic virus resistance. R In some embodiments, the primer pair of the first aspect is used to detect the sample, and the length of the amplified product is a 435 bp fragment, which indicates that the sample contains the soybean mosaic virus resistance gene Gm13g184900 or the sample has soybean mosaic virus resistance. s In some embodiments, the primer pair of the first aspect is used to detect the sample, and the length of the amplified product is a 435 bp fragment, which indicates that the sample contains the soybean mosaic virus resistance gene Gm13g184900 or the sample has soybean mosaic virus resistance.

[0016] In a seventh aspect, the present invention also provides the application of the soybean mosaic virus resistance gene Gm13g184900 or the soybean mosaic virus resistance protein Gm13g184900 in improving the resistance of soybean varieties to soybean mosaic virus. The application includes the step of introducing the soybean mosaic virus resistance gene Gm13g184900 or the soybean mosaic virus resistance protein Gm13g184900 into plant tissues. The nucleotide sequence of the soybean mosaic virus resistance gene Gm13g184900 is shown in SEQ ID No. 1, and the amino acid sequence of the soybean mosaic virus resistance protein Gm13g184900 is shown in SEQ ID No. 2.

[0017] In some embodiments, the introduction is achieved through techniques such as gene editing, transgenic technology, or hybridization.

[0018] Compared with the prior art, the present invention has the following technical effects.

[0019] 1) This invention utilizes transgenic technology to obtain transgenic soybean plants stably expressing 13g184900 in a susceptible variety background. It was found that after inoculation of transgenic soybeans with SMV-GFP, the inoculated leaves exhibited a clear HR phenotype, while the systemic leaves showed no symptoms of viral infection. Subsequent immunoblotting analysis confirmed that the systemic leaves of the SMV-GFP-inoculated transgenic soybeans did not contain SMV-GFP, indicating that the introduction of this gene into soybeans can resist SMV infection.

[0020] 2) This invention is based on 13g184900 of the cloned disease-resistant variety Suweon 97. R Alleles and the 13g184900 of the susceptible variety Williams 82 S Based on the allele nucleotide sequence, two pairs of specific molecular marker detection primers were designed. Genomic DNA was then extracted from Suweon 97 and Williams 82 to verify the accuracy of the molecular marker. The results showed that the molecular marker can specifically identify cells containing 13g184900. R / S The allele-based soybean varieties, along with the molecular marker and primer pair, can be used in practical agricultural production and guide current marker-assisted breeding for soybeans resistant to soybean mosaic virus. Attached Figure Description

[0021] Figure 1 To simultaneously express 13g184900 and SMV-GFP using Agrobacterium-mediated transient gene expression on 2-week-old cowpea leaves.

[0022] Figure 2 To simultaneously express 13g184900 and various proteins encoding SMV in 4-week-old Benedictine tobacco leaves.

[0023] Figure 3 To verify the HR response generated by the interaction between 13g184900 and the P3 protein of SMV on 4-week-old tobacco leaves.

[0024] Figure 4 To simultaneously express 13g184900 and SMV-GFP in 2-week-old cowpea leaves as the experimental group, p2300-flag-strep (empty vector without target gene expression, EV) and SMV-GFP were used as the control group. The fluorescence imaging of the leaves was then observed using a fluorescence inverted microscope.

[0025] Figure 5 Symptoms of 14 days after rubbing SMV-GFP onto transgenic soybean plants that stably express 13g184900 in the Williams 82 and Williams 82 backgrounds.

[0026] Figure 6 To analyze using Western blotting methods Figure 5 The accumulation of SMV-GFP protein in inoculated leaves and systemic leaves of Williams 82 and the accumulation of SMV-GFP protein in inoculated leaves and systemic leaves of plants stably expressing 13g184900.

[0027] Figure 7 To identify 13g184900 R / S A schematic diagram of molecular marker design for alleles, where the sequences shown are 13g184900 from the disease-resistant variety Suweon 97. R Alleles and the disease-susceptible variety Williams 82: 13g184900 S The nucleotide sequence of the allele.

[0028] Figure 8 13g184900 R / S Molecular markers of alleles can clearly distinguish 13g184900 in the disease-resistant variety Suweon 97. R Alleles and 13g184900 in the susceptible variety Williams 82 S Alleles.

[0029] Figure 9 13g of soybeans from 17 soybean cultivars (184900 mg / kg) R / S Allele results. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the embodiments of the present invention include, but are not limited to, the following embodiments. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the present invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are all conventional means well known to those skilled in the art.

[0031] Unless otherwise specified, all reagents and materials used in the examples in this specification are from commercially available products.

[0032] Escherichia coli DH5α competent cells, Agrobacterium tumefaciens competent cells GV3101, 5× protein loading buffer, and skim milk powder were all purchased from Shanghai Sangon Biotech. LB medium (200mL): Tryptone 2g, Yeast extract 1g, NaCl 2g, add pure water to make up to 200mL; add Agar 3g when preparing solid medium.

[0033] Kanamycin (50 mg / mL) is prepared with water; rifamycin (25 mg / mL) is prepared with anhydrous ethanol.

[0034] The cowpea variety used is Green Collar Red Handsome.

[0035] Agrobacterium treatment solution (MMA, 50 mL): 0.5 M MES (2-morpholinoethanesulfonic acid) 1 mL, 1 M MgCl2 (magnesium chloride) 500 μL, 100 mAS (acetylsyleugenol) 50 μL, add ddH2O to make up to 50 mL for later use.

[0036] 0.2M PB buffer (pH=7.5): 42.4g Na2HPO4·12H2O, 4.42g NaH2PO4·2H2O, add ddH2O to bring the volume to 1L, autoclave at 121℃ for 20min, and store at room temperature for later use.

[0037] 10×PBS solution: NaCl 80g, KCl 2g, NaH2PO4·12H2O 35.8g, KH2PO4 2.4g, add ddH2O 900mL, adjust pH to 7.5 with hydrochloric acid, then bring volume to 1L with ddH2O, autoclave at 121℃ for 20min, and store at room temperature for later use.

[0038] 2×CTAB solution: 200mL of 1M Tris (pH 7.5), 280mL of 5M NaCl, 40mL of 0.5M EDTA, 20g of CTAB (hexadecyltrimethylammonium bromide), and ddH2O to bring the total volume to 1L.

[0039] Example 1: Cloning of the Gm13g184900 gene and construction of a plant expression vector The vector was constructed using homologous recombination. A homologous arm was added to the 5' end of both the forward and reverse primers. The soybean reference genome variety Suweon 97 was selected as the gene cloning material. Total DNA was extracted from plant leaves and reverse transcribed into cDNA. The reverse-transcribed cDNA was used as a template for PCR amplification to obtain the complete 184900 fragment. The expression vector pCAM2300s-flag-strep was then digested with the restriction endonuclease BamHI (NEB). The digested plasmid, fragment, Exnase II, and 5 × CE II Buffer were mixed in a 10 μL system using Novizan's Recombinant Cloning Kit (C112-01). This allowed the 184900 fragment with the homologous arm to be loaded onto the digested plasmid under the action of the enzyme. The correct recombinant vector was then selected for subsequent experiments using colony PCR and sequencing.

[0040] Specifically as follows: (1) Total RNA was extracted from the leaves of Suweon 97 using the plant total RNA extraction kit (DP432) from Beijing Tiangen. The total RNA was finally obtained by elution according to the instructions (DP432-20170329). The total RNA was obtained by mixing 1 μL of specific primer S97-13G184900.1-R, 1 μL of 10mM dNTP mix, and 10 μL of total RNA. After mixing, the mixture was treated at 65℃ for 5 minutes and then placed on ice. Then, the reverse transcription kit from Promega was used. The mixture was mixed to 25 μL according to the following volume (M-MLV 5×buffer 5 μL, Recombinant RNase Inhibitor 1.6 μL, M-MLV RT 1 μL, RNase-free ddH2O 5.4 μL). The mixture was placed in a PCR instrument and the program was set to 42℃ for 60 minutes followed by 72℃ for 15 minutes. After the program was completed, the mixture was placed on ice for later use.

[0041] (2) The 13g184900 gene of the cloned soybean variety Suweon 97 was amplified using primers to obtain the reverse transcription product. S97-13G184900.1-F: TCGAGCTTTTCGCGAGCTCGGTACCATGGCACTAGAATTGGTTGGT (SEQ ID No. 3), S97-13G184900.1-R: CTGCAGGTCGACTCTAGAGGATCCAACATCAACATCATTACCTAATAAC (SEQ ID No. 4).

[0042] Using the reverse transcription product as a template, amplification was performed using a 50 μL system of Phanta Max Super-Fidelity DNA Polymerase (Novizan P505-d1) (2 × Phanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, 20 × Suweon 97 cDNA 1 μL, ddH2O to bring the total to 50 μL). The amplification program was 95℃ for 5 minutes; 35 cycles of 95℃ for 15 seconds, 56℃ for 30 seconds, 72℃ for 2 minutes and 30 seconds; 72℃ for 5 minutes. The PCR product was subjected to agarose gel electrophoresis, and a fragment of approximately 3.4 kb was excised and purified.

[0043] (3) The expression vector pCAM2300s-flag-strep was digested with restriction endonuclease BamHI (NEB). The sample was mixed in a 50 μL system (1 μL BamHI, 5 μL rCutsmart Buffer, 8 μL plasmid, and pure water to 50 μL) and placed in a 37℃ constant temperature incubator for 3 hours. After that, the sample was detected by agarose gel electrophoresis and found to be a single band. The sample was then cut and purified.

[0044] (4) Using the Novizan Recombinant Cloning Kit (C112-01), mix the components in a 5 L system (0.8 μL of plasmid after enzyme digestion, 1.7 μL of fragment, 1 μL of 5 × CE II Buffer, and 0.5 μL of Exnase II), and place the mixture in a 37℃ metal bath for 30 min. Then, immediately add the system to DH5α competent cells for Escherichia coli transformation. On the second day, pick single colonies of Escherichia coli and use the primer pair S97-13G184900.1-F / S97-13G184900.1-R to perform colony PCR amplification and screen for positive colonies. Then, extract the plasmid by shaking and sequence it for verification. Finally, the expression vector p2300-184900 carrying the 13g184900 gene from the soybean variety Suweon 97 was constructed.

[0045] The fragment obtained in step (2) was verified to be 13g184900. R The nucleotide sequence is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2.

[0046] Example 2: Validation of the interaction between Gm13g184900 and SMV functional proteins (1) An expression vector encoding SMV proteins was constructed using homologous recombination. A homologous arm was added to the 5' end of both the forward and reverse primers. The pCB301-SMVSC7-GFP plasmid (construction of which can be found in patent publication CN119082177 A) was used as a template to amplify fragments encoding SMV proteins with homologous arms. The expression vector pBinPlus-3HA was then digested with restriction endonucleases Kpn I and BamHI (NEB). The digested plasmid, fragments, Exnase II, and 5 × CE II Buffer were mixed in a 10 μL system using Novizan's recombinant cloning kit (C112-01). This allowed the enzymes to attach the fragments (8) of SMV proteins with homologous arms to the digested plasmid. The correct recombinant vector was then selected for subsequent experiments by colony PCR and sequencing.

[0047] Table 1 Primers used to clone SMV-encoded protein fragments

[0048] Using pCB301-SMVSC7-GFP plasmid as a template, amplification was performed using a 50 μL system of Phanta Max Super-Fidelity DNA Polymerase (Novizan P505-d1) (2 × Phanta Max Buffer 25 μL, dNTPMix (10 mM each) 1 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, 20 × pCB301-SMVSC7-GFP 1 μL, ddH2O to bring the total to 50 μL). The amplification program was 95℃ for 5 minutes; 35 cycles of 95℃ for 15 seconds, 56℃ for 30 seconds, 72℃ for 1 minute; 72℃ for 5 minutes. The PCR products were subjected to agarose gel electrophoresis, and the fragments were excised and purified.

[0049] (2) The expression vector pBinPlus-3HA was digested with restriction endonucleases Kpn I and BamHI (NEB). The sample was mixed in a 50 μL system (1 μL Kpn I, 1 μL BamHI, 5 μL rCutsmart Buffer, 8 μL plasmid, and pure water to 50 μL) and placed in a 37℃ constant temperature incubator for 3 hours. After that, the sample was detected by agarose gel electrophoresis and found to be a single band. The gel was then cut and purified.

[0050] (3) Using the Novizan Recombinant Cloning Kit (C112-01), mix the components in a 5 μL system (0.8 μL of plasmid after enzyme digestion, 1.7 μL of fragment, 1 μL of 5 × CE II Buffer, and 0.5 μL of Exnase II), and place the mixture in a 37℃ metal bath for 30 min. Then, immediately add the system to DH5α competent cells to transform Escherichia coli. On the second day, pick single colonies of Escherichia coli, and use the M13-F / M13-R primer pair to perform colony PCR amplification to screen for positive colonies. Then, extract the plasmid for sequencing verification.

[0051] (4) Treatment and infiltration of Agrobacterium S1. Before treating Agrobacterium, activation is necessary. Glycerol-containing clones of SMV, p2300-184900, CMV2a expression vectors, and empty vectors are streaked onto LB agar plates containing 50 mg / mL kanamycin and 25 mg / mL rifamycin resistance, and incubated overnight. The next day, single colonies are picked and added to 5 mL of LB liquid medium with the corresponding resistance, and incubated overnight. Then, the Agrobacterium cultures of the four vectors are added to 2 mL centrifuge tubes, centrifuged at 6000 rpm for 5 min to collect the cells. The supernatant is discarded, and the process is repeated once. The supernatant is discarded, and 2... The bacterial cells were suspended in mL of Agrobacterium treatment solution (MMA) and the OD600 was adjusted to 1.2. The cells were then placed in a 28°C incubator and kept in the dark for 1 hour. The three systems of SMV, p2300-184900, and p2300-flag-strep (empty vector) were mixed in pairs at a 1:1 ratio (if the infectivity of the infectious clone is poor, more of the treatment solution system of the infectious clone can be added appropriately). SMV and p2300-184900 were co-infiltrated as the experimental group, the empty vector, SMV, and p2300-184900 were co-infiltrated as the control group, and CMV2a was infiltrated alone as the positive control.

[0052] Using a 1ml syringe, draw up the prepared Agrobacterium-treated solution mixture. Hold the cowpea leaf on the upper surface with your index finger and use the other hand to gently push the solution into the designated infiltration area on the lower surface of the leaf. If some cowpea leaves are difficult to infiltrate, you can first make holes in the leaves with a needle, then inject the solution into the holes. Four Agrobacterium-treated solutions were infiltrated on cowpea leaves: SMV + p2300-184900, p2300-184900 + empty vector, SMV + empty vector, and CMV2a (positive control). After 7 days at 22°C, the combinations 184900 + SMV and 184900 + EV produced phenotypes similar to the positive control CMV2a, and the hazard ratio (HR) of the 184900 + SMV combination was more pronounced than that of the 184900 + EV combination.Figure 1 The results indicate that the expression of 13g184900 elicits a HR response, and the HR response induced after recognizing SMV is even more severe, suggesting that this gene may be an effective disease resistance gene.

[0053] S2. Similarly, p2300-184900 was mixed with the Agrobacterium-treated solutions of each SMV protein separately. To reduce the HR caused by expressing 13g of 184900, the OD of p2300-184900 in the mixture was reduced. 600 The value was adjusted to 0.2, and the OD of the SMV protein was... 600 The value was then adjusted to 0.6. p2300-184900 was co-infiltrated with eight SMV protein systems as experimental groups, and p2300-184900 co-infiltrated with the empty vector as a control group. The mixture was then injected into the leaves of *Tobacco Benedict* using a syringe. The leaves were observed three days later. Figure 2 When the OD of p2300-184900 600 After the concentration was reduced to 0.2, the control group p2300-184900 did not produce a HR (high-risk response) when co-infiltrated with the empty vector, while p2300-184900 produced a strong HR when co-infiltrated with pBin-SMVP3. Furthermore, no HR was produced when p2300-184900 was co-infiltrated with other SMV proteins. Subsequently, p2300-184900 co-infiltrated with SMV P3 protein served as the experimental group, while p2300-184900 and SMV P3 were co-infiltrated with the empty vector, respectively, serving as the control group. Transient expression was performed on *Tobacco Benedict* leaves, and the results are as follows: Figure 3 The simultaneous expression of p2300-184900 and SMV P3 protein showed a significant HR phenotype, while no HR phenotype was observed in either of the two control groups. This result further indicates that 13g184900 is an effective disease-resistant gene that can recognize SMV P3 protein and thus initiate downstream immune responses. The protein encoded by this gene and P3 are corresponding NLR and pathogen effector, respectively.

[0054] Example 3: Demonstration of the disease resistance function of the Gm13g184900 gene 1. Observe the fluorescence intensity of cowpea leaves and detect the amount of virus accumulation in the leaves. Before treating Agrobacterium, it must be activated. Glycerol-containing bacteria of the types pCB301-SMVSC7-GFP, p2300-184900, and p2300-flag-strep (not expressing the target gene) were picked and streaked onto LB solid medium plates containing 50 mg / mL kanamycin and 25 mg / mL rifamycin resistance and cultured overnight. The next day, single colonies were picked and added to 5 ml of LB liquid medium with the corresponding resistance and cultured overnight to obtain four Agrobacterium solutions.

[0055] a) Add the four Agrobacterium cultures to 2 mL centrifuge tubes respectively, centrifuge at 6000 rpm for 5 min to collect the cells; discard the supernatant and repeat once.

[0056] b) Discard the supernatant, suspend the bacterial cells in 4 mL of Agrobacterium treatment solution (MMA), and place them in a 28°C constant temperature incubator to stand in the dark for 1 h.

[0057] c) Mix SMVSC7-GFP with the treatment solutions of p2300-184900 and p2300-flag-strep (EV), respectively, and adjust the OD. 600 SMV-GFP:OD 600 p2300-184900 / EV to 1.0:0.5, where SMV-GFP and p2300-184900 were combined as the experimental group to verify that 13g184900 has the function of resistance.

[0058] d) Using a 1 ml syringe, draw up the prepared Agrobacterium-treated solution mixture. Hold the front of the cowpea leaf with your index finger and use the other hand to gently push the Agrobacterium-treated solution mixture into the planned wetting area on the back of the leaf. If some cowpea leaves are difficult to wet, you can first use a needle to make holes in the leaves, and then use the syringe to inject the solution into the holes.

[0059] e) After injection, place at 22 degrees Celsius for two and a half days before proceeding to the next stage of the experiment.

[0060] f) After soaking for two and a half days, the cowpea leaves of the experimental group and the control group were prepared into water-sealed slides using a temporary mounting method. The intensity and distribution of green fluorescence on the slides were then observed using an inverted fluorescence microscope.

[0061] The results are as follows Figure 4 As shown in Figures (a) and (c), the green fluorescence intensity and distribution of cowpea leaves when 13g184900 and SMV-GFP were expressed simultaneously were significantly weaker than those in Figures (b) and (d) when EV and SMV-GFP were expressed simultaneously. The results indicate that the expression of 13g184900 can inhibit the proliferation and infection of SMV in legumes.

[0062] 2. Observe the symptoms of transgenic plants stably expressing 13g184900 after inoculation with SMV-GFP and detect the protein accumulation level of SMV-GFP in the leaves. First, transgenic soybean plants with stable genetic expression of 13g184900 were obtained in the background of the susceptible variety Williams 82 using Agrobacterium-mediated transgenic technology.

[0063] a) Take a clean mortar and add an appropriate amount of 0.2M PB buffer. Then take out the SMV-GFP virus source stored in the -80℃ freezer and grind the virus source into the PB buffer with a mortar and pestle in preparation for inoculation.

[0064] b) Spray the first true leaf of the infected Williams 82 plant and the transgenic plant that stably expresses 13g184900 with carborundum to help create a wound. Use your finger to take the crushed toxin from the above steps and gently rub the leaf, repeating several times.

[0065] c) After friction inoculation, the plants were placed in a 25℃ greenhouse for observation for about 14 days. It was found that the inoculated leaves of Williams 82 showed very obvious mosaic symptoms, and the systemic leaves also showed mild mosaic symptoms. Later, it was found that the inoculated leaves showed very obvious fluorescence under ultraviolet light, while the systemic leaves simultaneously emitted mild fluorescence, indicating that SMV-GFP proliferation and infection occurred in both the inoculated and systemic leaves of the susceptible Williams 82 plants. In contrast, the inoculated leaves of the transgenic plants stably expressing 13g184900 showed a clear HR response phenotype, and no mosaic symptoms were observed in the systemic leaves. Under ultraviolet light, the HR response phenotype of the inoculated leaves was even more pronounced, and the systemic leaves did not emit any fluorescence, indicating that the transgenic plants stably expressing 13g184900 can resist SMV-GFP infection. Figure 5 ).

[0066] 3. To more accurately and effectively verify that transgenic plants stably expressing 13g184900 can resist SMV-GFP infection, total protein was extracted from the inoculated leaves and systemic leaves of Williams 82 after virus inoculation, as well as from the inoculated leaves and systemic leaves of transgenic plants after virus inoculation. Then, Western blot was used to determine whether there was any difference in the accumulation level of SMV-GFP protein in the leaves of transgenic plants compared with Williams 82.

[0067] a) Take several clean mortars and weigh 0.1g of inoculated leaves and systemic leaves of Williams 82 after virus inoculation, inoculated leaves and systemic leaves of transgenic plants after virus inoculation, and uninoculated Williams 82 leaves and add them to the mortars. Then add 300μL of 1×PBS solution (diluted 10×PBS solution 10 times) to the mortars and grind thoroughly until no leaf tissue remains.

[0068] b) Transfer 200 μL of supernatant from the mortar to a 1.5 mL centrifuge tube, add 50 μL of protein loading buffer, and heat all samples in a 95 °C metal bath for 10 min. After heating, centrifuge at 12000 rpm for 5 min and then freeze at -80 °C for later use.

[0069] c) Western blot was used to immobilize the SMV-GFP protein accumulation in the leaves of Williams 82 and transgenic plants onto a PVDF membrane, followed by chemiluminescence detection. The results showed that the SMV-GFP protein accumulation in the inoculated leaves and systemic leaves of Williams 82 was at a high level, while no SMV-GFP was found in the inoculated leaves and systemic leaves of transgenic plants stably expressing 13g184900.

[0070] The above results accurately and strongly demonstrate that transgenic plants stably expressing 13g184900 can resist SMV-GFP infection. Figure 6 ).

[0071] Example 4 13g184900 R / S Allele-specific molecular markers (1) Design 13g184900 R / S Specific molecular markers a) Cloning and sequencing yielded the resistant variety Suweon 97, cultivar 13g184900. R The nucleotide sequence of the allele is shown in SEQ ID No. 1. The susceptible variety Williams 82 contains 13g184900. S The nucleotide sequences of the alleles were downloaded from the Plant Genome Database website https: / / phytozome-next.jgi.doe.gov / . The sequence 13g184900 was simultaneously entered into the ClustalX2 software, along with the code for Suweon 97 and Williams 82. R / S The nucleotide sequences of alleles are compared for sequence similarity.

[0072] b) A segment encoding the NB-ARC domain was selected from the 13g184900 nucleotide sequence. Based on the nucleotide polymorphism, two pairs of primers were designed for amplifying specific molecular markers, namely, those for identifying 13g184900. R R-F1 (5'-CCGTAGAGAGAACACC-3' (SEQ ID No. 21)) / R1 (5'-AGTTGTAGAGTGAACATATTG-3' (SEQ ID No. 22)) and identification of 13g184900 SS-F1 (5'-ACACAGAGAGAACAGA-3' (SEQ ID No. 23)) / R1 (5'-AGTTGTAGAGTGAACATATTG-3' (SEQ ID No. 22)). For example... Figure 7 As shown, the R-F1 / R1 primer pair specifically amplifies a 435 bp fragment containing 69 single nucleotide polymorphism sites and a 30 bp insertion; the S-F1 / R1 primer pair specifically amplifies a 405 bp fragment containing 69 single nucleotide polymorphism sites and a 30 bp deletion.

[0073] (2) Verify the specificity and reliability of molecular markers a) First, genomic DNA was extracted from soybean leaves using the CTAB method. 50 mg of soybean leaves were weighed and placed in a 1.5 mL centrifuge tube. The leaves were then ground using a homogenizer pre-cooled with liquid nitrogen at a frequency of 60 Hz for at least 60 s, until the leaves were completely pulverized. 300 μL of 2×CTAB solution was added, and the mixture was quickly shaken and placed in a 65°C metal bath for 1 h.

[0074] b) Remove the sample and place it at room temperature. After cooling, add 300 μL of chloroform, shake quickly, and centrifuge at 12000 rpm for 10 min. Then, transfer the supernatant to a new 1.5 mL centrifuge tube and add 300 μL of isopropanol. Shake well, centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μL of 70% ethanol, and centrifuge at 12000 rpm for 10 min.

[0075] c) After removing the sample, discard the supernatant, carefully aspirate any remaining liquid from the centrifuge tube, open the cap, and place it in a fume hood until it is completely dry. After drying, add 50-100 μL of ddH2O and incubate at room temperature for 30 minutes to allow the DNA to dissolve naturally.

[0076] d) The extracted Suweon 97 (carrying 13g184900) R Homozygous), Williams 82 (carrying 13g 184900) SUsing homozygous individuals as templates, PCR verification was performed using two primer pairs, R-F1 / R1 and S-F1 / R1. Amplification was performed using a 25 μL system of Phanta Max Super-Fidelity DNA Polymerase (Novazia P505-d1) (2 × Phanta Max Buffer 12.5 μL, dNTP Mix (10 mM each) 0.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, Phanta Max Super-Fidelity DNA Polymerase 0.5 μL, Suweon 97 / Williams 82 genomic DNA 1 μL, ddH2O to bring the total to 25 μL). The amplification program for the R-F1 / R1 primer pair was 95℃ for 5 min; 35 cycles of 95℃ for 15 s, 60℃ for 30 s, 72℃ for 20 s; 72℃ for 5 min. The amplification program for the F2 / R1 primer pair was 95℃ for 5 min; 35 cycles of 95℃ for 15 s, 58℃ for 30 s, 72℃ for 20 s; 72℃ for 5 min.

[0077] e) After PCR, 5 μL of 10× loading buffer was added to each PCR sample, followed by agarose gel electrophoresis. Electrophoresis was performed at a constant voltage of 140V for 20 min, followed by UV imaging. The results are as follows: Figure 8 The results showed that the R-F1 / R1 primer pair specifically amplified a single band of approximately 500 bp from the Suweon 97 genomic DNA; similarly, the S-F1 / R1 primer pair specifically amplified a single band of approximately 500 bp from the Williams 82 genomic DNA. These results indicate that these two molecular markers can accurately distinguish 13g184900. R / S Alleles, and the molecular markers in this invention can be used to specifically identify soybean varieties carrying 13g184900. R / S Genotypes of alleles.

[0078] Example 5: Detection of the Gm13g184900 genotype in soybean cultivars using molecular markers. (1) Genomic DNA was extracted from 17 soybean cultivars using the CTAB method. Genomic DNA from Suweon 97 and Williams82 was used as control groups for PCR amplification. The specific experimental method is described in Example 4.

[0079] (2) Agarose gel imaging results are as follows Figure 9 As shown, the results of the control group first demonstrated the reliability of the results, indicating that only Shanning 21 contained 13g of 184900.R Alleles, and being heterozygous, are found in 18 other soybean cultivars carrying 13g184900. R / S The genotype information is shown in Table 2.

[0080] Table 2. 17 soybean cultivars carry 13g 184900 R / S Genotype summary table

[0081] This shows that most soybean cultivars in my country lack a gene that shows resistance to all SMV lines. Therefore, introducing this effective disease-resistant gene has great development potential and application prospects in my country's current soybean antiviral breeding project.

[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer pair for detecting soybean mosaic virus resistance gene Gm13g184900, characterized in that, The primer pair comprises an upstream primer R-F1 and a downstream primer R1, wherein the nucleotide sequence of the upstream primer R-F1 is shown as SEQ ID No. 21, and the nucleotide sequence of the downstream primer R1 is shown as SEQ ID No.

22.

2. A kit comprising the primer pair of claim 1.

3. Use of the primer pair of claim 1 or the kit of claim 2 in detecting the soybean mosaic virus resistance gene Gm13g184900 or screening soybean varieties with soybean mosaic virus resistance.

4. Use according to claim 3, characterized in that, The sample to be tested is detected by using the primer pair of claim 1, and the length of the amplified product is a 435 bp fragment, which indicates that the sample to be tested contains the soybean mosaic virus resistance gene Gm13g184900 or the sample to be tested has soybean mosaic virus resistance.

5. A primer set for identifying the genotype of Gm13g184900 in soybean varieties, characterized in that, The primer set comprises the primer pair described in claim 1, and an upstream primer S-F1, wherein the nucleotide sequence of the upstream primer S-F1 is shown as SEQ ID No.

23.

6. A kit comprising the primer set of claim 5.

7. Use of the primer set of claim 5 or the kit of claim 6 in identifying soybean varieties carrying the genotype of Gm13g184900 or screening soybean varieties with soybean mosaic virus resistance.

8. Use according to claim 7, characterized in that, The sample to be tested is detected by using the upstream primer R-F1 and the downstream primer R1, and the upstream primer S-F1 and the downstream primer R1, respectively. If the length of the amplified product is a 435 bp size fragment, the genotype of Gm13g184900 in the sample to be tested is 13g184900 R , that is, the sample to be tested carries a resistance gene or has soybean mosaic virus resistance; if the length of the amplified product is a 405 bp size fragment, the genotype of Gm13g184900 in the sample to be tested is 13g184900 s , that is, the sample to be tested carries a susceptible gene or does not have soybean mosaic virus resistance.

9. Use of the soybean mosaic virus resistance gene Gm13g184900 or the soybean mosaic virus resistance protein Gm13g184900 for increasing the resistance of a soybean variety against the soybean mosaic virus, characterized in that, The application comprises the step of introducing the soybean mosaic virus resistance gene Gm13g184900 or the soybean mosaic virus resistance protein Gm13g184900 into plant tissues, wherein the nucleotide sequence of the soybean mosaic virus resistance gene Gm13g184900 is shown as SEQ ID No. 1, and the amino acid sequence of the soybean mosaic virus resistance protein Gm13g184900 is shown as SEQ ID No.

2.

10. Use according to claim 9, characterized in that, The introduction is achieved by gene editing, transgenic technology or hybridization technology.

Images