High-temperature-resistant polylactic acid depolymerases and application thereof in degradation of polylactic acid plastics

Abstract

The invention relates to the technical field of bioengineering and environmental biology, and particularly discloses high-temperature-resistant polylactic acid depolymerases and application thereof in degradation of polylactic acid plastics. The nucleotide sequence of the coding gene of the high-temperature-resistant polylactic acid depolymerases B01 is as shown in SEQ ID NO: 1, and the amino acid sequence of the coding gene is as shown in SEQ ID NO: 2. The enzyme is derived from metagenome mining, the sequence similarity of the enzyme and the known PLA depolymerases PAM is only 34.45%, and the enzyme has remarkable novelty. According to the present invention, the secretory expression and the purification of the B01 are successfully achieved in the bacillus subtilis SCK6; an enzymatic property research shows that the optimal reaction temperature of the B01 is 65 DEG C, the half-life period at 60 DEG C is as long as 150 minutes, and the B01 shows excellent thermal stability; and the optimum pH value of the strain is 9.0. The invention provides a novel enzyme preparation with important application potential for high-temperature biological recovery treatment of PLA plastic waste.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of industrial enzyme preparation and biodegradation, and particularly relates to a novel polylactic acid depolymerase B01 with excellent thermal stability, a coding gene thereof, a preparation method thereof, and application of the polylactic acid depolymerase B01 in biodegradation of PLA plastic and lactic acid recovery, especially high-crystallinity PLA. BACKGROUND

[0002] As an important biodegradable plastic, polylactic acid (PLA) is slowly degraded in the natural environment. Enzymatic degradation is one of the key technologies for realizing green recycling of PLA. However, the plastic-degrading enzymes reported in the prior art have many defects, for example: the esterase PpEst from Pseudomonas pseudoalcaligenes can only degrade PBAT plastic and has no degrading effect on other plastics such as PLA; some esterases can act on PLA, but have poor temperature tolerance and the enzyme activity sharply decreases at a temperature higher than 50℃; and some other enzymes have poor degrading effect on high-melt-index and high-crystallinity PLA, which is difficult to meet the needs of complex scenarios in actual application.

[0003] These defects limit the industrial application of plastic-degrading enzymes, and therefore it is of great significance to develop a PLA-degrading enzyme with broad spectrum and high stability, and it is crucial to develop a PLA-degrading enzyme with a brand-new sequence skeleton for promoting the technical development and commercial application in this field. SUMMARY

[0004] The present application aims to provide a PLA depolymerase B01 with a brand-new amino acid sequence to overcome the deficiencies of the prior art and provide a new core element for enzymatic recycling of PLA.

[0005] The technical solution of the present application is as follows: A high-temperature-resistant polylactic acid depolymerase has the following amino acid sequence: 1) the amino acid sequence shown in SEQ ID NO. 2; or 2) substitution, deletion and / or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO. 2 without changing the function; or 3) an amino acid sequence derived from 2) and having the same function as 2).

[0006] An isolated polynucleotide encoding the polylactic acid depolymerase described above.

[0007] Preferably, it has the following nucleotide sequence: 1) the nucleotide sequence shown in SEQ ID NO. 1; or 2) the sequence shown in SEQ ID NO. 1 is substituted, deleted and / or increased by one or more nucleotides, and a nucleotide sequence encoding a protein with the same function; or 3) a nucleotide sequence having 75%, 80%, 85%, 88%, 90% or 95% or more homology with the sequence shown in SEQ ID NO. 1 and encoding a protein with the same function.

[0008] The skilled in the art can easily mutate the nucleotide sequence of the protein obtained by the present application by using known methods, such as site-directed mutagenesis and rational modification of the nucleotide sequence of the gene. Those nucleotide sequences artificially modified, which have 75% or more similarity with the nucleotide sequence encoding the protein obtained by the present application, are derived from the nucleotide sequence of the present application and equivalent to the nucleotide sequence of the present application, as long as the encoded enzyme has activity.

[0009] The present application innovatively constructs a recombinant expression system of Bacillus subtilis SCK6, and realizes efficient secretion expression of B01 by whole gene synthesis and optimization.

[0010] A recombinant expression vector comprising the above-mentioned polynucleotide.

[0011] A recombinant cell, wherein the host cell is Bacillus subtilis SCK6.

[0012] A method for producing the poly-lactic acid depolymerase, comprising culturing the recombinant cell, and separating the bacterial cells and the enzyme from the culture by centrifugation, and obtaining the high-purity enzyme by purifying the obtained crude enzyme using AKTA.

[0013] The specific enzyme activity of the high-temperature-resistant poly-lactic acid depolymerase is 3.82 U / mg, the optimal reaction temperature is 60°C, the optimal pH is 8.0, and it still maintains more than 75% activity after being treated at 70°C for 40 minutes, showing excellent thermal stability.

[0014] The application of the high-temperature-resistant poly-lactic acid depolymerase in degrading PLA plastic or recycling lactic acid monomers.

[0015] The application comprises: The PLA plastic to be degraded is dissolved in a buffer solution, and the high-temperature-resistant poly-lactic acid depolymerase is added for degradation, so that the PLA plastic is degraded into lactic acid monomers, and the lactic acid monomers are recycled.

[0016] The amount of the high-temperature-resistant poly-lactic acid depolymerase is 1-10% of the total volume, and the degradation time is 12-36 hours.

[0017] The buffer solution is Tris-HCl buffer solution.

[0018] The enzyme has high depolymerization capacity for PLA substrate, and the release amount of lactic acid monomer can reach 6 mM (10 mg of 3260HPPLA powder, 1 mL of reaction system), which has the potential to be directly applied to PLA biological recycling.

[0019] Preferably, the application is carried out at 60-70℃, pH 8.5-9.5.

[0020] Beneficial effects: The high-temperature-resistant polylactic acid depolymerase (B01 enzyme) provided by the application has a core amino acid sequence (SEQ ID NO: 2) which is completely new. Compared with the currently known representative PLA depolymerase PAM, the sequence similarity is only 34.45%, which is far lower than the commonly considered homologous protein threshold (such as 60%), which indicates that B01 is an evolutionarily independent and completely new protein sequence.

[0021] The expression system has industrial application advantages: the application successfully realizes high-efficiency secretory expression of B01 enzyme in Bacillus subtilis SCK6. Bacillus subtilis as a GRAS host has good protein secretion capacity and mature high-density fermentation process, avoiding the renaturation problem of inclusion body formed by intracellular expression, greatly simplifying the downstream purification process, and being more conducive to industrial large-scale production.

[0022] Excellent enzymatic properties and degradation efficiency: the specific enzyme activity of the B01 enzyme is 3.82 U / mg, the optimum reaction temperature is 60℃, the optimum pH is 8.0, and it can still maintain more than 75% activity after being treated at 70℃ for 40 minutes, showing excellent thermal stability. The B01 enzyme has high depolymerization capacity for PLA substrate, and the release amount of lactic acid monomer is high, which has the potential to be directly applied to PLA biological recycling. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 : Multiple sequence alignment results of B01 and typical members of ester hydrolase family.

[0024] Figure 2 : B01 phylogenetic tree constructed based on maximum likelihood method.

[0025] Figure 3 : SDS-PAGE diagram of expression and purification of B01 in Bacillus subtilis.

[0026] Figure 4 : Optimum temperature and optimum pH of B01.

[0027] Figure 5 : Effect of organic reagents / surfactants on protein B01.

[0028] Figure 6: B01 comparative chart of degradation products of different PLA, Figure A is 3D printing material, Figure B is a disposable straw, Figure C is high crystallinity PLA particles 3260 HP crystallinity is 39.88%, Figure D is a fiber made of PLA.

[0029] Figure 7 : B01 degradation effect on real PLA. DETAILED DESCRIPTION

[0030] The methods used in the following examples are conventional methods in the art, unless otherwise specified. The "%” concentrations involved in the following examples are mass / volume percentages (w / v), unless otherwise specified.

[0031] Example 1: Obtaining of PLA depolymerase B01 A new gene sequence with putative PLA depolymerization activity was obtained by Hidden Markov Model (HMM) mining from metagenomic database. The sequence was optimized and modified, and the protein encoded by it was named B01, with the amino acid sequence shown in SEQ ID NO: 2.

[0032] The sequence of B01 was aligned with the closest known PLA depolymerase PAM in the database using global alignment algorithm, and the results showed that the similarity of the two in the entire sequence length was only 34.45%. This extremely low similarity fully proves that B01 is a brand new polylactic acid depolymerase protein sequence.

[0033] Further, B01 was subjected to multiple sequence alignment with a plurality of known PLA hydrolytic enzymes (PAMs) and a phylogenetic tree was constructed. Figure 1 Figure 2 The results showed that B01 formed an independent branch on the phylogenetic tree, and had a distant genetic relationship with other known enzymes, further confirming its novelty from the perspective of phylogenetics.

[0034] ​ Optimized protein sequence (SEQ ID NO. 2): MRSKKLWISLLFALTLIFTMAFSNMSVQAAGKSSTEKKYIVGFKQTMSAMSSAKKKDVISEKGGKVQKQFKYVNAAAATLDEKAVKELKKDPSVAYVEEDHIAHEYAQSVPYGISQIKAPALHSQGYTGSNVKVAVIDSGIDSSHPDLNVRGGASFVPSETNPYQDGSSHGTHVAGTIAALNNSIGVLGVSPSASLYAVKVLDSTGSGQYSWIINGIEWAISNNMDVINMSLGGPSGSTALKTVVDKAVSSGIVVAAAAGNEGSSGSSSTVGYPAKYPSTIAVGAAASSNQRASFSSAGSELDVMAPGVSIQSTLPGGTYGAYNGTSMATPHVAGAAALILSKHPTWTNAQVRDRLESTATYLGNSFYYGKGLINVQAAAQ Example 2: Construction of expression vector and engineering strain of B01 depolymerase According to the codon bias of Bacillus subtilis SCK6, the gene encoding polylactic acid depolymerase B01 (amino acid sequence as shown in SEQ ID NO: 2) was codon-optimized. The optimized gene sequence is shown in SEQ ID NO: 1. The sequence was synthesized by whole gene synthesis, and the expression vector pET-29a(+) was from Novagen. The amplification primers B01-29aF and B01-29aR were designed, and the 5' ends of the primers were added with homologous arms derived from the 3' ends of the EcoRI and NdeI enzyme digestion sites of pET-29a(+), respectively. After PCR amplification of the gene fragment, a one-step cloning reaction was performed to transform E. coli DH5a. LB kanamycin (kan) antibiotic plates were used for screening, and single clones were extracted and purified using gel recovery method. Then the plasmid was subjected to EcoRI and NdeI double enzyme digestion verification, and electrophoresis analysis was performed on the nucleic acid gel. Finally, the positive E. coli clone strain DH5a / pET-29a(+)-B01 was obtained by sequencing verification.

[0035] Bacillus Subtilis SCK 6 (comK gene was integrated into the genome of Bacillus subtilis 1A751), the Bacillus subtilis SCK6 was streaked on LB solid medium containing a final concentration of chloramphenicol 5 mg / mL, and inverted overnight culture in a 37°C incubator. 3 μL of Bacillus subtilis alkaline broken wall liquid 1 (KOH lye) was added to a sterile PCR tube, and then 27 μL of broken wall liquid 2 (Tris buffer) was added. A single colony of SCK6 was picked and transferred to the mixed liquid, and after 72°C treatment for 20 min, 3 μL of broken wall liquid 3 (HCl acid liquid) was added for neutralization to obtain the broken wall liquid. 6 μL of the broken wall liquid was used as a template, and 2 μL of primer LF-F and 2 μL of primer LF-R, 1 μL of DNTP, 1 μL of high-fidelity enzyme, 25 μL of buffer, and 13 μL of sterile water were added. The specific system is shown in Table 1, and the PCR amplification was performed according to the program in Table 4 to obtain the left homologous arm. The right homologous arm was amplified by the same method using primers RF-F and RF-R. The specific system is shown in Table 3, and the left and right homologous arm genes were obtained by gel recovery. First, 1 μL of the constructed pET-29a(+)-B01 plasmid was taken as a template and added to the PCR tube, and 2 μL of primer B01-29aF and 2 μL of primer B01-29aR, 1 μL of high-fidelity enzyme, 25 μL of buffer, and 15 μL of sterile water were added. The PCR amplification was performed according to the program in Table 2, and the nucleic acid gel was recovered to obtain the B01 gene. The left and right homologous arm genes and the B01 gene were used as templates to perform one-step cloning to obtain the SCK6-B01 gene.

[0036] SCK6 was streaked on solid LB plates and incubated at 37°C for 12 h. A single colony was inoculated in 4 mL of YN liquid medium and incubated at 37°C with 200 rpm shaking for 8 h. Then, it was transferred to fresh 18 mL of YN liquid medium, and 0.5% of xylose was added to a final concentration. The mixture was incubated at 37°C with 200 rpm shaking for 2-3 h. Finally, 6 mL of 50% sterile glycerol was added, mixed well, and aliquoted into sterile centrifuge tubes (500 μL / tube) and stored at -80°C.

[0037] The competent cells were taken out, thawed in a 42°C water bath, and 1 μL (1 μg / mL) of DNA of SCK6-B01 was added. After incubation at 37°C and 200 rpm for 1 h, 100 μL was spread on a chloramphenicol-resistant plate at 5 mg / mL. After 12 h of incubation at 37°C, the transformants were picked and subjected to PCR verification and sequencing. Then, the positive clones were inoculated in 5 mL of LB liquid medium containing chloramphenicol, and incubated at 37°C and 200 rpm for 12 h. The bacterial liquid was mixed with 40% glycerol water at a volume ratio of 1:1, and stored in a -80°C sterile preservation tube. The strain information was labeled. After resistance screening and colony PCR verification, the positive recombinant engineering strain SCK6 was obtained.

[0038] Table 1 B01 gene amplification reaction system

[0039] Table 2

[0040] Table 3 B01 gene amplification reaction system

[0041] Table 4 PCR amplification program

[0042] Primer sequence: LF-F: acacagagcttcctgtttggagccacGATTGGGATGATAGCGGGAGC LF-R: ttgattttccagccgccatAGCCTGCGCAGACATGTTGCT B01-29aF: tcgagcaccaccaccaccaccactgaACTTTATCTGAGAATAGTCAATCTTCGG B01-29aR: ttgattttccagccgccatAGCCTGCGCAGACATGTTGCT RF-F: AGCAACATGTCTGCGCAGGCTATGGCGGCTGGAAAATCAA RF-R: ATTGACTATTCTCAGATAAAGTTCAGTGGTGGTGGTGGTGGTGC Example 3: Expression, purification and identification of B01 depolymerase The engineering strain constructed in Example 2 was subjected to shake flask fermentation culture. In this study, the fermentation process of B. subtilis SCK6 strain producing polylactic acid-degrading enzyme B01 was optimized and fermentation tank fermentation. First, through shake flask fermentation experiment, the key parameters such as carbon and nitrogen source of culture medium, fermentation temperature, fermentation time and inoculation amount were systematically optimized, and the optimal shake flask fermentation conditions were finally obtained as follows: Culture medium: 50 g / L glycerol, 30 g / L yeast powder, 30 g / L peptone, 6 g / L potassium phosphate dibasic; fermentation temperature is 37℃, fermentation time is 48h, inoculation amount is 1.5%.

[0043] After plate culture, test tube culture was carried out, and then the recombinant engineering strain SCK6 was inoculated into the fermentation medium at an inoculation amount of 1.5% for shake flask fermentation experiment. The fermentation medium was 50 g / L glycerol, 30 g / L yeast powder, 30 g / L peptone, 6 g / L potassium phosphate dibasic, 37℃, fermentation time 48h, The fermentation supernatant (extracellular secretion) was collected by using a high-speed centrifuge (centrifugation parameters: 9000 rpm, 30 min), and then filtered using a filter head. The purified protein was obtained by using AKTA pure25 protein purification instrument (Ni-NTA column). The target protein was eluted by using 50 mM, 100 mM, 200 mM and 300 mM imidazole PBS buffer in sequence, and the eluate was collected and stored.

[0044] The purified protein sample was subjected to SDS-PAGE analysis, and the results are shown in Figure 3 A single band consistent with the theoretical molecular weight was observed at about 27 kDa, indicating that high-purity B01 recombinant protein was successfully obtained. Compared with the E. coli expression system, a single strong band was obtained in the B. subtilis system, indicating that the purification efficiency was better in the secretion expression system.

[0045] Example 4: Enzymatic property analysis of B01 depolymerase The activity of the purified B01 enzyme was determined using p-nitrophenyl octanoate (pNPO) as the substrate.

[0046] 980 μL PBS, 10 μL substrate p-NPO and 10 μL enzyme protein solution were added to a 2 mL test tube, and then mixed thoroughly. The test tube was placed in a 40℃ metal bath for 5 min. 300 μL was taken and placed in a 96-well plate, and the absorbance (410 nm) was measured using an enzyme marker. The data were recorded. 200 μL of Coomassie brilliant blue solution and 4 μL of enzyme solution were added to the 96-well plate, mixed well, and the absorbance (595 nm) was measured using an enzyme marker. The data were processed.

[0047] Optimum temperature determination: Set the temperature at 30℃, 40℃, 50℃, 60℃, 70℃, 80℃, then prepare the sample in a 2 mL tube by adding 970 μL of PBS buffer, 10 μL of enzyme solution, and 10 μL of substrate p-NPO. React in the set water bath, and after the reaction is complete, measure the absorbance at 410 nm on the enzyme marker. Record the data and make a graph to find the optimum reaction temperature.

[0048] Thermal stability detection: Set the time at 0 min, 10 min, 20 min, 30 min, 45 min, 60 min, 90 min, and prepare the sample (add 970 μL of PBS buffer and 10 μL of enzyme solution in a 2 mL tube, and make four parallel groups) in a 70℃ metal bath according to the set time. After the placement time is over, perform ice bath operation for 5 min, add 10 μL of p-NPO to react at 40℃ metal bath for 5 min, and use the enzyme marker to measure the absorbance at 410 nm. Take the 0 min sample as the control group to measure the relative enzyme activity of the remaining samples.

[0049] As shown in FIG. 1A, Figure 4 The optimum reaction temperature of B01 enzyme is 60℃. After incubation at 70℃ for 40 minutes, the residual activity remains above 75%, indicating that the enzyme has good stability at high temperature.

[0050] Optimum pH determination: Prepare the buffer: citrate acid buffer (pH 3.0~6.0), PBS buffer (pH 6.0~8.0), Tris-HCl buffer (pH 8.6~10.0), and Gly-NaOH buffer (pH 10.0~12.0). Use the above buffer to prepare the reaction system, adjust the temperature to the optimum temperature, and react for 20 min. After the reaction is complete, measure the absorbance at 410 nm on the enzyme marker. Record the data and make a graph to find the optimum reaction pH. As shown in FIG. 1B, Figure 4 The optimum reaction pH of B01 enzyme is 8.0.

[0051] Effect of organic reagents / surfactants on protein B01: To evaluate the effects of different organic reagents, surfactants, and metal ions on the activity of B01 protease, and to determine its tolerance in actual application environment.

[0052] Experimental method: The purified B01 enzyme solution was mixed with 1% (v / v) organic reagent / surfactant or 1 mM metal ion solution, respectively, and incubated at 4°C for 1 hour. Then, the residual enzyme activity was measured under the optimal conditions (60°C, pH 8.0) using pNPO as the substrate, and the activity of the untreated enzyme solution was used as the control (100%).

[0053] Experimental results: As shown in Figure 5 , the B01 enzyme showed good tolerance to a variety of test reagents. In particular, in the presence of Co 2+ , Mn 2+ , Ca 2+ ions, the enzyme activity remained at a high level; while its activity was more obviously inhibited by Zn 2+ , Cu 2+ .

[0054] Example 5: Verification of the degradation ability of B01 depolymerase on PLA plastic Using commercially available 3D printing materials, disposable straws, high crystallinity PLA particles 3260 HP with a crystallinity of 39.88%, and PLA fibers as substrates, the purified B01 enzyme was added to a total volume of 3% in a 50 mM PBS buffer (pH 8.0) system, and the reaction was carried out at 40°C for 48 hours. After the reaction, the supernatant was filtered, and the concentration of released lactic acid monomer was detected by high performance liquid chromatography (HPLC). As shown in Figure 6 , the generation of lactic acid monomer was confirmed by comparison with lactic acid standard.

[0055] Example 6: Performance evaluation in real plastic depolymerization scenarios To verify the actual degradation ability of B01 on high crystallinity commercial PLA products, we conducted a large-scale degradation experiment. In a 100 mL reaction system, 1 g of PLA particles (model: 3260 HP) was used as the substrate, and 3% of B01, protease K (PK) and E01 were used for a 48-hour depolymerization reaction under the optimal reaction conditions (60°C, pH 8.0).

[0056] After the reaction, it can be seen that Figure 7 , the solution transparency of the B01 treatment group was very high, and the solid PLA residue at the bottom of the bottle was significantly reduced. This phenomenon directly indicates that under the same conditions, the B01 depolymerase provided by the present application can more effectively depolymerize solid PLA plastic into soluble small molecule products, highlighting its great value in actual industrial applications.

Claims

1. A thermostable polylactic acid depolymerase, characterized in that, The amino acid sequence of which is shown as SEQ ID NO:

2.

2. An isolated polynucleotide, comprising, The nucleotide sequence of which is shown as SEQ ID NO:

1.

3. The polynucleotide of claim 2, wherein, The polynucleotide of claim 2 or 3.

4. A recombinant expression vector, characterized in that, The recombinant expression vector of claim 4.

5. A recombinant cell, characterized in that, The recombinant cell of claim 5 is cultured, expression is induced, and the polylactic acid depolymerase is obtained by separation and purification from the culture supernatant.

6. The method for preparing the thermostable polylactic acid depolymerase according to claim 1, characterized by, 7. The use of the high-temperature-resistant polylactic acid depolymerase of claim 1 in depolymerizing polylactic acid plastic. The enzyme is directly added to a solution containing polylactic acid plastic to be degraded for depolymerization reaction; wherein the amount of enzyme is 1-10% of the total volume, and the degradation time is 12-36 hours.

8. Use according to claim 7, characterized in that, The depolymerization reaction is carried out at 40-70℃ and pH 7-9.

9. Use according to claim 7, characterized in that, ​

Images