Herbal active hair growth liquid as well as preparation method and application thereof

Abstract

The invention belongs to the field of bioactive preparations and tissue regeneration, and particularly discloses herbal active hair growth liquid as well as a preparation method and application thereof. The herbal active hair growth liquid is prepared by compounding deionized water, medicinal-grade butanediol, an astragalus membranacus root extract, a ganoderma atrum extract, an angelica sinensis root extract, a cordyceps sinensis extract, a ginseng extract and phenoxyethanol according to a specific weight percentage, dissolving, stirring, controlling the temperature, monitoring the particle size, defoaming and the like. The herbal active hair growth liquid prepared by the invention can remarkably promote proliferation of human hair follicle outer root sheath cells, can realize complete hair regeneration, remarkably increases the number of hair follicles and the diameter of the hair follicles, is superior to existing products, and is suitable for industrial production and application.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioactive preparations and tissue regeneration technology, and particularly relates to a herbal active hair growth liquid as well as a preparation method and application thereof. BACKGROUND

[0002] Hair loss problems are increasingly common in modern society, causing distress to many people. There are many hair growth products on the market, but some of them have the problem of poor effect: ordinary vitamins and biotin added only provide nutrition and cannot effectively promote hair follicle growth; and the abuse of active substances (such as 6-gingerol in ginger) may even inhibit hair growth, resulting in many consumers not achieving the expected hair growth effect after use. Therefore, it is of great practical significance to develop an efficient hair growth liquid. SUMMARY

[0003] To develop a safe and efficient hair growth liquid, the present application provides a herbal active hair growth liquid as well as a preparation method and application thereof. The herbal active hair growth liquid prepared by the present application can significantly promote the proliferation of human hair follicle outer root sheath cells, can realize complete hair regeneration, and significantly increase the number and diameter of hair follicles, which is superior to existing products and suitable for industrial production and application.

[0004] The present application provides a herbal active hair growth liquid, 100 mL of which is prepared from the following components: Butanediol 16 mL-24 mL, Astragalus membranaceus root extract 8 g-12 g, black ganoderma extract 0.5 g-1.25 g, Angelica sinensis root extract 5.5 g-7 g, Cordyceps sinensis extract 4.5 g-6 g, ginseng extract 2 g-4 g, phenoxyethanol 0.5 mL-1 mL, and the rest is water.

[0005] The herbal active hair growth liquid prepared by the present application can significantly promote the proliferation of human hair follicle outer root sheath cells, can realize complete hair regeneration, and significantly increase the number and diameter of hair follicles, which is superior to existing products and suitable for industrial production and application.

[0006] Further, the purity of the Astragalus membranaceus root extract is ≥98%, and the polysaccharide content of the black ganoderma extract is ≥30%.

[0007] Further, the ferulic acid content of the Angelica sinensis root extract is ≥0.1%, the adenosine content of the Cordyceps sinensis extract is ≥0.3%, and the ginsenoside Rg1 content of the ginseng extract is ≥2.0%.

[0008] The present application also provides a preparation method of a herbal active hair growth liquid, comprising the following steps: The water and butanediol are stirred at 250 r / min~350 r / min for 10 min~20 min; the Astragalus membranaceus root extract, black ganoderma extract, Angelica sinensis root extract, Cordyceps sinensis extract and Panax ginseng extract are sequentially added; the temperature is increased to 40℃~50℃, and the stirring is carried out at 350 r / min~450 r / min for 25 min~35 min to obtain a first solution; the temperature is decreased to 20℃~30℃, and the phenoxyethanol is added; the stirring is carried out at 150 r / min~250 r / min for 5 min~15 min to obtain a second solution; and the vacuum standing is carried out to obtain the herbal active hair growth liquid.

[0009] Further, the standing time for the vacuum standing is 15 min~25 min.

[0010] Further, the particle size of the Astragalus membranaceus root extract, black ganoderma extract, Angelica sinensis root extract, Cordyceps sinensis extract and Panax ginseng extract in the first solution is ≤5 μm.

[0011] The application further provides an application of the herbal active hair growth liquid in the preparation of a hair growth product.

[0012] Further, the function of the hair growth product further includes promoting the proliferation of human hair follicle outer root sheath cells and / or inhibiting the apoptosis thereof.

[0013] Compared with the prior art, the application has the following beneficial effects: The herbal active hair growth liquid prepared by the application can significantly promote the proliferation of hair follicle cells and inhibit the apoptosis, and efficiently stimulate the hair growth of an animal model: the cell test shows that, under the concentration of 1%, the herbal active hair growth liquid prepared by the application can make the proliferation rate of human hair follicle outer root sheath cells (HHDPC) increase by up to 45.6% (Example 1), and the apoptosis rate decrease by 32.5%, which is better than the positive control group of 50 μg / mL of minoxidil, proving that the herbal active hair growth liquid can effectively activate the hair follicle activity and prolong the hair follicle growth period; the mouse test result shows that, after the herbal active hair growth liquid is applied for 15 days, the hair growth area of the mouse reaches 100%. The key indicators such as the number of hair follicles (48.6 per mm2) and the diameter of hair follicles (78.3 μm) are significantly higher than those of the blank control group and the positive control group of the commercially available minoxidil, proving that the herbal active hair growth liquid can not only promote the rapid coverage of hair, but also increase the hair density and thickness, realize the qualitative change from “having hair” to “having thick and strong hair”, and can be applied in the fields of medical treatment, medical aesthetics and washing and protection, and meet the hair growth demand.

[0014] The herb active hair growth liquid prepared in the present application can block the conversion of testosterone to dihydrotestosterone (DHT) from the root, and reduce the inhibitory effect of DHT on hair follicles. By increasing the ratio of cordyceps sinensis and ginseng, the positive expression rate of hair follicle stem cell marker CD200 (44.0%) is significantly improved, and the expression of nutrient supply related gene VEGF is up-regulated, which proves that the herb active hair growth liquid prepared in the present application can promote hair thickening growth by enhancing the self-renewal ability of hair follicles and local microcirculation nutrition supply.

[0015] The herb active hair growth liquid prepared in the present application is uniform in appearance, has no precipitation and stratification, and the pH value is stable within 28 days under extreme conditions such as high temperature (45 DEG C), low temperature (-5 DEG C) and strong light irradiation (4500 lx), and the retention rate of effective components is more than 97%, which completely meets the cosmetic stability evaluation standard, and ensures the quality controllability and effective period guarantee of the product in the process of industrialized production, storage and transportation. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiment or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0017] Figure 1 It is the cell proliferation experiment and apoptosis rate detection results of example 1; in the figure, A is the cell proliferation experiment result; B is the apoptosis rate detection result.

[0018] Figure 2 It is the hair growth area ratio, hair follicle number and hair follicle diameter detection results of example 1 mice; in the figure, A is the hair growth area ratio; B is the hair follicle number; C is the hair follicle diameter.

[0019] Figure 3 It is the cell proliferation experiment and apoptosis rate detection results of example 2; in the figure, A is the cell proliferation experiment result; B is the apoptosis rate detection result.

[0020] Figure 4 It is the hair growth area ratio, hair follicle number and hair follicle diameter detection results of example 2 mice; in the figure, A is the hair growth area ratio; B is the hair follicle number; C is the hair follicle diameter.

[0021] Figure 5 The results of cell proliferation experiment and apoptosis rate detection of Example 3; in the figure, A is the result of cell proliferation experiment; B is the result of apoptosis rate detection.

[0022] Figure 6 The results of hair growth area ratio, hair follicle number and hair follicle diameter detection of Example 3; in the figure, A is the hair growth area ratio; B is the hair follicle number; C is the hair follicle diameter.

[0023] Figure 7 The results of 5α-reductase activity detection in Example 3.

[0024] Figure 8 The results of cell proliferation experiment and apoptosis rate detection of Example 4; in the figure, A is the result of cell proliferation experiment; B is the result of apoptosis rate detection.

[0025] Figure 9 The results of hair growth area ratio, hair follicle number and hair follicle diameter detection of Example 4; in the figure, A is the hair growth area ratio; B is the hair follicle number; C is the hair follicle diameter.

[0026] Figure 10 The results of clarity detection of the herbal active hair tonic of Example 4.

[0027] Figure 11 The results of ferulic acid and formononetin content determination in the herbal active hair tonic of Example 4; in the figure, A is the ferulic acid content; B is the formononetin content.

[0028] Figure 12 The results of cell proliferation experiment, apoptosis rate detection and gene expression of Example 5; in the figure, A is the result of cell proliferation experiment; B is the result of apoptosis rate detection; C is the result of gene expression. VEGF VEGF The results of gene expression of Example 5.

[0029] Figure 13 The results of hair follicle number and hair follicle diameter detection in Example 5; in the figure, A is the hair follicle number; B is the hair follicle diameter. DETAILED DESCRIPTION

[0030] The specific embodiments of the present application are described in detail below, but it should be understood that the scope of protection of the present application is not limited by the specific embodiments. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application. The experimental methods described in the embodiments of the present application are conventional methods, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0031] ​Example 1: A herbal active hair growth liquid, its preparation method and application.

[0032] I. Herbal Active Hair Growth Liquid Formula and Preparation 1. Herbal Active Hair Growth Liquid Formula 54.25 mL deionized water, 20 mL pharmaceutical grade butylene glycol, 10 g Astragalus membranaceus root extract (purity ≥98%, Fufeng Sinote Biotechnology Co., Ltd., catalog number SNT210831), 1 g Ganoderma lucidum extract (polysaccharide content ≥30%, Naturalin Biotechnology Co., Ltd., catalog number NAT-180), 6 g Angelica sinensis root extract (ferulic acid content ≥0.1%, UPI, catalog number 210089), 5 g Cordyceps sinensis extract (adenosine content ≥0.3%, Lanzhou Waterles Biotechnology Co., Ltd., catalog number YSX), 3 g ginseng extract (ginsenoside Rg1 content ≥2.0%, Naturalin Biotechnology Co., Ltd., catalog number NAT-114), 0.75 mL phenoxyethanol.

[0033] 2. Preparation of Herbal Active Hair Growth Liquid Deionized water and pharmaceutical-grade butylene glycol (Jiangsu Baichuan High-Tech New Materials Co., Ltd., item number BC-012) were added to a 500 mL glass reactor. The mixture was stirred for 15 min at a constant temperature of 35℃ and magnetic stirring at 300 r / min until the system was homogeneous and transparent. Then, extracts of Astragalus membranaceus root, Ganoderma lucidum, Angelica sinensis root, Cordyceps sinensis, and ginseng were added sequentially. The temperature was raised to 45℃, and the mixture was stirred at 400 r / min for 30 min. During this period, the particle size was monitored using a laser particle size analyzer (Mastersizer3000) to ensure that the particle size was ≤5 μm. After stirring, the temperature was lowered to 25℃, and food-grade phenoxyethanol (Jiangsu Baichuan High-Tech New Materials Co., Ltd., item number P103663) was added. The mixture was stirred at 200 r / min for 10 min, and then allowed to stand under a vacuum of 0.08 MPa for 20 min to remove bubbles, yielding the herbal active hair growth liquid.

[0034] II. Cell and Animal Experiments 1. Cell experiments 1.1 Test Materials Human hair follicle outer root sheath cell line (HHDPC, purchased from Shanghai Yaji Biotechnology Co., Ltd.), DMEM high glucose medium (containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin), MTT reagent (concentration 5 mg / mL, dissolved in PBS), and Annexin V-FITC / PI apoptosis detection kit (Elabscience, catalog number E-CK-A211).

[0035] 1.2 Propagation Experiment HHDPC cells were inoculated in 96-well plates at 5 x 10 3 After 24 h of culture at 37°C in a 5% CO2 incubator, the supernatant was discarded; the herb active hair growth solution sample was added to DMEM / F-12 medium (Gibco, item number 11320033) with 10% FBS (Gibco, item number 26140079) to make the final concentration of the herb active hair growth solution 1%, and 1 mL of DMEM / F-12 medium with 1% herb active hair growth solution was added to the HHDPC cells with the supernatant discarded, with 6 replicates per group; the blank control group was added with the same amount of medium, and the positive control group was added with DMEM / F-12 medium with a final concentration of 50 μg / mL minoxidil, with a volume of 1 mL. After 48 h of culture, 20 μL of MTT solution was added to each well, and the culture was continued for 4 h, the supernatant was discarded, 150 μL of DMSO was added, and the micro-vibration oscillator was vibrated for 10 min. The absorbance value (OD value) at 490 nm was determined by an enzyme-labeled instrument (Thermo Multiskan FC), and the cell proliferation rate = (test group OD value-blank group OD value) / blank group OD value x 100%.

[0036] 1.3. Apoptosis test HHDPC cells were inoculated in 6-well plates at 2 x 10 5 After 24 h of culture at 37°C in a 5% CO2 incubator, the same treatment as in the proliferation test was performed, and the cells were collected after 48 h of continuous culture, washed twice with PBS, added with 500 μL of Binding Buffer, and added with 5 μL of Annexin V-FITC and 5 μL of PI. After 15 min of incubation in the dark, the apoptosis rate was detected by flow cytometry (BD FACSCalibur).

[0037] 2. Mouse test 2.1. Test materials and grouping SPF C57BL / 6 mice (30, male, 6-8 weeks old, 18-22 g, purchased from Vantoll Life) were randomly divided into 3 groups (n=10): Example 1 group (applying Example 1 herb active hair growth solution), blank control group (applying 0.9% normal saline), and positive control group (applying 50 μg / mL commercially available minoxidil solution). One week of adaptive feeding before the experiment, environmental temperature 22±2°C, humidity 50±5%, 12 h light-dark cycle.

[0038] 2.2. Hair growth test After the mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (50 mg / kg), the hair on a 2 cm x 2 cm area on the back was removed by an electric shaver, and the residual fluff was removed by depilatory cream to ensure that the skin was intact and undamaged.

[0039] The samples were applied at 9:00 am every day, and the example 1 group and the positive control group were applied with 0.2 mL per mouse, and the blank control group was applied with the same amount of normal saline, for 15 consecutive days; each mouse was injected with DHT androgen (ABMOLE, item number M6033) intraperitoneally every day, 0.1 mg of DHT was dissolved in 10 μL of DMSO, and the injection amount was 10 mg / kg of mouse weight.

[0040] The hair growth of the mice was photographed at the same time every 5 days, and the area ratio of hair growth was calculated by Image J software; the mice were sacrificed by cervical dislocation on the 21st day, and the back skin tissue (1 cm x 1 cm) was taken, fixed with 4% paraformaldehyde for 24 h, dehydrated with gradient ethanol, embedded with paraffin, sliced at 5 μm, HE stained, and randomly selected 5 regions under 400x field of view of optical microscope (Olympus BX53) to determine the number and diameter of hair follicles, and calculate the average value.

[0041] II. Test results 1. Cell test results The cell proliferation rate of the example 1 group under the 1% concentration of the herbal active hair growth solution was increased by 45.6% compared with the blank control group, and the apoptosis rate was decreased by 32.5%, and both indicators were better than the positive control group (the cell proliferation rate was increased by 8.4% compared with the positive control group, and the apoptosis rate was decreased by 9.3%) (see Table 1, A and B). Figure 1 It is proved that the herbal active hair growth solution prepared by the formula has significant effects of promoting proliferation and inhibiting apoptosis on HHDPC.

[0042] 2. Mouse test results After 15 days, the hair growth area of the example 1 group mice reached 100%, the number of hair follicles was 48.6±5.8 / mm², and the diameter of hair follicles was 78.3±7.2 μm, which were significantly higher than those of the blank control group (30.5±3.2 / mm², 60.2±5.1 μm, P<0.05), and better than those of the positive control group (42.3±4.5 / mm², 70.5±6.3 μm) (see Table 2, A~C). Figure 2

[0043] Example 2: A herbal active hair growth solution and a preparation method and application thereof I. Formula and preparation of the herbal active hair growth solution 1. Formula of the herbal active hair growth solution Deionized water 51.25 mL, pharmaceutical grade butanediol 24 mL, Astragalus membranaceus root extract 8 g, black ganoderma extract 1 g, Angelica sinensis root extract 6 g, Cordyceps sinensis extract 5 g, ginseng extract 4 g, phenoxyethanol 0.75 mL.

[0044] 2. Preparation of the herbal active hair growth solution​ The same as Example 1.

[0045] II. Cell, animal test and membrane astragalus mongholicus glycoside content detection

[0046] 1. Cell and animal test The test design of the cell test and animal test of Example 2 group is the same as Example 1, and the test results are compared with those of Example 1 group, blank control group and positive control group.

[0047] 2. Membrane astragalus mongholicus glycoside content detection Precisely take 2.0 mL of the herb active hair growth liquid sample, place it in a 10 mL centrifuge tube with a stopper, add 5 mL of methanol, vortex for 1 min to mix evenly, place it in an ultrasonic extraction instrument, power 300 W, temperature 30°C, ultrasonic extraction for 30 min to ensure that the membrane astragalus mongholicus glycoside is fully dissolved. After extraction is completed, place the centrifuge tube in a high-speed centrifuge, centrifuge at 8000 rpm for 10 min to completely settle the insoluble impurities in the sample, and take the supernatant for standby.

[0048] Transfer the supernatant after centrifugation to a 50 mL volumetric flask, wash the inner wall of the centrifuge tube with methanol multiple times (2 mL each time, a total of 3 times), all the washing liquid is added to the volumetric flask, add methanol to the 50 mL scale line in the volumetric flask, vortex for 30 s to mix evenly, and obtain the test solution. Take 5 mL of the test solution and filter it with a needle cylinder filter, cooperate with a 0.22 μm organic phase filter membrane, discard about 1 mL of the initial filtrate, collect the subsequent filtrate, and use it for HPLC sampling.

[0049] Prepare a series of standard working solutions: precisely weigh 10.0 mg of astragalus mongholicus glycoside reference substance (Biyun Tian Biological Technology, item number SM6152-100 mg) and place it in a 10 mL volumetric flask, dissolve and dilute to the 10 mL scale with methanol, vortex to mix, obtain a 1.0 mg / mL stock solution, store it in a 4°C refrigerator away from light (validity period 7 days), and obtain the reference substance stock solution. Precisely take 0.1 mL, 0.2 mL, 0.5 mL, 1.0 mL, and 2.0 mL of the reference substance stock solution, respectively, and place it in a 10 mL volumetric flask, dilute to the 10 mL scale with methanol, mix after dilution to obtain a series of standard working solutions with concentrations of 10 μg / mL, 20 μg / mL, 50 μg / mL, 100 μg / mL, and 200 μg / mL, and use them immediately after preparation. Filter the series of standard working solutions with a 0.22 μm organic phase filter membrane, collect the subsequent filtrate for HPLC sampling.

[0050] HPLC detection conditions and operation: the mobile phase is acetonitrile-ultra pure water (v:v=30:70), which needs to be filtered through a 0.22 μm organic phase filter and ultrasonically degassed for 20 min before use; the flow rate is 1.0 mL / min; the chromatographic column is a C18 column, the column temperature is 30℃; the detection wavelength is 203 nm; the injection volume is 10 μL; the running time is 30 min.

[0051] Turn on the chromatograph and the workstation, set the above chromatographic conditions, preheat the instrument for 30 min, and then flush the chromatographic column with the mobile phase until the baseline is stable (20 min). Sample the series of standard working solutions in order from low concentration to high concentration, sample each concentration 3 times, record the chromatogram and peak area, and draw the standard curve with concentration as the abscissa and the average value of the peak area as the ordinate. After the standard curve is drawn, sample the test solution, sample each sample 3 times, record the chromatogram and peak area, and calculate the concentration of membranous huangqi astragaloside in the sample through the standard curve.

[0052] III. Test results 1. Cell test results The cell proliferation rate of the cells in the example 2 group was increased by 43.8% compared with the blank control group, and the apoptosis rate was decreased by 31.8%, which was significantly different (P<0.05), and both indicators were better than those of the positive control group (the cell proliferation rate was increased by 7.6% compared with the positive control group, and the apoptosis rate was decreased by 10.2%). Figure 3 A and B of the table.

[0053] 2. Mouse experiment results After 15 days, the hair growth area of the mice in the example 2 group was 100%, the number of hair follicles was 47.9±5.5 / mm², which was decreased by 1.4% compared with the example 1 group; the diameter of the hair follicles was 77.6±7.0 μm, which was slightly lower than that of the example 1 group but still higher than that of the positive control group (A~C of the table). Figure 4 A~C of the table.

[0054] 3. Membranous huangqi astragaloside content The content of membranous huangqi astragaloside in the herbal active hair growth liquid prepared in example 1 and example 2 was 1.05 mg / mL and 0.92 mg / mL respectively (table 1). Analysis found that the content of membranous huangqi astragaloside in the herbal active hair growth liquid of example 2 was decreased by 12.4% compared with example 1, and the HHDPC cell proliferation rate was decreased by 1.8 percentage points (example 1: 45.6%; example 2: 43.8%).

[0055] Table 1: Membranous huangqi astragaloside content detection results Example 3: A kind of herbal active hair growth liquid and its preparation method and application.

[0056] I. Formulation and preparation of herbal active hair growth solution 1. Formulation of herbal active hair growth solution Deionized water 55.75 mL, pharmaceutical grade butylene glycol 16 mL, Astragalus membranaceus root extract 12 g, black ganoderma extract 0.5 g, Angelica sinensis root extract 7 g, Cordyceps sinensis extract 6 g, ginseng extract 2 g, phenoxyethanol 0.75 mL.

[0057] 2. Preparation of herbal active hair growth solution The same as Example 1.

[0058] II. Cell, animal test and 5α-reductase activity detection 1. Cell and animal test The test design of the cell test and animal test of Example 3 group is the same as Example 1, and the test results are compared with those of Example 1 group, blank control group and positive control group; at the same time, Astragalus membranaceus single group and Angelica sinensis single group are set.

[0059] The specific formulation of the Astragalus membranaceus single group is: deionized water 62.75 mL, pharmaceutical grade butylene glycol 16 mL, Astragalus membranaceus root extract 12 g, black ganoderma extract 0.5 g, Cordyceps sinensis extract 6 g, ginseng extract 2 g, phenoxyethanol 0.75 mL.

[0060] The specific formulation of the Angelica sinensis single group is: deionized water 67.75 mL, pharmaceutical grade butylene glycol 16 mL, black ganoderma extract 0.5 g, Angelica sinensis root extract 7 g, Cordyceps sinensis extract 6 g, ginseng extract 2 g, phenoxyethanol 0.75 mL.

[0061] 2. 5α-reductase activity detection Take the skin tissue of the back of the mouse, add ice bath PBS homogenate at a ratio of 50 mg / mL, centrifuge at 4°C, 12000 rpm for 20 min, then transfer the supernatant to a new pre-cooled centrifuge tube, use 5α-reductase activity detection kit (Shanghai Biyun Tian Biological Technology Co., Ltd., item number BC4680) to detect enzyme activity, and use enzyme marker to detect OD value at 450 nm.

[0062] III. Test results 1. Cell test results The cell proliferation rate of Example 3 group is increased by 47.2% compared with the blank control group, and the apoptosis rate is decreased by 33.6%, which is significantly different (P<0.05), and both indicators are better than those of the positive control group and Example 1 group (the cell proliferation rate is increased by 12.7% compared with the positive control group, and the apoptosis rate is decreased by 14.6%; the cell proliferation rate is decreased by 1.2% compared with Example 1 group, and the apoptosis rate is increased by 10.7%). Figure 5 A and B).

[0063] 2. Results of mouse experiments In Example 3 group mice, after 15 days, the hair growth area was 100%, and the number of hair follicles was 49.2±6.0 / mm², an increase of 1.2% compared to Example 1 group; the hair follicle diameter was 79.1±7.5 μm, which was superior to the positive control group and Example 1 group. Figure 6 (A~C).

[0064] 3. 5α-Reductase Activity 5α-Reductase is a key target in androgenetic alopecia, converting testosterone to dihydrotestosterone (DHT), which inhibits hair follicle growth. Example 3 achieved a synergistic effect of inhibiting enzyme activity and promoting hair follicle proliferation by increasing the concentration of Astragalus membranaceus root extract to 12% and adjusting the concentration of Angelica sinensis root extract to 7%. Compared to the blank control, Example 3 showed an inhibition rate of 67.3% on 5α-reductase, higher than the 61.0% in Example 1 and the 60.9% in the positive control group. Figure 7 This indicates that a high proportion of Astragalus and Angelica combination can more effectively block the dihydrotestosterone production pathway. Combined with the results of cell experiments, compared with the blank control group, the cell proliferation rate increased by 47.2% and the apoptosis rate decreased by 33.6%, confirming that the herbal active hair growth liquid formulated in Example 3 can activate the proliferation signal of hair follicle stem cells while inhibiting enzyme activity, thus avoiding the limitation of "simply inhibiting enzymes but not promoting growth".

[0065] 4. Synergistic effect analysis Table 2 shows that the proliferation rate increase (47.2%) of the combination of Astragalus membranaceus root extract (12%) and Angelica sinensis root extract (7%) was higher than the theoretical sum of 39.4% when the two were used alone (the theoretical sum of the contributions of Astragalus membranaceus alone and Angelica sinensis alone without synergy. According to the Bliss independent model, the theoretical sum of 39.4% is 28.0% + 15.9% − (28.0% × 15.9%), which confirms the existence of synergistic effect.

[0066] Table 2 Results of Synergistic Effect Analysis Note: Synergy effect coefficient = (measured value / theoretical superposition value), coefficient > 1.10 indicates significant synergy; Synergy effect coefficient of Example 3 group = (measured value of value-added rate increase 47.2% / theoretical superposition value 39.4% = 1.19).

[0067] Example 4: A herbal active hair growth liquid, its preparation method and application.

[0068] I. Herbal Active Hair Growth Liquid Formula and Preparation 1. Herbal Active Hair Growth Liquid Formula Deionized water 53.25 mL, pharmaceutical grade butanediol 22 mL, Astragalus membranaceus root extract 9 g, black ganoderma extract 1.25 g, angelica root extract 6.5 g, cordyceps sinensis extract 4.5 g, ginseng extract 2.5 g, phenoxyethanol 1 mL.

[0069] 2. Preparation of the herbal active hair growth solution The same as in Example 1. After obtaining the herbal active hair growth solution, the absorbance at 280 nm was monitored by a UV spectrophotometer (UV-2600) to ensure that the absorbance was stable (RSD≤2%).

[0070] II. Cell, animal test and content detection of astragaloside IV 1. Cell and animal test The test design of the cell test and animal test of Example 4 group was the same as that of Example 1, and the test results were compared with those of Example 1 group, blank control group and positive control group.

[0071] 2. Detection of clarity and effective component solubility The absorbance of the herbal active hair growth solution at 600 nm (A600) was determined by a UV spectrophotometer, and the smaller the A600, the higher the clarity. After centrifugation of the herbal active hair growth solution at 8000 r / min for 10 min, the supernatant was taken and the contents of astragaloside IV and ferulic acid were detected by HPLC method (the detection conditions and process were the same as those in Example 2). The astragaloside IV and ferulic acid were purchased from Shanghai Aladdin Biochem Technology Co., Ltd. with the product number F103702. The detection of clarity and effective component solubility was performed at 0 day, 7 days and 14 days after the preparation of the herbal active hair growth solution, respectively, and each time point had 3 parallel samples.

[0072] III. Test results 1. Cell test results The cell proliferation rate of Example 4 group was increased by 44.5% and the apoptosis rate was decreased by 28.4% compared with the blank control group, and both indexes were better than those of the positive control group (the cell proliferation was increased by 8.9% and the apoptosis rate was decreased by 4.5% compared with the positive control group) (see Table Figure 8 A and B).

[0073] 2. Mouse test results After 15 days, the hair growth area of the mice in Example 4 group was 100%, the hair follicle number was 48.9±4.9 / mm2, and the hair follicle diameter was 78.8±7.3 μm, which were better than those of the positive control group and similar to those of Example 1 group (see Table Figure 9 A to C).

[0074] 3. Detection results of clarity and effective component solubility The A600 of Example 4 group was 0.021 (0.035 for Example 1 group), no precipitation was generated within 14 days, and the solubility was better than that of Example 1 group Figure 10 ].

[0075] The solubility of astragaloside IV was 1.12 mg / mL (1.05 mg / mL for Example 1 group), and the solubility of ferulic acid was 0.085 mg / mL (0.072 mg / mL for Example 1 group) (see Table 3, A and B), which indicated that the component allocation ratio scheme of Example 4 was more beneficial to improving the bioavailability of the effective components. Figure 11

[0076] Table 3: Comparison of solubility and performance test results of effective components Example 5: A herbal active hair growth liquid and a preparation method and application thereof.

[0077] I. Formula and preparation of the herbal active hair growth liquid 1. Formula of the herbal active hair growth liquid Deionized water 55.25 mL, pharmaceutical grade butanediol 18 mL, Astragalus membranaceus root extract 11 g, black Ganoderma lucidum extract 0.75 g, Angelica sinensis root extract 5.5 g, Cordyceps sinensis extract 5.5 g, Panax ginseng extract 3.5 g, and phenoxyethanol 0.5 mL.

[0078] 2. Preparation of the herbal active hair growth liquid Same as Example 1.

[0079] II. Cell and animal tests and detection of hair stem cell marker (CD200) expression 1. Cell and animal tests The test design of the cell and animal tests of Example 5 group was the same as that of Example 1, and the test results were compared with those of Example 1 group, blank control group, and positive control group; Cordyceps sinensis single group and Panax ginseng single group were also set.

[0080] The specific formula of the Cordyceps sinensis single group was as follows: deionized water 58.75 mL, pharmaceutical grade butanediol 18 mL, Astragalus membranaceus root extract 11 g, black Ganoderma lucidum extract 0.7 g, Angelica sinensis root extract 5.5 g, Cordyceps sinensis extract 5.5 g, and phenoxyethanol 0.5 mL.

[0081] The specific formula of the Panax ginseng single group was as follows: deionized water 60.75 mL, pharmaceutical grade butanediol 18 mL, Astragalus membranaceus root extract 11 g, black Ganoderma lucidum extract 0.75 g, Angelica sinensis root extract 5.5 g, Panax ginseng extract 3.5 g, and phenoxyethanol 0.5 mL.

[0082] ​2. CD200 expression detection The skin tissues (2 cm x 2 cm) of the depilated area of the back of each group of mice were washed with physiological saline to remove residual blood, and then were fixed in 4% paraformaldehyde at 4°C for 24 h, during which the fixing solution was replaced once. The fixed tissues were dehydrated with gradient ethanol (70%, 80%, 90%, 95%, and 100% for 30 min each), cleared with xylene (2 times for 15 min each), and embedded with wax (65°C paraffin, 3 times for 30 min each) to form wax blocks. Continuous sectioning was performed using a microtome, with a thickness of 4 μm, and the sections were attached to polylysine-coated glass slides and baked at 60°C for 2 h. After baking, the sections were dewaxed with xylene (2 times for 10 min each), rehydrated with gradient ethanol (100%, 95%, 90%, 80%, and 70% for 5 min each), and washed with distilled water twice (3 min each) to obtain the sections.

[0083] The sections were immersed in 0.01 M citrate buffer (pH 6.0), heated to boiling in a microwave oven for 15 min, naturally cooled to 25°C, and washed with PBS 3 times (5 min each); 3% H2O2 (prepared with methanol) was added dropwise to the sections, which were incubated at 25°C in the dark for 15 min, and washed with PBS 3 times (5 min each); 1% BSA-PBS solution was added dropwise to the sections, which were incubated at 37°C for 30 min, and the 1% BSA-PBS solution was removed without washing.

[0084] Primary antibody incubation: diluted CD200 primary antibody (1:200, Abeam, catalog number 124804) was added dropwise, and the sections were incubated in a wet box at 4°C for 16 h; the negative control was incubated under the same conditions using PBS instead of the primary antibody.

[0085] Secondary antibody incubation: the sections were washed with PBS 3 times (5 min each), HRP-labeled secondary antibody (1:500, Biyun Tian Biotechnology Co., Ltd., catalog number A0208) was added dropwise, and the sections were incubated at 37°C for 30 min, and washed with PBS 3 times (5 min each).

[0086] Freshly mixed DAB developing solution A and B (1:1, DAB developing kit, Biyun, catalog number P0202) were uniformly added dropwise to the sections, and the color development was observed under a microscope in real time after 5 min; the color development was terminated by immersion in distilled water; the sections were immersed in hematoxylin staining solution for 30 s, rinsed with tap water for 10 min to return to blue, differentiated with 1% hydrochloric acid ethanol for 3 s, and then washed with water for 5 min; the sections were dehydrated with gradient ethanol (70%, 80%, 90%, 95%, and 100% for 30 s each), cleared with xylene (2 times for 5 min each), mounted with neutral balsam, and dried in a well-ventilated place for microscope observation.

[0087] The CD200 positive expression was brownish yellow particles under optical microscope (200 times field), and was located in the cell membrane / cytoplasm of hair follicle stem cells. Five slices were randomly selected from each group, and five non-overlapping hair follicle dense fields were selected from each slice. The number of positive cells and the total number of cells were counted by Image-Pro Plus 6.0 software, and the positive cell ratio (%) = (number of positive cells / total number of cells) x 100% was calculated. The average value was taken as the expression level of CD200 in the group.

[0088] 3. VEGF gene expression detection When the confluence of cells in each group reached 80%, the total RNA of cells in each group was extracted using RNeasy Plus Mini Kit kit (purchased from QIAGEN, item number 74134), and the cDNA sample was prepared using the RNA reverse transcription kit (purchased from Takara, item number 638313). After dilution 20 times, it was used for qRT-PCR detection.

[0089] Selection of internal reference gene GAPDH The gene primer information is as follows: VEGF Forward primer: CTGCTGTAACGATGAAGCCCTG, SEQ ID NO. 1; VEGF Reverse primer: GCTGTAGGAAGCTCATCTCTCC, SEQ ID NO. 2; GAPDH Forward primer: TGTGGGCATCAATGGATTTGG, SEQ ID NO. 3; GAPDH Reverse primer: ACACCATGTATTCCGGGTCAAT, SEQ ID NO. 4.

[0090] The qRT-PCR reaction system (20 μL) was: 2x SYBR Green qPCR mix (purchased from Aidley, item number PC3301) 10 μL, Forward primer 1 μL, Reverse primer 1 μL, cDNA 5 μL, RNase Free D H2O 3 μL. The reaction program was: 95℃ 10 min, 95℃ 15 s, 60℃ 60 s, cycle 40 times.

[0091] III. Test results 1. Cell test results The cell proliferation rate of Example 5 group was increased by 46.3% compared with the blank control group, the apoptosis rate was decreased by 33.0%, and the expression of nutrition supply related gene (VEGF) was up-regulated (P<0.05) Figure 12A~C) of Table 1.

[0092] 2, Results of mouse experiments After 15 days, the hair growth area of the mice in Example 5 group was 100%, the number of hair follicles was 43.4±5.9 / mm2, and the diameter of the hair follicles was 79.5±7.6 μm, which was better than that of the positive control group and Example 1 group to Example 4 group (P<0.05). Figure 13 A and B of Table 1.

[0093] 3, Detection of CD200 by immunohistochemistry The results of CD200 detection are shown in Table 4. The positive rate of Example 1 group was 38.6±1.2%, which was significantly higher than that of the blank control group (23.6±1.2%, an increase of 63.6%), and was better than that of the Cordyceps group alone (33.6±1.2%, an increase of 14.9%) and the ginseng group alone (30.6±1.2%, an increase of 26.1%), indicating that the "multi-component combination" of the formula of Example 1 group promotes the proliferation of hair follicle cells, which is significantly better than "single component", proving that there is a synergistic effect between components, rather than the independent effect of a single component.

[0094] The positive rate of Example 5 group was 44.0±1.8%, which was 12.4% higher than that of Example 1 group, and was significantly higher than that of the positive control group (36.6±1.2%, an increase of +20.2%), indicating that the formula of Example 5 further strengthens the proliferation activity of hair follicle cells and directly improves the efficiency of the hair growth core mechanism at the molecular level.

[0095] Table 4 CD200 detection results 4, Correlation analysis of synergistic nourishing effect Table 5 shows that the proliferation rate of the combination of Cordyceps extract (5.5%) and ginseng extract (3.5%) (46.3%) is higher than the theoretical additive value of 39.2% when they are used alone (the contribution of the Cordyceps group alone + the contribution of the ginseng group alone, the theoretical total without synergy, according to Bliss independent model, the theoretical additive value = 27.5% + 16.2% - (27.5% x 16.2%) = 39.2%, confirming the existence of synergistic effect.

[0096] Table 5 Correlation analysis of synergistic nourishing effect Example 6: Product stability study.

[0097] The herbal active hair growth liquid prepared by Example 1 of the present application has balanced comprehensive effect, so the formula of Example 1 is used as the object of stability study.

[0098] I. Temperature stability 1, High temperature stability The herbal active hair growth liquid sample is placed in a 45℃ constant temperature box, and the appearance is observed, the pH value is measured, and the contents of effective components, astragaloside IV and ferulic acid are measured at 0d, 7d, 14d, 21d and 28d, respectively.

[0099] Table 6 High-temperature stability of the herbal active hair growth liquid The results show (Table 6) that under high-temperature conditions, the appearance of the herbal active hair growth liquid is a light yellow clear liquid without precipitation and stratification within 28d; the pH value changes from the initial 5.50 to 5.39 with a fluctuation of ≤0.1; the retention rate of astragaloside IV is 98.2%, and the retention rate of ferulic acid is 97.3%.

[0100] 2. Low-temperature stability The herbal active hair growth liquid sample is placed in a -5℃ refrigerator, and the appearance is observed, the pH value is measured, and the contents of effective components (astragaloside IV and ferulic acid) are measured at 0d, 7d, 14d, 21d and 28d, respectively. After recovering to room temperature, whether stratification occurs is observed.

[0101] Table 7 Low-temperature stability of the herbal active hair growth liquid The results show (Table 7) that under low-temperature conditions, the herbal active hair growth liquid sample does not freeze out, and the appearance of the herbal active hair growth liquid is a light yellow clear liquid without precipitation and stratification within 28d, and the homogeneity is good after recovering to room temperature; the pH value changes from the initial 5.50 to 5.43 with a fluctuation of ≤0.1; the retention rate of astragaloside IV is 97.2%, and the retention rate of ferulic acid is 96.7%.

[0102] II. Light stability The herbal active hair growth liquid is irradiated under a 4500 lx ultraviolet lamp, and the appearance is observed, the pH value is measured, and the contents of effective components (astragaloside IV and ferulic acid) are measured at 0d, 7d, 14d, 21d and 28d, respectively.

[0103] Table 8 Light stability of the herbal active hair growth liquid The results show (Table 8) that after 28d of irradiation, the retention rate of the effective components of the herbal active hair growth liquid is all ≥95%, which meets the cosmetic stability evaluation standard (QB / T 1857-2013), indicating that the product has excellent stability.

[0104] The results of the stability study part show that the herbal active hair growth liquid product prepared by the present application has excellent stability under extreme environments, low degradation rate of effective components, and meets the industrial storage and transportation requirements.

[0105] Although preferred embodiments of the application have been described herein, additional alternatives, modifications, and variations can be made thereto by those skilled in the art, once given the benefit of the foregoing description, without departing from the spirit and scope of the underlying inventive concepts.

[0106] Obviously, numerous modifications and variations of the present application are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described.

Claims

1. A herbal active hair growth tonic, characterized in that, Each 100 mL of the herbal active hair growth solution is made of the following components: 16 mL~24 mL of butanediol, 8 g~12 g of Astragalus membranaceus Bunge root extract, 0.5 g~1.25 g of black Ganoderma lucidum extract, 5.5 g~7 g of Angelica sinensis root extract, 4.5 g~6 g of Cordyceps sinensis extract, 2 g~4 g of Panax ginseng extract, 0.5 mL~1 mL of phenoxyethanol, and the rest of water.

2. The herbal active hair growth liquid according to claim 1, characterized by, The purity of the Astragalus membranaceus Bunge root extract is ≥98%, and the polysaccharide content of the black Ganoderma lucidum extract is ≥30%.

3. The herbal active hair growth tonic as set forth in claim 1, characterized by, The ferulic acid content of the Angelica sinensis root extract is ≥0.1%, the adenosine content of the Cordyceps sinensis extract is ≥0.3%, and the ginsenoside Rg1 content of the Panax ginseng extract is ≥2.0%.

4. A process for the preparation of the herbal active hair growth fluid as claimed in claim 1, wherein, The method comprises the following steps: The water and butanediol are stirred at 250 r / min~350 r / min for 10 min~20 min; the Astragalus membranaceus Bunge root extract, the black Ganoderma lucidum extract, the Angelica sinensis root extract, the Cordyceps sinensis extract, and the Panax ginseng extract are sequentially added, and the temperature is raised to 40℃~50℃, and the stirring is performed at 350 r / min~450 r / min for 25 min~35 min to obtain a first solution; The temperature is lowered to 20℃~30℃, the phenoxyethanol is added, and the stirring is performed at 150 r / min~250 r / min for 5 min~15 min to obtain a second solution; and the vacuum standing and defoaming are performed to obtain the herbal active hair growth solution.

5. The method of preparing the herbal active hair growth tonic as claimed in claim 4, wherein, The standing and defoaming time is 15 min~25 min.

6. The method of preparing the herbal active hair growth tonic as claimed in claim 4, wherein, The particle size of the Astragalus membranaceus Bunge root extract, the black Ganoderma lucidum extract, the Angelica sinensis root extract, the Cordyceps sinensis extract, and the Panax ginseng extract in the first solution is ≤5 μm.

7. Use of the herbal active hair growth solution according to claim 1 for the preparation of a hair growth product, characterized in that, The functions of the hair growth product include improving the hair density, the number of hair follicles, and the diameter of hair follicles.

8. Use of the herbal active hair growth solution according to claim 7 in the preparation of a hair growth product, characterized in that, The functions of the hair growth product also include promoting the proliferation of human hair follicle outer root sheath cells and / or inhibiting the apoptosis thereof.

Images