Cynoglossus semilaevis IgM monoclonal antibody

Abstract

The invention discloses a cynoglossus semilaevis IgM monoclonal antibody, which is characterized in that screened cynoglossus semilaevis hybridoma No.39 is sequenced to obtain nucleotide and amino acid sequences of variable regions of a heavy chain and a light chain of the targeted cynoglossus semilaevis IgM monoclonal antibody as shown in SEQ ID NO.1-12, the heavy chain subtype is IgG type, the light chain is kappa type, and the nucleotide and amino acid sequences of the variable regions of the heavy chain and the light chain of the targeted cynoglossus semilaevis IgM monoclonal antibody are subjected to codon optimization to obtain the cynoglossus semilaevis IgM monoclonal antibody. And constructing recombinant pATX1 vectors of heavy-chain and light-chain antibodies with a constant region sequence of a murine antibody respectively. The cynoglossus semilaevis IgM monoclonal antibody is cultured and expressed in vitro through co-transfection of XtenCHO cells, the chimeric immunoglobulin is good in reaction characteristic and high in titer (128000 or above), the chimeric immunoglobulin is easier to store compared with a hybridoma cell mode, and the risk of losing the specific antibody is avoided.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a high-potency, easy-to-store IgM monoclonal antibody against half-smooth tongue sole. Background Technology

[0002] Half-smooth tongue sole (Cynoglossus semilaevis) is a high-end economic fish known for its high meat yield, smooth texture, ability to remain tender even after prolonged cooking, and rich protein content. However, with the expansion of factory farming, water quality deterioration and disease problems have become increasingly serious. Bacterial invasions have caused significant economic losses to the half-smooth tongue sole farming industry. The overuse of antibiotics and chemical drugs in the treatment of fish diseases has led to severe drug resistance in pathogens, which accumulate in the environment, putting enormous pressure on the ecosystem, affecting the quality of aquatic products, endangering consumer health, and seriously impacting the industry's reputation and public health. Fish vaccines, while improving the fish's specific immunity and enhancing their stress resistance, meet the requirements of not polluting the environment and leaving no drug residues in aquatic products, and have become the mainstream product in the global aquatic animal disease prevention and control field.

[0003] Antibodies are immunoglobulins secreted by plasma cells (effector B cells) in vertebrates during immune responses to internal and external antigenic stimuli. They bind specifically to corresponding antigens and possess immunogenic functions. Immunoglobulin M (IgM) is the most important mediator in fish-specific immune responses, and the serum IgM titer has become a relatively ideal and reliable indicator of the immune level in aquatic animals. In recent years, researchers have prepared monoclonal antibodies against IgM in different fish species to systematically evaluate the primary and secondary humoral immune responses in fish after antigen stimulation or vaccination, providing an effective means for immune monitoring. This indicator is of significant scientific value for elucidating changes in the immune capacity of fish during growth, development, and disease occurrence, as well as revealing the influence of the external environment on their immune function.

[0004] However, most fish IgM monoclonal antibodies are currently preserved using hybridoma technology. This method has problems such as stringent preservation conditions, insufficient stability, and large fluctuations in resuscitation survival rates. It can easily lead to chromosome loss or mutation in hybridoma cells, thereby affecting or even eliminating their antibody secretion ability. Although many studies have focused on fish IgM antibodies, so far, there are no reports on high-potency, easily preserved half-smooth tongue sole IgM monoclonal antibodies. Summary of the Invention

[0005] The present invention aims to solve the above-mentioned technical problems existing in the prior art and provide a high-potency, easy-to-store IgM monoclonal antibody against tongue sole.

[0006] The technical solution of this invention is: a semi-smooth tongue sole IgM monoclonal antibody, comprising a heavy chain and a light chain, wherein the DNA sequences of the three complementarity-determining regions of the variable region of the light chain are as follows: CDR1: CAGAGCCTTTATATAGTAGCAATCAAAAGAACTAC; CDR2: TGGGCATCC; CDR3: CAGCAATATTATACCTATCCATTCACG; The DNA sequences of the three complementarity-determining regions of the heavy chain variable region are as follows: CDR1: GGCTACACCTTCACTGACTACTAT; CDR2:ATTTATCCTGGAAGTGGTCATACT; CDR3: GCCTCGTATGGGTACGACGGGCCCTGGTTTGCTTAC.

[0007] The amino acid sequences of the three complementarity-determining regions of the light chain variable region are as follows: CDR1: QSLLYSSNQKNY; CDR2: WAS; CDR3: QQYYTYPFT.

[0008] The amino acid sequences of the three complementarity-determining regions of the heavy chain variable region are as follows: CDR1: GYTFTDYY; CDR2: IYPGSGHT; CDR3: ASYGYDGPWFAY.

[0009] This invention sequenced the selected half-smooth tongue sole hybridoma cell line 39 to obtain the nucleotide and amino acid sequences of the variable regions (CDRs) of the heavy and light chains of a half-smooth tongue sole IgM monoclonal antibody. The heavy chain subtype was IgG, and the light chain subtype was κ. Through codon optimization, recombinant pATX1 vectors for the heavy and light chains were constructed using the constant region sequences of a murine antibody, respectively. The half-smooth tongue sole IgM monoclonal antibody was expressed in vitro by co-transfection into XtenCHO cells. This chimeric immunoglobulin exhibited good reactivity and high titer (above 128,000), and was easier to preserve than hybridoma cells, avoiding the risk of losing this specific antibody. Attached Figure Description

[0010] Figure 1 This is an SDS-PAGE result of purified serum IgM from half-smooth tongue sole in Example 1 of this invention.

[0011] Figure 2This is a WB analysis result of the monoclonal antibody secreted by hybridoma cell line 39, which was screened in an embodiment of the present invention.

[0012] Figure 3 This is an indirect immunofluorescence image of the monoclonal antibody secreted by hybridoma cell line 39, which was screened in an embodiment of the present invention.

[0013] Figure 4 This is a schematic diagram of the monoclonal antibody nucleotide and amino acid sequence secreted by hybridoma cell line 39 screened in an embodiment of the present invention.

[0014] Figure 5 This is a diagram illustrating the construction of the 39-VH recombinant plasmid according to an embodiment of the present invention.

[0015] Figure 6 This is a diagram illustrating the construction of the 39-VL recombinant plasmid according to an embodiment of the present invention.

[0016] Figure 7 This is a WB analysis result of the exogenously expressed antibody in an embodiment of the present invention.

[0017] Figure 8 This is an indirect immunofluorescence image of the exogenously expressed antibody in an embodiment of the present invention. Detailed Implementation

[0018] I. Screening of hybridoma cell lines secreting IgM monoclonal antibodies against half-smooth tongue sole (as described in this invention) 1. Purification of IgM from the serum of half-smooth tongue sole Blood was collected from the tail vein of healthy tongue soles, left at room temperature for 1 hour, and then incubated overnight at 4 °C. The next day, the sample was centrifuged at 3000 g for 20 min, and the supernatant serum was collected. The serum was mixed with an equal volume of PBS, and saturated ammonium sulfate was added dropwise until the final ammonium sulfate mass fraction was 50%. After thorough stirring, the mixture was incubated overnight at 4 °C. The next day, the sample was centrifuged at 12000 g for 30 min, and the precipitate was collected. The precipitate was dissolved in an appropriate amount of 0.02 M sodium phosphate buffer, placed in a dialysis bag, and dialyzed against the same buffer to remove ammonium sulfate. The dialyzed sample was filtered through a 0.22 μm filter and further purified by loading it into a pre-equilibrated Protein A affinity chromatography column. IgM protein was further concentrated by ultrafiltration. The purity of IgM protein was determined by SDS-PAGE electrophoresis, and the concentration of IgM protein was determined using the Bradford method. The IgM protein concentration was approximately 0.7 mg / mL.

[0019] SDS-PAGE electrophoresis results are as follows: Figure 1 As shown. From Figure 1 It can be seen that there are two main protein bands with relative molecular masses of 75 kDa and 25 kDa, respectively, which correspond to the heavy chain and light chain of the tongue sole IgM.

[0020] 2. Preparation of hybridoma cells Four-week-old BALB / c mice were immunized with tongue sole IgM as the antigen in four doses, each dose being 0.1 mL. The specific immunization procedure was as follows: basal immunization: tongue sole IgM was mixed with Freund's complete adjuvant in an equal ratio and administered via intraperitoneal injection; two weeks later, the first booster immunization: tongue sole IgM was mixed with Freund's incomplete adjuvant in an equal ratio and administered via intraperitoneal injection; three weeks later, the second booster immunization was administered via tail vein injection without adjuvant; four weeks later, the third booster immunization was administered via tail vein injection without adjuvant; three days after the third booster immunization, the mice were sacrificed by cervical dislocation, and the spleen was harvested for cell fusion.

[0021] Under aseptic conditions, spleen cells from immunized mice were fused with SP2 / 0 myeloma cells using 45% PEG1500. The fused cells were resuspended in HAT selective culture medium and added to 0.2 ml of feeder cells in 96-well cell culture plates. The plates were incubated at 37°C with 5% CO2 and the growth of hybridoma cells was observed using an inverted phase-contrast microscope. After approximately two weeks, the supernatant from the hybridoma cells was collected for analysis.

[0022] 3. Positive screening using indirect enzyme-linked immunosorbent assay (ELISA) The ELISA assay procedure is as follows: Coat the microplate with tongue sole IgM (5 μg / ml, 100 μl / well) and incubate overnight at 4 °C; wash three times with PBST for 5 min each time; block with 3% bovine serum albumin (BSA) (200 μl / well) and incubate at 37 °C for 1 h; wash three times with PBST for 5 min each time; add 100 μl / well of hybridoma cell culture supernatant (using myeloma cell culture supernatant as a negative control) and incubate at 37 °C for 1 h; wash three times with PBST for 5 min each time; add 100 μl / well of HRP-labeled goat anti-mouse Ig (1:3000) and incubate at 37 °C for 1 h; wash three times with PBST for 5 min each time; add 100 μl / well of TMB chromogenic solution and incubate at 37 °C in the dark for 30 min; add 50 μl of chromogenic stop solution. μl / well, read the OD value at 450 nm using an ELISA reader; a positive result is determined when the positive OD / negative OD (P / N) ratio is greater than 2.1.

[0023] 4. Positive hybridoma cell clones secreting IgM monoclonal antibodies against half-smooth tongue sole Positive hybridoma cells were cloned using the limiting dilution method. The positive hybridoma cells were resuspended in 1640 medium and serially diluted 10-fold to 10⁻⁶. 2Cells / ml: Take 1 ml of cell culture and add it to 9 ml of culture medium. Mix well and drop 0.1 ml into each well of a 96-well cell culture plate containing feeder cells. Select a well with only one hybridoma cell. When the cell has grown to more than 2 / 3 of the bottom of the well, take the supernatant and test it according to the method in step 3 above. The positive wells are cloned twice more according to the above method to obtain hybridoma cells that secrete IgM monoclonal antibodies against half-smooth tongue sole serum.

[0024] 5. Analysis of the recognition antigen determinants of serum IgM monoclonal antibodies secreted by hybridomas in half-smooth tongue sole Purified tongue sole serum IgM was transferred to a PVDF membrane after SDS-PAGE and electroporated at 200 mA for 1.5 h. The membrane was then blocked overnight at 4 °C with 5% BSA. After washing with PBST, the PVDF membrane was placed in the IgM monoclonal antibody to be detected and incubated overnight at 4 °C. After washing with PBST, the membrane was placed in HRP-labeled goat anti-mouse Ig and incubated on a shaker at room temperature for 1 h. The membrane was then washed with PBST again. Equal amounts of Enhanced Luminol Reagent and Oxidizing Reagent were diluted with an appropriate amount of ddH2O, mixed, and dropped onto a sealing film. The PVDF membrane was placed face down in contact with the luminescent reagent, and color development was performed for 1.5–2.0 min. The PVDF membrane was then flipped over, and the results were observed using a gel imaging system.

[0025] 6. Analysis of the binding of serum IgM monoclonal antibodies secreted by hybridoma cells to leukocytes in half-smooth tongue sole. A discontinuous density gradient separation system was prepared using two different concentrations of Percoll cell separation medium (1.070 g / mL and 1.035 g / mL) at a density gradient of 2 mL. Blood from half-smooth tongue sole was mixed with an equal volume of cell culture medium (L-15 medium) and added to the discontinuous density gradient separation system. The mixture was centrifuged at 800 g for 20 min at 4 ℃, and the intermediate layer of leukocytes was collected and placed on a glass slide. The slide was incubated in a humidified chamber at room temperature for 20 min, and fixed with 4% paraformaldehyde for 10 min. After washing, 100 μL of the IgM monoclonal antibody to be detected was added, and the slide was incubated at 37 ℃ for 1 h. After washing, 100 μL of FITC-labeled goat anti-mouse IgG diluted 1:250 was added, and the slide was incubated at 37 ℃ for 1 h. After washing, DAPI anti-fluorescence attenuation mounting medium was added, and the slide was observed under a fluorescence microscope.

[0026] result: Through antigen immunization, cell fusion, ELISA screening, and limiting dilution cloning, a hybridoma cell line 39 secreting a monoclonal antibody against tongue sole IgM was obtained. The ELISA screening results are shown in Table 1. Western blotting revealed that the monoclonal antibody secreted by the selected hybridoma cell line 39 recognizes the tongue sole IgM antigenic determinant located on the heavy chain of IgM. Figure 2 Indirect immunofluorescence results showed that the monoclonal antibody secreted by hybridoma cell line 39 could bind to mIgM on the surface of leukocytes in the blood of half-smooth tongue sole, and positive cells showed punctate green fluorescence on their surface. Figure 3 ).

[0027] Table 1. ELISA screening of hybridoma cell lines

[0028] II. Sequencing and vector construction of IgM monoclonal antibody secreted by hybridoma cell 39 of *Sinocyclocheilus smoothie*. 1. Sequencing of monoclonal antibodies VH and VL secreted by hybridoma cells 39 of *Sinomorphus spathulatus*. The IgM monoclonal antibody gene secreted by the above-mentioned half-smooth tongue sole IgM hybridoma cell line 39 was sent to Pujian Biotechnology (Wuhan) Co., Ltd. for hybridoma antibody gene profiling sequencing (HybSeq-HTTM). The hybridoma antibody sequencing experimental procedure included RNA extraction using the Trizol method, cDNA acquisition by reverse transcription of the sample, amplification of the heavy and light chain variable region sequences, construction of recombinant vectors, sequencing library construction, and analysis. After sequencing, the sequencing results were compared with the IMGT database to extract CDR1, CDR2, and CDR3 information of the antibody VH and VL sequences. For each sample, the 10 sequences with the highest abundance were selected for abundance analysis, and the sequence ranked first was considered the target gene sequence. Specific sequences are shown in [link to specific sequences]. Figure 4 . Figure 4 The information marked in red in the middle is the CDR1, CDR2 and CDR3 information of the antibody VH and VL sequences, and the specific sequences can be found in SEQ ID NO.1-12.

[0029] 2. Synthesis and construction of monoclonal antibody gene plasmid secreted by half-smooth tongue sole hybridoma cell No. 39 The antibody heavy and light chains were selected and constructed on the pATX1 empty vector, named 39-VH and 39-VL, respectively. Figure 5 , 6 To improve antibody affinity, codon optimization was performed, and the chimeric antibody was fused with the constant region of a murine antibody while retaining the variable region. The resulting chimeric antibody was then co-transfected with the 39-VH and 39-VL recombinant plasmids into XtenCHO cells for endocrine expression. Western blot results ( Figure 7The results showed that the exogenously expressed antibody detected a highly specific target band, indicating that the antibody secreted by half-smooth tongue sole IgM hybridoma cell 39 has been successfully expressed.

[0030] III. Detection of Antibody Subtypes and Titers of Exogenously Expressed 39-VH and 39-VL Recombinant Plasmids in Examples of the Invention 1. Detection of IgM monoclonal antibody subtypes secreted by exogenous expression of tumor cells 39 The 39-VH and 39-VL recombinant plasmids were co-transfected into XtenCHO cells for endocrine expression. On day 10 post-transfection, the culture supernatant was collected for low endotoxicity purification, and the antibody subtype was identified as IgG 2b.

[0031] 2. Detection of the titer of exogenously expressed IgM monoclonal antibody secreted by hybridoma cell No. 39 The titer of exogenously expressed antibody 39 was determined by indirect ELISA. The coating antigen was half-smooth tongue sole IgM, and the coating concentration was 5 μg / ml, 100 μl / well. The titer of exogenously expressed antibody 39 was above 128,000 (Table 2).

[0032] Table 2 Results of titer detection for exogenously expressed antibody 39

[0033] 3. Indirect immunofluorescence of exogenous expression of antibody 39 Leukocytes from the tongue sole were collected, and the cell nuclei were stained with DAPI. Indirect immunofluorescence detection was performed using exogenously expressed antibody 39. Results showed that exogenously expressed antibody 39 could bind to mIgM on the surface of leukocytes, and positive cells exhibited green dotted fluorescent signals. Figure 8 ).

Claims

1.A Cynoglossus semilaevis IgM monoclonal antibody comprising a heavy chain and a light chain, characterized in that: the DNA sequences of the three complementarity determining regions of the light chain variable region are respectively: CDR1: CAGAGCCTTTTATATAGTAGCAATCAAAAGAACTAC; CDR2: TGGGCATCC; CDR3: CAGCAATATTATACCTATCCATTCACG; the DNA sequences of the three complementarity determining regions of the heavy chain variable region are respectively: CDR1: GGCTACACCTTCACTGACTACTAT; CDR2: ATTTATCCTGGAAGTGGTCATACT; CDR3: GCCTCGTATGGGTACGACGGGCCCTGGTTTGCTTAC. 2.The Cynoglossus semilaevis IgM monoclonal antibody of claim 1, characterized in that: the amino acid sequences of the three complementarity determining regions of the light chain variable region are respectively: CDR1: QSLLYSSNQKNY; CDR2: WAS; CDR3: QQYYTYPFT; the amino acid sequences of the three complementarity determining regions of the heavy chain variable region are respectively: CDR1: GYTFTDYY; CDR2: IYPGSGHT; CDR3: ASYGYDGPWFAY.

Images