Construction method and application of alpha-farnesene-producing pichia pastoris
By integrating farnesene synthesis genes into Pichia pastoris and performing metabolic optimization and mutagenesis screening, a high-yield α-farnesene engineered strain was constructed, solving the problems of low farnesene production efficiency and high cost in existing technologies, and achieving the effects of efficient biosynthesis and cost reduction.
Patent Information
- Application Number
- CN202511342253.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-19
- Publication Date
- 2026-01-23
AI Technical Summary
The current industrial production of α-farnesene relies on chemical synthesis or plant extraction, which has problems such as high energy consumption, high cost, heavy environmental burden and low yield. Furthermore, there is no clear plan for Pichia pastoris in the construction of a farnesene production system.
By integrating farnesene synthesis-related genes into Pichia pastoris CICC 1958, combined with metabolic pathway optimization and ARTP mutagenesis screening, an engineered strain producing high levels of α-farnesene was constructed, and fermentation conditions were optimized to improve synthesis efficiency.
The efficient biosynthesis of α-farnesene was achieved, with yields of 3.05 g/L (based on methanol) and 30.66 g/L (based on glucose), reducing production costs and demonstrating potential for industrial application.
Smart Images
Figure CN121379843A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for constructing an α-farnesene-producing Pichia pastoris strain and its application, belonging to the field of biotechnology. Background Technology
[0002] α-Farnesene is an important sesquiterpene natural product with wide applications in biofuels, fragrances, lubricants, pharmaceutical intermediates, and chemical raw materials due to its unique structure and broad functional properties. Currently, the industrial production of farnesene mainly relies on traditional chemical synthesis methods or extraction from plants. However, chemical synthesis processes are typically energy-intensive, complex, and involve harmful catalysts and solvents, resulting in a heavy environmental burden. Plant extraction methods are limited by the area of raw material cultivation, low extraction efficiency, and seasonal fluctuations, leading to high production costs and making it difficult to meet the growing market demand.
[0003] Microbial fermentation, as a green and sustainable production method, has attracted much attention in recent years due to its advantages of minimal environmental impact, high resource utilization, and efficient product synthesis through metabolic engineering. Among them, Pichia pastoris, as a model strain, has become an ideal host for the microbial synthesis of sesquiterpenes such as farnesene due to its unique biological characteristics. Specifically, compared with other industrial chassis, Pichia pastoris has the following significant advantages: ① Highly efficient exogenous protein expression capability. Pichia pastoris possesses a powerful protein expression system, enabling high-level expression of exogenous genes, which can greatly improve the activity and yield of enzymes related to farnesene synthesis. ② Good genetic manipulation convenience. Pichia pastoris has mature molecular biology tools and gene editing technology support, with high homologous recombination efficiency, facilitating the integration and regulation of multiple genes, and making it easy to construct complex metabolically engineered strains to optimize the farnesene synthesis pathway. ③ Strong tolerance and high-density fermentation capability. Pichia pastoris can tolerate high levels of ethanol, methanol, acetic acid, etc., making it suitable for industrial-scale high-density fermentation, which can significantly improve the production efficiency and economic benefits of farnesene. In addition, it has strong adaptability to culture conditions and can grow stably in various culture media and fermentation modes. ④ Safety and industrial application potential. Pichia pastoris, as a widely recognized food-grade microbial host, has good safety profile and is suitable for producing farnesene products for use in food, pharmaceuticals, and other fields, which is conducive to subsequent industrialization and promotion.
[0004] However, whether Pichia pastoris can be used to construct an α-farnesene production system, and how to construct such a system, remains unknown. Therefore, the goal is to develop a highly efficient α-farnesene synthesis platform based on Pichia pastoris, aiming to find a key technological breakthrough for promoting the green carbon-neutral manufacturing and industrialization of α-farnesene. Summary of the Invention
[0005] To address the common technical problems in existing industrial production of α-farnesene, such as low yield, high production cost, reliance on chemical synthesis or plant extraction, and heavy environmental burden, this invention provides a method for constructing a high-yield α-farnesene-producing Pichia pastoris yeast strain and its application. Using wild-type Pichia pastoris CICC 1958 as the starting strain, by integrating and efficiently expressing farnesene synthesis-related genes into the genome, combined with metabolic pathway optimization and mutagenesis screening, a high-yield α-farnesene-producing engineered strain was obtained. Further optimization of fermentation conditions enabled industrial-scale, highly efficient biosynthesis of α-farnesene.
[0006] The first technical solution provided by this invention is a yeast engineered strain that produces α-farnesene. The yeast engineered strain uses Pichia pastoris as the starting strain. In the starting strain, the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI, and apple tree-derived α-farnesene synthase are overexpressed from Pichia pastoris. The truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is missing amino acids 1-552 of the parent 3-hydroxy-3-methylglutaryl-CoA reductase.
[0007] In some embodiments, the amino acid sequence of the 3-hydroxy-3-methylglutaryl-CoA reductase parent is shown in GenBank:ANZ76226.1, and the amino acid sequence of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is shown in SEQ ID NO.1.
[0008] In some embodiments, the amino acid sequence of isopentenyl pyrophosphate isomerase IDI is shown in GenBank:ANZ76675.1.
[0009] In some embodiments, the amino acid sequence of α-farnesene synthase MdAFS is shown in GenBank:AAO22848.2.
[0010] In the MVA pathway enhancement module, the aforementioned engineered strains overexpressed a truncated 3-hydroxy-3-methylglutaryl-CoA reductase (tHMG1) gene, deleting amino acids 1-552 and retaining only the catalytic domain to avoid feedback degradation. The amino acid sequence is shown in GenBank:ANZ76226.1. In the farnesene synthesis module, isopentenyl pyrophosphate isomerase (IDI, amino acid sequence shown in GenBank:ANZ76675.1) and apple-derived α-farnesene synthase (MdAFS, amino acid sequence shown in GenBank:AAO22848.2) were overexpressed to improve the catalytic efficiency of key synthetic steps.
[0011] In some embodiments, the starting strain of the Pichia pastoris is P. pastoris CICC 1958.
[0012] The present invention also provides a method for mutagenesis of the high-yielding Pichia pastoris engineered strain of α-farnesene, the method comprising: performing ARTP mutagenesis on the yeast engineered strain described in the first technical solution, introducing random mutations throughout the genome to construct a mutant library, and obtaining a high-yielding α-farnesene strain through multiple rounds of screening.
[0013] In some implementations, the conditions for ARTP mutagenesis are: 100W RF power input, pure helium working gas, flow rate of 10.0 SLM, effective processing distance of 2.0 mm, and processing time of 90 s.
[0014] The second technical solution provided in this invention is a strain of Pichia pastoris mut008, which was deposited at the China General Microbiological Culture Collection Center on September 10, 2025, with accession number CGMCC No. 35873.
[0015] The third technical solution provided by the present invention is a microbial preparation containing Pichia pastoris mut008 as described in the second technical solution.
[0016] The fourth technical solution provided by the present invention is a fermentation agent containing Pichia pastoris mut008 as described in the second technical solution, or a microbial preparation as described in the third technical solution.
[0017] The fifth technical solution provided by the present invention is a method for fermenting to produce α-farnesene. The method involves adding the engineered yeast strain described in the first technical solution, the Pichia pastoris mut008 strain described in the second technical solution, the microbial preparation described in the third technical solution, or the fermentation agent described in the fourth technical solution to a fermentation system using methanol or glucose as a carbon source to synthesize α-farnesene through fermentation.
[0018] In some implementations, dodecane (20%, v / v) is added to the culture medium at the start of fermentation as an organic phase extractant.
[0019] In some implementations, the initial methanol concentration for fermentation is 10 g / L, and when the methanol concentration is below 2 g / L, methanol is added to maintain it at 1-2 g / L.
[0020] In some implementations, the pH is controlled at 6.0±0.2, dissolved oxygen at 20-30%, and temperature at 30±0.5℃ during fermentation.
[0021] In some implementations, the initial glucose concentration for fermentation is 40 g / L, and when the glucose concentration is below 2 g / L, methanol is added to maintain it at 0.5-2 g / L.
[0022] In some implementations, the pH is controlled at 6.0±0.2, dissolved oxygen at 20-30%, and temperature at 30±0.5℃ during fermentation.
[0023] The sixth technical solution provided by this invention is the application of the yeast engineered strain described in the first technical solution, the Pichia pastoris mut008 described in the second technical solution, the microbial preparation described in the third technical solution, the fermentation agent described in the fourth technical solution, or the method described in the fifth technical solution in the preparation of α-farnesene or products containing α-farnesene.
[0024] This invention also provides the application of the Pichia pastoris engineered strain and its α-farnesene production method in the chemical, food, and fragrance fields.
[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0026] This invention discloses a novel Pichia pastoris engineered strain with the ability to efficiently synthesize α-farnesene. Through metabolic pathway optimization and high expression of key enzymes, this strain significantly improves the carbon flux allocation efficiency of substrates to α-farnesene. The superior Pichia pastoris strain mut008, obtained through ARTP mutagenesis and multiple rounds of screening, achieved a yield of 3.05 g / L in a 5L fermenter with methanol as the substrate, initially meeting the industrial production level required for C1 substrate utilization; with glucose as the substrate, the yield reached 30.66 g / L, which can reduce industrial production costs.
[0027] Preservation of biological materials
[0028] Pichia pastoris mut008, taxonomically named Pichia pastoris, was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, China, with accession number CGMCC No. 35873. Attached Figure Description
[0029] Figure 1 The image shows the spectrum of plasmid PGAPZA-tHMG1-IDI-AFS in Example 1 of this invention.
[0030] Figure 2The agarose gel electrophoresis used for PCR verification of the strain constructed in Example 1 of this invention shows that lane 1 represents a 5000bp marker, and the other lanes represent different single-point bacteria. The colonies circled in red are those with correct bands.
[0031] Figure 3 This represents the initial screening yield of the ARTP mutagenized strain in Example 2 of this invention.
[0032] Figure 4 This represents the yield of the ARTP mutagenized strain in Example 2 of this invention during secondary screening.
[0033] Figure 5 This is the result of fermentation culture of the mutant engineered strain P. pastoris mut008 in a 5L fermenter using methanol as a substrate, as described in Example 3 of this invention.
[0034] Figure 6 This is the result of fermentation culture of the mutant engineered strain P. pastoris mut008 in a 5L fermenter using glucose as a substrate, as described in Example 4 of this invention. Detailed Implementation
[0035] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.
[0036] Test method:
[0037] α-Farnese determination method: Quantitative analysis was performed using high-performance liquid chromatography (HPLC). First, the dodecane coating layer was collected and centrifuged at 12,000 rpm for 20 minutes. The supernatant was collected, diluted with HPLC-grade methanol, and analyzed using an UltiMate 3000 HPLC system (Thermo Fisher, Germany). Chromatographic separation was performed using a ZORBAX Eclipse XDB-C18 column (4.6 mm × 250 mm, 5 μm). The mobile phase was a mixture of methanol, acetonitrile, and water at a ratio of 90:5:5 (v / v / v), with a flow rate of 0.8 mL / min. The column temperature was maintained at 40 °C, and the detection wavelength was 232 nm.
[0038] Methanol determination method: The Shenzhen Xierman Biosensor Analyzer M-100 was used for detection.
[0039] Biomass determination method: Shimadzu UV-Vis spectrophotometer was used for detection. The absorbance of the fermentation broth at a wavelength of 600 nm was measured.
[0040] Raw materials used in the examples:
[0041] LB medium: 10 g / L NaCl, 5 g / L yeast extract, 10 g / L peptone. LB medium is used for the construction and purification of free expression vectors.
[0042] YNB medium: 6.67 g / L yeast basal nitrogen source, 20 g / L glucose.
[0043] YPD medium: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone.
[0044] MM medium: 6.67 g / L yeast basal nitrogen source.
[0045] 1000× Trace element solution (4.5 g / L ZnSO4·7H2O, 1 g / L MnCl2·4H2O, 3.0 g / L FeSO4·7H2O, 300 mg / L CuSO4·5H2O, 300 mg / L CoCl2·6H2O, 400 mg / L Na2MoO4·2H2O, 1 g / L H3BO3, 4.5 g / L CaCl2·2H2O, 100 mg / L KI, 19 g / L Na2EDTA·2H2O) and 1000× Vitamin solution (50 mg / L Biotin, 1.0 g / L Thiamine Hydrochloride, 1.0 g / L Pyridoxine Hydrochloride, 1.0 g / L Calcium Pantothenate, 1.0 g / L Nicotinic Acid, 0.2 g / L Para-aminobenzoic Acid, 25 g / L Inositol).
[0046] Adding 1.5-2% agar powder to the above-mentioned culture medium can prepare the corresponding solid culture medium.
[0047] The reagents used were purchased from Sinopharm and Maclean's.
[0048] Example 1: Construction of an engineered Pichia pastoris strain with enhanced mevalonate (MVA) and farnesene synthesis pathways.
[0049] In this embodiment, P with strong constitutive expression characteristics is selected during the construction process. GAP The promoter drives the expression of the target gene. The gene was cloned into the multiple cloning site of the pGAPZA vector using the ClonExpress II One Step Cloning Kit (Vazyme Biotech) to form the PGAPZA-tHMG1-IDI-AFS expression vector.
[0050] To achieve genome integration, the Zeocin resistance selection marker in the pGAPZA vector and its application in P... GAPEach construct was linearized using a single restriction endonuclease site in the promoter region and then introduced into Pichia pastoris competent cells via electroporation. Transformants were obtained by Zeocin plate selection, and PCR was used to verify that the target gene had been correctly integrated into the genome.
[0051] The obtained positive transformants were further cultured, and the screening markers were recovered using the Cre / loxP system to achieve multi-round gene integration, ultimately obtaining an engineered strain that simultaneously integrates the tHMG1, IDI, and MdAFS genes.
[0052] Specifically, primers were designed based on the tHMG1 nucleotide sequence, IDI nucleotide sequence, MdAFS nucleotide sequence (SEQ ID NO. 2-4), and the integration vector pGAPZA gene sequence:
[0053] AFS-F: gagaccttcgtttgtgcggatcccccac;
[0054] AFS-R:gtcaacgctattacgccagctg;
[0055] FP-F: gcgttgacaattaatcatcggcatag;
[0056] FP-R: catgtctatagttgttcaattgattg;
[0057] IDI-F:GAATTAACttcgaaacgatatagcttc;
[0058] IDI-R: ccgcacaaacgaaggtctcacttaatc;
[0059] tHMG-F: aactatagacatgactgttccgtttatc;
[0060] tHMG-R:GTTAATTCAAATTAATTGATATAGTTTTTTAATGAG;
[0061] YZ-F: ctcgtccaatcaggtagcc;
[0062] YZ-R: aagagctaccaactctttttccgaag.
[0063] The plasmid backbone, promoter fragment, and gene fragment are combined into a circular plasmid, namely PGAPMPA-tHMG1-IDI-AFS, using a one-step multi-fragment homologous recombination method. Figure 1(As shown). After linearizing and purifying the integration plasmid PGAPZA-tHMG1-IDI-AFS, it was transformed into Pichia pastoris strain. Gene integration was completed using non-homologous end linking. To verify primer PCR screening, the engineered strain P. pastoris FA1 with successfully integrated pathway genes was isolated by streaking on YNB plates.
[0064] Example 2: Mutagenesis and screening of Pichia pastoris engineered strains producing high levels of α-farnesene
[0065] The genetically engineered Pichia pastoris FA1 strain described in Example 2, which produces α-farnesene, was mutagenized under ARTP to introduce random mutations across the entire genome. The specific implementation method is as follows:
[0066] The seed culture was inoculated into YPD medium and cultured at 37°C for 12 h. Subsequently, the cells were washed three times with PBS buffer (100 mM, pH 7.2) and resuspended in sterile physiological saline to adjust the OD600 to 3.0. 10 μL of the cell suspension was evenly spread onto a sterile metal slide for subsequent mutagenesis. The radio frequency power input was set to 100 W, the working gas was pure helium, and the flow rate was 10.0 SLM (standard liters / min). The cell samples were treated for 90 s at an effective treatment distance of 2.0 mm. After treatment, the cells were thoroughly eluted by vortexing for 30 s and transferred to a 100 mL shake flask containing 30 mL of fresh YPD medium, and cultured at 30°C for 12 h.
[0067] After appropriate dilution, 100 μL of the treated cell suspension was spread onto MM solid medium supplemented with 30 g / L methanol and cultured at 30 °C for 36 h to construct a mutant strain library.
[0068] In the initial screening stage, 400 high-yielding candidate strains of α-farnesene were selected from the mutant library. These strains were inoculated into 96-well plates containing fresh MM medium and fermented at 30℃ and 200 rpm for 72 h. The α-farnesene yield was then measured. Figure 3 As shown, candidate strains with higher yields than the parent strain proceed to secondary screening.
[0069] In the secondary screening stage, the seed cultures of the 12 selected strains were inoculated at a rate of 10% (v / v) into shake flasks containing fresh MM medium and fermented at 30°C and 200 rpm for 72 h. The α-farnesene yield of each strain was then measured. Subsequently, the mutant strain P. pastoris mut008, which exhibited the best performance, was selected through screening. Figure 4As shown, the control CK was the starting strain P. pastoris FA1, and 1-12 were the 12 strains screened again. The best performing strain was P. pastoris mut008, with a shake flask yield of 231.67 mg / L.
[0070] Example 3: Feed-in batch fermentation of the mutagenized recombinant strain P. pastoris mut008 in a fermenter using methanol as the substrate.
[0071] The mutagenic Pichia pastoris mut008, which produced high levels of α-farnesene as described in Example 2, was subjected to fed-batch fermentation in a 5L fermenter. The specific implementation method is as follows:
[0072] Primary seed culture: 10 μL of bacterial culture was drawn from a glycerol tube and streaked onto a YPD plate, incubated at 37°C for 24 h. A single colony was picked and inoculated into a 250 mL shake flask containing 50 mL of primary seed culture medium (YPD medium), and incubated at 37°C and 200 rpm for 10–16 h. The OD of the primary seed culture was measured. 600 Between 6.0 and 10.0;
[0073] Secondary seed culture: 2% (v / v) seed culture was transferred to a 500 mL shake flask containing 100 mL YNB medium and 10 g / L methanol, and cultured for another 48 h.
[0074] Feed-through fermentation was performed in a 5L fermenter: The initial volume of the fermenter was 2.7L (containing 20% dodecane). The secondary seed culture was washed three times with ultrapure water and then inoculated into the fermentation medium at a rate of 10% (volume fraction) of the total volume. The temperature was 30℃, and the fermentation speed was 300 rpm. During fermentation, 2M KOH was added to control the pH (6.0±0.2). The culture medium was MM medium, and the initial substrate was 10 g / L methanol. The methanol concentration in the fermenter was sampled every 12 hours. The feed rate was 1.5–5 g / L / h to maintain the residual methanol concentration below 2 g / L. Simultaneously, the α-farnesene and the biomass of the cells were measured in the samples. Figure 5 The final fermentation results are shown; at 120 hours of fermentation, the cell OD... 600 The highest value was 60.20, and the yield of α-farnesene reached 3.05 g / L.
[0075] Example 4: Feed-in fermentation of the mutagenic recombinant strain P. pastoris mut008 in a fermenter using glucose as a substrate.
[0076] The mutagenic Pichia pastoris mut008, which produced high levels of α-farnesene as described in Example 2, was subjected to fed-batch fermentation in a 5L fermenter. The specific implementation method is as follows:
[0077] Primary seed culture: 10 μL of bacterial culture was drawn from a glycerol tube and streaked onto a YPD plate, incubated at 37°C for 24 h. A single colony was picked and inoculated into a 250 mL shake flask containing 50 mL of primary seed culture medium (YPD medium), and incubated at 37°C and 200 rpm for 10–16 h. The OD of the primary seed culture was measured. 600 Between 6.0 and 10.0;
[0078] Secondary seed culture: 2% (v / v) seed culture was transferred to a 500 mL shake flask containing 100 mL YPD medium and cultured for another 48 h;
[0079] Feed-through fermentation was performed in a 5L fermenter: The initial volume of the fermenter was 2.7L (containing 20% dodecane). The secondary seed culture was washed three times with ultrapure water and then inoculated into the fermentation medium at a rate of 10% (volume fraction) of the total volume. The temperature was 30℃, and the fermentation speed was 300 rpm. During fermentation, 2M KOH was added to control the pH (6.0±0.2). The culture medium was YPD medium, with an initial substrate of 40 g / L glucose. Glucose concentration in the fermenter was measured every 12 hours. The feed rate was 2–10 g / L / h to maintain a glucose concentration of 0.5–2 g / L. Simultaneously, the α-farnesene and cell biomass of the samples were measured. Figure 6 The final fermentation results are shown; at 120 hours of fermentation, the cell OD... 600 The highest value was 81.77, and the yield of α-farnesene reached 30.66 g / L.
[0080] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A yeast strain that produces α-farnesene, characterized in that, The engineered yeast strain is based on Pichia pastoris as the starting strain. In the starting strain, a truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI, and apple-derived α-farnesene synthase are overexpressed from Pichia pastoris. The truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is missing amino acids 1-552 of the parent 3-hydroxy-3-methylglutaryl-CoA reductase. The amino acid sequence of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is shown in SEQ ID NO.
1.
2. The engineered yeast strain according to claim 1, characterized in that, The amino acid sequence of isopentenyl pyrophosphate isomerase IDI is shown in GenBank:ANZ76675.1, and the amino acid sequence of α-farnesene synthase MdAFS is shown in GenBank:AAO22848.
2.
3. The engineered yeast strain according to claim 1, characterized in that, The starting strain of Pichia pastoris was P. pastoris CICC 1958.
4. A strain of Pichia pastoris mut008, characterized in that, It was deposited at the China General Microbiological Culture Collection Center on September 10, 2025, with accession number CGMCC No. 35873.
5. A microbial preparation containing Pichia pastoris mut008 as described in claim 4.
6. A fermenting agent, characterized in that, The fermentation agent contains Pichia pastoris mut008 as described in claim 4, or the microbial preparation as described in claim 5.
7. A method for producing α-farnesene by fermentation, characterized in that, The method involves adding the engineered yeast strain according to any one of claims 1 to 3, the Pichia pastoris mut008 according to claim 4, the microbial preparation according to claim 5, or the fermenting agent according to claim 6 to a fermentation system using methanol or glucose as a carbon source to synthesize α-farnesene through fermentation.
8. The method according to claim 7, characterized in that, The initial methanol concentration of the fermentation system was 10 g / L. When the methanol concentration was lower than 2 g / L, methanol was added to maintain it at 1-2 g / L. Alternatively, if the initial glucose concentration of the fermentation system is 40 g / L, and the glucose concentration is below 2 g / L, glucose is added to maintain it at 0.5-2 g / L.
9. The method according to claim 7, characterized in that, During fermentation, the pH is controlled at 5.8-6.2, dissolved oxygen at 20-30%, and temperature at 29.5-30.5℃.
10. The use of the engineered yeast strain according to any one of claims 1 to 3, the Pichia pastoris mut008 according to claim 4, the microbial preparation according to claim 5, the fermentation agent according to claim 6, or the method according to any one of claims 7 to 9 in the preparation of α-farnesene or products containing α-farnesene.