Pichia pastoris engineering bacteria using xylose as the sole carbon source and construction method and application thereof
By reconstructing the xylose assimilation pathway and knocking out related genes in Pichia pastoris, an engineered strain capable of using xylose as the sole carbon source was constructed. This solved the problem of Pichia pastoris' inability to effectively utilize xylose, improved xylose utilization efficiency, and expanded the conversion pathway of lignocellulose biomass and the application of yeast cell factories.
Patent Information
- Application Number
- CN202411745878.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-02
- Publication Date
- 2026-06-02
AI Technical Summary
The existing Pichia pastoris cannot effectively utilize xylose as the sole carbon source, which limits the high-value conversion of lignocellulose biomass and the application potential of yeast cell factories.
By using metabolic engineering and gene editing technology, the xylose assimilation pathway in Pichia pastoris was reconstructed, integrating genes from the XI-XK pathway, the non-oxidative phase of PPP, and the PK-PTA pathway. Furthermore, the aldose reductase Gre3, the Hog-MAPK pathway, and the glucose repression-related transcription factor PpTFGR were knocked out to optimize the xylose metabolism pathway and construct an engineered strain capable of using xylose as the sole carbon source.
This study demonstrated the ability of Pichia pastoris to grow using xylose as the sole carbon source, improved xylose utilization efficiency, expanded the green conversion pathway of xylose and cellulose biomass, and explored the application potential of Pichia pastoris in microbial cell factories.
Smart Images

Figure CN122128341A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial metabolic engineering and industrial biotechnology, and relates to an engineered strain of Pichia pastoris that uses xylose as the sole carbon source, its construction method, and its application. Background Technology
[0002] The main monosaccharides in lignocellulose are glucose and xylose. Xylose is the primary monosaccharide component of hemicellulose, accounting for up to 30% of lignocellulose, second only to glucose. However, due to low xylose assimilation efficiency and glucose repression, xylose utilization efficiency remains low. Therefore, efficient xylose utilization is one of the key issues in the production of bio-based chemicals in yeast cell factories. Although synthetic biology and metabolic engineering have established efficient xylose metabolic pathways in Saccharomyces cerevisiae cells, greatly improving the yeast's xylose utilization capacity (Curr. Opin. Biotechnol. 2021. 67, 15-25), the metabolic capacity is still insufficient. Therefore, improving the xylose utilization capacity of yeast cell factories is an important prerequisite for achieving the economic feasibility of lignocellulose bioconversion.
[0003] Pichia pastoris is widely used as a protein expression host, and due to its safety, high-density fermentation, and methyltrophic characteristics, it is considered a chassis cell with great development potential. (e.g., Metab Eng. 2018, 50, 2-15). In recent years, the Pichia pastoris genetic manipulation platform has become relatively well-developed, enabling convenient, rapid, and precise genome editing and metabolic regulation, laying a solid foundation for building efficient Pichia pastoris cell factories (Nucleic Acids Res. 2021, 49, 7791-7805). Although Pichia pastoris can utilize various carbon sources, such as glucose, glycerol, methanol, and ethanol, wild-type Pichia pastoris cannot utilize xylose as a single carbon source, and the bioconversion of xylose is a prerequisite for achieving high-value conversion of cellulosic biomass. To enable the utilization of xylose, related research mainly focuses on modifying the xylose assimilation pathway in Saccharomyces cerevisiae and strengthening the downstream pentose phosphate pathway (PPP) and xylose transport proteins to improve xylose uptake and maximize metabolic flux. Simultaneously, transcription factors or adaptive laboratory evolution strategies are employed to improve or balance the distribution of metabolic flux (Bioresour Technol. 2021, 337, 125484). However, no studies have been reported on Pichia pastoris using xylose as the sole substrate. To improve the single-saccharide utilization capacity of Pichia pastoris, strategies such as metabolic engineering, adaptive evolution, multi-omics, and reverse metabolic engineering are proposed to modify the yeast. Therefore, this invention aims to obtain a Pichia pastoris strain capable of efficiently utilizing xylose and producing fatty acids, demonstrating the application potential of Pichia pastoris as a cell factory. Summary of the Invention
[0004] To improve the xylose utilization capacity of Pichia pastoris, the present invention aims to provide an engineered strain of Pichia pastoris that utilizes xylose as the sole carbon source, its construction method, and its application.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] A method for constructing an engineered Pichia pastoris strain using xylose as the sole carbon source.
[0007] The engineered strain was obtained by reconstructing the XI-XK pathway, the non-oxidative phase of PPP, and the PK-PTA pathway in the host strain through intracellular xylose assimilation pathway.
[0008] Alternatively, the engineered strain obtained above can be cultured in a culture system using xylose as the sole carbon source to obtain a Pichia pastoris engineered strain with the sole carbon source.
[0009] Alternatively, the engineered strain or the Pichia pastoris strain with the sole carbon source obtained above can be optimized for key gene targets and / or metabolic pathways to obtain the engineered strain.
[0010] The xylose isomerase gene LpXI* from *Lactobacillus fermentum*, xylulose kinase gene PpXK from *Pichia pastoris*, transaldehyde gene OpTAL1 and transketolase gene OpTKL1 from *Hansenula polymorpha*, ribose 5-phosphate isomerase 1 gene SsRKI1 and ribulose 5-phosphate epimerase 1 gene SsRPE1 from *Pichia stylosa*, phosphate transketolase gene BbxfPK from *Bifidobacterium breve*, and acetylphosphotransferase gene CkPTA from *Clostridium kluyveromyces* were continuously and stably expressed in the host strains.
[0011] The polypeptide encoded by the LpXI* gene is a xylose isomerase derived from Lactobacillus phytofermentans.
[0012] The polypeptide encoded by the PpXK gene is a xylulose kinase derived from Pichia pastoris (Komagataella phaffii).
[0013] The polypeptide encoded by the OpTAL1 gene is transaldolase 1 derived from Ogataea polymorpha.
[0014] The polypeptide encoded by the OpTKL1 gene is transketolase 1 derived from Ogataea polymorpha.
[0015] The polypeptide encoded by the SsRKI1 gene is ribose-5-phosphate isomerase 1 derived from Pichia stipitis.
[0016] The polypeptide encoded by the SsRPE1 gene is ribulose-5-phosphate epimerase 1 derived from Pichia stipitis.
[0017] The polypeptide encoded by the BbxfPK gene is a phosphotransketolase derived from Bifidobacterium breve.
[0018] The polypeptide encoded by the CkPTA gene is an acetyltransferase derived from Clostridium kluyveri.
[0019] The host strain is Pichia pastoris, which overexpresses the RAD52 gene derived from Pichia pastoris and knocks out the acyl-CoA synthase gene FAA1 to produce high levels of fatty acids.
[0020] The DNA fragment P GAP -LpXI*-T FBA2 It integrates into the PNS I-3 site of the recombinant strain's chromosome.
[0021] The DNA fragment P GAP -PpXK-T PMP20 It integrates into the PNS I-4 site of the recombinant strain's chromosome;
[0022] The DNA fragment P TPI -OpTKL1-T ADH2 +P ADH2 -OpTAL1-T DAS1 It integrates into the PNS I-8 site of the recombinant strain;
[0023] The DNA fragment P TEF1 -SsRKI1-T DAS2 +P TPI -SsRPE1-T AOX1 It was integrated into the PNS I-10 site of the recombinant strain;
[0024] The DNA fragment T DAS1 -CkPTA-P HTX1 -BbxfPK-KpOPT-T AOX1 It was integrated into the PNS II-3 site of the recombinant strain;
[0025] The nucleotide sequence of the LpXI* gene is shown in SEQ ID NO: 1;
[0026] The nucleotide sequence of the PpXK gene is shown in SEQ ID NO: 2;
[0027] The nucleotide sequence of the OpTAL1 gene is shown in SEQ ID NO: 3.
[0028] The nucleotide sequence of the OpTKL1 gene is shown in SEQ ID NO: 4;
[0029] The nucleotide sequence of the SsRKI1 gene is shown in SEQ ID NO: 5;
[0030] The nucleotide sequence of the SsRPE1 gene is shown in SEQ ID NO: 6;
[0031] The nucleotide sequence of the BbxfPK gene is shown in SEQ ID NO: 7.
[0032] The nucleotide sequence of the CkPTA gene is shown in SEQ ID NO: 8.
[0033] Based on strain PC101, the xylose isomerase gene LpXI* and xylulose kinase gene PpXK of the XI-XK pathway were integrated into the I-3 and I-4 neutral sites of the genome, respectively (Nucleic. Acids. Res., 2021, 49(13): 7791-7805.); the aldehyde transoxidase gene OpTAL1 and ketone transoxidase gene OpTKL1 of the non-oxidative phase of PPP, as well as the ribose 5-phosphate isomerase 1 gene SsRKI1 and the ribulose 5-phosphate epimerase 1 gene SsRPE1 were integrated into the I-8 and I-10 sites, respectively; and the phosphate transketone transoxidase gene BbxfPK and acetylphosphotransferase gene CkPTA of the PK-PTA pathway were integrated into the II-3 site.
[0034] The engineered bacteria knock out one or more of the following: the xylose metabolism branching pathway mediated by aldose reductase Gre3, the Hog-MAPK pathway mediated by mitogen-activated protein kinase kinase Pbs2, and the carbon metabolism transcription factor regulation mediated by glucose repression-related transcription factor PpTFGR.
[0035] Furthermore, knocking out the aldose reductase gene GRE3 in the xylose metabolism branch of the host bacteria;
[0036] Knock out the Hog-MAPK pathway mitogen-activated protein kinase kinase gene PBS2 in the host bacteria;
[0037] Knock out the host bacterium's carbon metabolism transcription factor regulatory gene PpTFGR;
[0038] Knock out the chitin transglycosylase encoding gene UTR2.
[0039] The engineered bacteria obtained can be obtained by reconstructing the intracellular xylose assimilation pathway by introducing genes of the XI-XK pathway, the non-oxidative phase of PPP, and the PK-PTA pathway into the Pichia pastoris host bacteria; or by knocking out one or more of the following: the xylose metabolism branching pathway mediated by aldose reductase Gre3, the Hog-MAPK pathway mediated by mitogen-activated protein kinase kinase Pbs2, and the carbon metabolism transcription factor regulation mediated by glucose repression-related transcription factor PpTFGR, based on the engineered bacteria obtained according to the aforementioned method, and knocking out UTR2 (encoding chitin transglycosylase), thereby obtaining the engineered bacteria.
[0040] The construction method also includes the reintroduction of the HIS4 gene.
[0041] A method for constructing *Pichia pastoris* strains using xylose as the sole carbon source is described above.
[0042] An application of the engineered strain of Pichia pastoris that uses xylose as the sole carbon source, specifically in the preparation of fatty acids using xylose as the carbon source.
[0043] The beneficial effects that can be obtained by this invention include:
[0044] (1) The present invention provides a method for obtaining a Pichia pastoris strain that can use xylose as the sole carbon source, which enhances the xylose assimilation pathway and improves xylose utilization capacity through metabolic reconstruction.
[0045] (2) This invention further improves the growth ability of strains with xylose as the sole carbon source by optimizing the branching pathway of xylose metabolism and knocking out the UTR2 gene.
[0046] (3) This invention realizes for the first time the ability of Pichia pastoris to use xylose as the sole carbon source, expands the green conversion pathway of xylose and cellulose biomass, and explores the application potential of Pichia pastoris in the field of microbial cell factories. Attached Figure Description
[0047] Figure 1 A schematic diagram of the metabolic transformation of xylose utilization by Pichia pastoris.
[0048] Figure 2 The effect of metabolic remodeling on xylose utilization in Pichia pastoris.
[0049] Figure 3 The effect of knocking out a side pathway of xylose metabolism on xylose utilization in Pichia pastoris.
[0050] Figure 4Xylose growth ability of the UTR2 gene after knockout in strains KZ125 and KZ151.
[0051] Figure 5 Different strains utilized 20 g / L xylose as a carbon source to produce fatty acids. a, strain growth curve; b, strain xylose consumption curve; c, strain fatty acid accumulation curve. Detailed Implementation
[0052] The following non-limiting embodiments are intended to enable those skilled in the art to more fully understand the present invention, but do not limit the invention in any way. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials and reagents used can be purchased from biological or chemical companies.
[0053] In this application, the gene modification involves introducing donor DNA containing either "upstream homologous arm of the integration site - integration fragment - downstream homologous arm of the integration site" or "upstream homologous arm of the knockout site - downstream homologous arm of the knockout site" into the host, and using the CRISPR / Cas9 system to achieve gene integration or knockout. The donor DNA and site targeting sequences involved in this application are shown in Tables 1 and 2. The integration site, the 20bp targeting sequence in the expression vector, and the upstream and downstream homologous arms in Table 1 are referenced in NucleicAcids Res. 2021.49, 7791-7805. The sequence of the integration fragment can be found in NCBI using the provided gene / promoter / terminator names.
[0054] This invention first enhances the xylose assimilation pathway through metabolic reconstruction, enabling Pichia pastoris to initially acquire xylose utilization capacity. Subsequently, by blocking branching pathways of xylose metabolism, the Hog-MAPK pathway, and transcription factors related to carbon source utilization, and by optimizing the xylose metabolism pathway through the gene encoding chitin transglycosylase UTR2, the xylose utilization capacity of the engineered strain is further improved. Finally, the engineered strain utilizes xylose as a single carbon source to synthesize fatty acids.
[0055] Table 1. Donor DNA and gRNA expression vectors involved in the embodiments of this application
[0056]
[0057] Table 2. Donor DNA and gRNA expression vectors involved in the embodiments of this application
[0058]
[0059] The basic culture medium (Delft) used consisted of the following components: (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L. Histidine 40 mg / L was added as needed, and the pH was adjusted to 5.6. The medium was then sterilized at 115°C for 30 min. 1 mL of Vitamin solution and 2 mL of Trace metal solution were added, along with the appropriate concentrations of glucose, xylose, or methanol. The formula for Trace metal (500×) is: 3.0 g / L FeSO4·7H2O, 0.45 g / L ZnSO4·7H2O, 4.5 g / L CaCl2·2H2O, 1.0 g / L MnCl2·4H2O, 0.3 g / L CoCl2·6H2O, 0.3 g / L CuSO4·5H2O, 1.0 g / L H3BO3, 0.1 g / L KI, 0.4 g / L Na2MoO4·2H2O, 19 g / L Na2EDTA·2H2O, with a final pH of 4. The formula for Vitamin Solution (1000×) is: 0.05 g / L D-Biotin, 1.0 g / L D-Pantothenic acid hemicalcium salt, 1.0 g / L thiosulfate hydrochloride, 1.0 g / L pyridoxine hydrochloride, 1.0 g / L base hydrochloride, 0.2 g / L para-aminobenzoic acid and 25 g / L inositol.
[0060] The fermentation conditions for different strains in the following examples are as follows:
[0061] (1) Pick up the bacterial culture from the glycerol tube for preservation and streak it on YPD solid medium. Incubate at 220 rpm and 30°C for about 3 days.
[0062] (2) Prepare Delft medium, add carbon source concentration according to experimental needs, and dispense 20 mL into Erlenmeyer flasks (100 mL size).
[0063] (3) Pick 3-5 single colonies from the plate and inoculate them into centrifuge tubes (15 mL) containing 2 mL of Delft medium. Incubate at 30°C until the bacterial culture OD increases. 600 The value reaches the midpoint of the logarithm.
[0064] (4) Select three vigorous bacterial strains and inoculate them into three Erlenmeyer flasks containing 20 mL of culture medium, so that the initial bacterial solution OD 600 The value is 0.2. If necessary, the bacterial cells should be washed twice with sterile water before inoculation.
[0065] (6) Samples were taken before inoculation as 0h samples to determine the carbon source content. After inoculation, samples were taken at set times to determine the OD. 600 And carbon source content.
[0066] The methods for detecting carbon sources and fatty acids are as follows. Quantitative analysis of glucose, xylose, and methanol was performed using high-performance liquid chromatography (HPLC). Sample pretreatment: 1 mL of fermentation broth was centrifuged at 12,000 rpm for 5 min, and the supernatant was filtered through a 0.22 μM membrane. Carbon source detection was performed using a Shimadzu LC-20AD high-performance liquid chromatography system (SHIMADZU Corporation, Tokyo, Japan). The chromatographic column used was a Bio-Rad Aminex HPX-87G column, the mobile phase was 5 mM sulfuric acid, the flow rate was 0.6 mL / min, the column temperature was 50 ℃, and the injection volume was 20 μL (PNAS, 2022, 119(29):e2201711119). Gas chromatography detection conditions: The extraction and quantification procedures for fatty acids were performed according to PNAS, 2022, 119(29):e2201711119. A differential detector and a UV detector (210 nm) were configured using gas chromatography, equipped with a Zebron ZB-5MS GUARDIAN capillary column (30m*0.25mm*0.25mm, Phenomenex) and an FID detector. Detection conditions: Injector temperature 250℃, detector temperature 300℃, carrier gas N2 flow rate 1mL / min. Temperature program: Initially 40℃, held for 2 min; increased to 130℃ at 30℃ / min; then increased to 280℃ at 10℃ / min, held for 3 min.
[0067] Example 1: Construction of Pichia pastoris strain with high efficiency in utilizing xylose
[0068] Figure 1 This study demonstrates metabolic remodeling to improve xylose utilization in Pichia pastoris.
[0069] The engineered strain PC101 (GS115,faa1Δ,HIS4::P) of Pichia pastoris GS115 was used. GAP -KpRAD52-T AOX1 As the starting strain (PNAS, 2022, 119(29):e2201711119), the key homologous recombination protein RAD52 gene in this strain was integrated into the GS115 genome to improve homologous recombination efficiency; in order to efficiently produce fatty acids, the acyl-CoA synthase gene FAA1 was knocked out to obtain high fatty acid production. The genome integration expression and knockout operation of the target gene were performed using the CRISPR / Cas9 genome editing system (Nucleic Acids Res. 2021.49, 7791-7805).
[0070] This paper describes a method for constructing a *Pichia pastoris* strain utilizing xylose as the sole carbon source. Specifically, it involves reconstructing xylose metabolism by integrating genes related to the XI-XK pathway, the non-oxidative PPP phase, and the PK-PTA pathway into the *Pichia pastoris* host genome. This enhances xylose utilization, enabling *Pichia pastoris* to achieve initial growth in a basal medium with xylose as the sole carbon source. The XI-XK pathway includes xylose isomerase XI and xylulose kinase XK. The non-oxidative PPP phase includes four enzymes: transaldolase TAL1, transketolase TKL1, ribose-5-phosphate isomerase 1RKI1, and ribulose-5-phosphate epimerase 1RPE1. The PK-PTA pathway includes two enzymes: phosphate transketolase PK and phosphate transacetylase PTA. Subsequently, the relevant pathways of xylose metabolism were optimized, including blocking the xylose metabolism branch mediated by aldose reductase Gre3, the Hog-MAPK pathway mediated by mitogen-activated protein kinase kinase Pbs2, and the regulation of carbon metabolism transcription factors mediated by glucose repression-related transcription factor PpTFGR, to further improve the cell's ability to utilize xylose for growth.
[0071] The specific implementation steps are as follows:
[0072] (1) Xylose metabolism remodeling
[0073] Using strain PC101 as the starting strain, and taking the integration and expression of LpXI* at the PNS I-3 site in the genome as an example, the LpXI* gene (nucleotide sequence as shown in SEQ ID NO: 1) was amplified using a gene synthesis plasmid as a template. The upstream and downstream homologous arms PNSI-3up and PNSI-3dw, and the promoter P... GAP and Termination T FBA2 Obtained by amplification using the GS115 genome as a template, PNSI-3up and P GAP LpXI* gene, T FBA2 PNSI-3dw was fused with PNSI-3up-P using overlap extension PCR to form donor DNA PNSI-3up-P GAP -LpXI*-T FBA2 -PNSI-3dw, along with the gRNA plasmid pPICZ-Cas9-gPNSI-3, was transformed into Pichia pastoris PC101(GS115,faa1Δ,HIS4::P) GAP -KpRAD52-T AOX1 The transformants were plated onto YPD resistance selection plates and incubated at 30°C for 3–4 days. After the transformants were cultured in liquid YPD medium, their correctness was verified by colony PCR. They were then plated onto antibiotic-free plates for plasmid loss. The strains after plasmid loss were stored for later use, and the engineered strain KZ104 was obtained. The integration and expression of other genomes in Pichia pastoris described below followed a similar procedure.
[0074] Expression cassettes were constructed by combining the remaining enzyme genes with different promoters and terminators, and then integrated into different sites on the genome using the CRISPR / Cas9 system. PNSI-4up-P GAP -PpXK-T PMP20 -PNSI-4dw was integrated into the PNSI-4 site of strain KZ104 to obtain strain KZ106, which was then processed using PNSI-8up-P TPI -OpTKL1-T ADH2 +P ADH2 -OpTAL1-T DAS1 -PNSI-8dw was integrated into the PNSI-8 site of strain KZ106 to obtain strain KZ115, which was then processed using PNSI-10up-P TEF1 -SsRKI1-T DAS2 +P TPI -SsRKE1-T AOX1 -PNSI-10dw was integrated into the PNSI-10 site of strain KZ115 to obtain strain KZ116, which was then processed using PNSII-1up-P GAP -hCas9-T Aox1 -PNSII-1dw was integrated into the PNSII-1 site of strain KZ116 to obtain strain KZ118, which was then processed using PNSII-3up-T. DAS1 -CkPTA-P HTX1 -BbxfPK-KpOPT-T AOX1 -PNSII-3dw was integrated into the PNSII-3 site of strain KZ118 to obtain strain KZ125.
[0075] To verify the growth of the engineered strain in xylose medium, the activated recombinant strain was used with an initial OD value. 600 0.2 g / L was transferred to basal medium containing 10 g / L xylose and fermented at 30°C and 220 rpm. Growth was measured every 24 hours. After 96 hours of culture, the OD of strain KZ125 was... 600 Reached 3.94 ( Figure 2 ), and the OD of the initial strain PC101 600 In comparison, Pichia pastoris exhibits a significantly improved ability to utilize xylose for growth, achieving growth using xylose as a single carbon source.
[0076] To further improve xylose utilization, the engineered strain KZ125 was further modified. The aldose reductase gene GRE3, the mitogen-activated protein kinase gene PBS2, and the glucose repression-related transcription factor PpTFGR were successively knocked out. Taking seamless knockout of the GRE3 gene as an example, firstly, the sgRNA expression vector pCAI-GRE3 targeting the GRE3 gene was constructed, with a 20bp target sequence as shown in SEQ ID No. 9. Next, donor DNA molecules were constructed, and approximately 1000bp sequences upstream and downstream of the GRE3 coding region were amplified. The complete donor DNA fragment was obtained using fusion PCR. The gRNA expression vector and donor DNA were transformed into strain KZ125 at 1000 ng each via electroporation and cultured on YPD-resistant plates at 30°C for 3–4 days. After transformants were cultured in liquid YPD medium, PCR verification confirmed their correctness. The strain was then continuously passaged in YPD medium to remove plasmids, and the plasmid-free strains were preserved for future use. In addition, sgRNA expression vectors pCAI-PBS2 and pCAI-PpTFGR were constructed, with the 20bp target sequence being the nucleotide sequences shown in SEQ ID No: 10 and 11. The knockout of gene PBS2 and other genome knockout procedures described below all followed a similar process.
[0077] To verify the growth of the engineered strain in xylose medium, the activated recombinant strain was used with an initial OD value. 600 0.2 g / L was transferred to Delft basal medium containing 10 g / L xylose and fermented at 30°C and 220 rpm. Growth was measured every 24 hours. The OD of strain KZ161 was... 600 Reaching 6.9, the xylose utilization growth ability of Pichia pastoris was significantly improved, achieving the ability to grow using xylose as a single carbon source.
[0078] The specific implementation steps of the above technical solution are as follows:
[0079] First, LpXI* integration donor DNA was constructed. Using primers LPXI-F (ATTTCAATCAATTGAACAACTATCAAAACACAATGAAGAACTACTTCCCAAATGTGCC) and LPXI-R (ATAGACTTAAAGAATAAAGAGAAATTTTATTTATCTGAACAGGATGTTGTTCACAATGG), PCR was performed (template: synthesized LpXI* plasmid; system: 10 μL 5×SF Buffer, 1 μL dNTP, 50 ng template, 2 μL each of upper and lower primers, 1 μL DNA polymerase, 33 μL ddH2O. PCR conditions: 95℃ for 3 min, 95℃ for 10 s, 56℃ for 30 s, 72℃ for 50 s, then repeated to step two for 34 cycles, 72℃ for 10 min, 18℃ for unlimited time). The LpXI* sequence (SEQ ID) was amplified. NO: 1), and then, using the same PCR amplification method, the homologous arm sequences of 1000 bp upstream and downstream of Pichia pastoris PNSI-2 and the promoter P were obtained. GAP Termination of sub-T FBA2 Then, after overlapping extension PCR (Round 1: System: 5×PS Buffer 5μL, dNTP 3μL, the five fragments added in a ratio of 1:3:5:3:1, DNA polymerase 0.5μL, add ddH2O to 25μL. PCR conditions: 95℃ 3min, 98℃ 10s, 58℃ 15s, 72℃ 5min. Then cycle to step 2, 15 cycles, 72℃ 10min, 18℃ unlimited time. Round 2: Template: First round PCR product. System: 5×SF Buffer 10μL, dNTP 1μL, template 2μL, upper and lower primers 2μL each, DNA polymerase 1μL, ddH2O 32μL. PCR conditions: 95℃ 3min, 95℃ 10s, 56℃ 30s, 72℃ 2min 30s. Then cycle to step 2, 34 cycles, 72℃... 10 min, 18℃, unlimited time. (With promoter P) GAP Termination of sub-T FBA2 The complete donor DNA was obtained by fusing with the homologous arm and the LpXI* gene for subsequent electroporation experiments.
[0080] The electroconversion process is as follows:
[0081] 1) On the evening of the first day (16:00-18:00), pick single clones into 5mL YPD medium (50mL centrifuge tube) and incubate overnight at 220rpm and 30℃ for 12-16h.
[0082] 2) The next morning, transfer the overnight cultured seed strain to 20 mL of YPD medium (in a 100 mL shake flask) to ensure initial OD. 600 The concentration is 0.15–0.2, and the culture time is 4–6 hours, which allows the OD to be... 600 Reaching 0.8 to 1;
[0083] 3) Take 10 mL of bacterial culture, centrifuge at 500 g for 5 min to collect cells, remove the supernatant, and resuspend in 1.8 mL BEDS + 0.2 mL 1 M dithiothreitol (DTT);
[0084] 4) Incubate at 30℃ and 100 rpm for 5 minutes;
[0085] 5) Collect cells by centrifugation at 500g for 5 minutes.
[0086] 6) Resuspend the cells in 400 μL of BEDS (without DTT).
[0087] 7) Aliquot the competent Pichia pastoris cells into 1.5mL centrifuge tubes (80μL per tube).
[0088] 8) Pichia pastoris competent cells can be stored at -80℃. (Competent cells can be stored for 6 months, but their use is not recommended for transformation efficiency studies.)
[0089] 9) When using G418 as an resistant agent, add 600 ng of DNA fragment and 300 ng of gRNA plasmid. When using Zeocin as an resistant agent, add 1 μg of DNA fragment and 500 ng of gRNA plasmid. Transfer the mixed cells and DNA to an electroporation cuvette and incubate on ice for 2 min.
[0090] 10) Electrostatic parameters: The Bio-rad electroconverter uses the fungal Pic mode.
[0091] 11) Immediately after clicking, suspend in culture medium:
[0092] Auxotrophic type: Resuspend in 1 mL of pre-cooled 1M sorbitol and then plate onto selective medium (YNB, 2% glucose + 1M sorbitol).
[0093] Using plasmids based on G418 or Zeocin: Resuspend the strain in 0.5 mL of 1 M sorbitol + 0.5 mL of YPD and incubate at 30 °C on a shaker for 1 h. Centrifuge at 500 g for 5 min, remove the supernatant, add 200 μL of water to resuspend the strain, and then plate it on G418 or zeocin-resistant YPD plates.
[0094] 12) Incubate at 30℃ for 2-4 days until transformants appear.
[0095] The starting strain for electroporation was PC101, and positive clones were obtained by screening transformants. After losing the gRNA plasmid, the strain was preserved using glycerol or fermented using xylose as the sole carbon source, and the growth status (OD) of the strain was monitored. 600 The YPD medium used consisted of 20 g / L glucose, 20 g / L peptone, and 10 g / L yeast extract. Xylose fermentation medium (containing 10 g xylose / L of basal components) was used. The basal components (Delft) were: (NH₄)₂SO₄ 2.5 g / L, KH₂PO₄ 14.4 g / L, MgSO₄·7H₂O 0.5 g / L. Histidine 40 mg / L was added as needed, and the pH was adjusted to 5.6. The medium was sterilized at 115℃ for 30 min. 1 mL of vitamin solution and 2 mL of trace metal solution, along with the appropriate concentration of xylose or methanol, were added. The xylose-methanol medium consisted of 10 g / L xylose and 8.52 g / L methanol. The formula for Trace Metal (500×) is: 3.0 g / L FeSO4·7H2O, 0.45 g / L ZnSO4·7H2O, 4.5 g / L CaCl2·2H2O, 1.0 g / L MnCl2·4H2O, 0.3 g / L CoCl2·6H2O, 0.3 g / L CuSO4·5H2O, 1.0 g / L H3BO3, 0.1 g / L KI, 0.4 g / L Na2MoO4·2H2O, 19 g / L Na2EDTA·2H2O, with a final pH of 4. The formula for Vitamin Solution (1000×) is: 0.05 g / L D-Biotin, 1.0 g / L D-Pantothenic acid hemicalcium salt, 1.0 g / L thiosulfate hydrochloride, 1.0 g / L pyridoxine hydrochloride, 1.0 g / L base hydrochloride, 0.2 g / L para-aminobenzoic acid and 25 g / L inositol.
[0096] Xylose fermentation process:
[0097] (1) Pick up the bacterial culture from the glycerol tube for preservation and streak it on YPD solid medium. Incubate at 220 rpm and 30°C for about 3 days.
[0098] (2) Prepare Delft xylose medium and dispense 20 mL into Erlenmeyer flasks (100 mL size).
[0099] (3) Pick 3-5 single colonies from the plate and inoculate them into centrifuge tubes (15 mL) containing 2 mL Delft xylose methanol medium. Incubate at 30°C until the bacterial culture OD increases. 600 The value reaches the midpoint of the logarithm.
[0100] (4) Select 3-4 vigorous bacterial strains and inoculate them into 3-4 Erlenmeyer flasks containing 20mL of culture medium. The initial bacterial solution OD600 The value is 0.2. If necessary, the bacterial cells should be washed twice with sterile water before inoculation. After inoculation, samples should be taken at set intervals (every 12 hours) to determine the OD. 600 .
[0101] The recombinant strain KZ104 (PNSI-3::P) of *Pichia pastoris* expressing the LpXI* protein was obtained by xylose fermentation analysis. GAP -LpXI*-T FBA2 ()( Figure 2 Subsequently, P was processed according to the above method. GAP -PpXK-T PMP20 Integration into the PNSI-4 site (PpXK sequence SEQ ID NO: 2), P TPI1 -OpTKL1-T ADH2 +P ADH2 -OpTAL1-T DAS1 Integration into the PNSI-10 site (sequences of OpTAL1 and OpTKL1, SEQ ID NO: 3 and 4), P TEF1 -SsRPE1-T FBP1 +P TPI1 -SsRKI1-T DAS1 Integration into the PNSI-8 site (sequences of SsRKI1 and SsRPE1, SEQ ID NO: 5 and 6), P GAP -hCas9-T Aox1 Integrates into the PNSII-1 site, T DAS1 -CkPTA-P HTX1 -BbxfPK-T AOX1 Integrating into the PNSII-3 site (SEQ ID NO: 7 and 8 of the sequences BbxfPK and CkPTA), strains KZ106, KZ115, KZ116, KZ118, and KZ125 were obtained, respectively.
[0102] The above-mentioned strains were fermented with 10 g / L xylose, and the OD of strain KZ125 was... 600 It can reach 3.94 ( Figure 2 ).
[0103] Example 2: Optimizing the xylose metabolic pathway to further improve xylose utilization.
[0104] To further enhance xylose utilization in Pichia pastoris, the GRE3, PBS2, and PpTFGR genes were knocked out in engineered strain KZ125. Specifically, the sgRNA expression vector pCAI-gGRE3 was constructed, with a 20bp target sequence as shown in SEQ ID No: 9. A pair of primers, GRE3-sgRNA-F (TTCAGTTCCAAAAACGACTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG) and GRE3-sgRNA-F (CAGTCGTTTTTGGAACTGAAGACGAGCTTACTCGTT TCGTCC), were used for PCR (template: pCAI plasmid, Nucleic. Acids. Res., 2021, 49(13): 7791-7805). The system consisted of 10 μL of 5×SF Buffer, 1 μL of dNTPs, 50 ng of template, 2 μL of each primer, 1 μL of DNA polymerase, and 33 μL of H2O. PCR conditions: 95℃ for 3 min, 95℃ for 10 s, 56℃ for 30 s, 72℃ for 1 min 55 s, then repeat step 2 for 25 cycles, 72℃ for 10 min, 18℃ for unlimited time. The gGRE3 plasmid sequence was amplified and then digested with DpnI enzyme (system: DpnI 1 μL, 10×T Buffer 2 μL, DNA ≤ 1 μg, add H2O to 20 μL) at 37℃ for 1 h. The plasmid was then transformed into *E. coli* DH5α and cultured overnight at 37℃. The next day, four single clones were picked and transferred to LB+Kana culture, and sequencing was performed to obtain the correct plasmid strain. In addition, sgRNA expression vectors pCAI-gPBS2 and pCAI-gPpTFGR were constructed. The 20bp target sequence of pCAI-gPBS2 is the nucleotide sequence shown in SEQ ID No: 10. The pCAI-gPBS2 plasmid sequence was obtained by PCR amplification using a pair of primers PBS2-sgRNA-F (TGATGACGAAAA GAACGTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG) and PBS2-sgRNA-R (CCACGTTCTTTTCGTCATCAGACGAGCTTACTCGTTTCGT CC) under the PCR conditions described above. The 20bp target sequence of pCAI-gPpTFGR is the nucleotide sequence shown in SEQ ID No: 11. The pCAI-gPBS2 plasmid sequence was obtained by PCR amplification using a pair of primers PpTFGR-sgRNA-F (GGCTTCGGATGAGATAACGGGTTTTAGAGCTAGAAA).
[0105] The plasmid sequence pCAI-gPpTFGR was obtained by PCR amplification of PpTFGR-sgRNA-R (CCGTTATCTCATC CGAAGCCGACGAGCTTACTCGTTTCGTCC) under the PCR conditions described above. The plasmid was then transferred to *E. coli* DH5α and cultured overnight at 37°C. The next day, four single clones were picked and transferred to LB+Kana culture, and sequencing confirmed the correct plasmid strain. Subsequently, donor DNA for the target gene was constructed. Homologous arm sequences of 1000 bp upstream and downstream of GRE3 in *Pichia pastoris* were obtained by PCR amplification. These sequences were then fused using overlap extension PCR under the PCR conditions described above to obtain complete donor DNA. The donor DNA was used in subsequent electroporation experiments to achieve gene editing. The starting strain was KZ125, resulting in the *Pichia pastoris* recombinant strain KZ132 with GRE3 knocked out. Figure 3 KZ132 strain was modified by knocking out PBS2 to obtain KZ151 strain, and KZ151 strain was modified by knocking out PpTFGR. Figure 3 It can be observed that the maximum OD of strain KZ161(PpTFGRΔ) is... 600 It reached 6.9.
[0106] To identify target genes that promote xylose utilization, a CRISPR / Cas9 targeting vector was constructed to knock out UTR2. The 20bp target sequence of pCAI-gUTR2 is the nucleotide sequence shown in SEQ ID No: 12. The pCAI-gUTR2 plasmid sequence was obtained by PCR amplification using a pair of primers UTR2-sgRNA-F (GGTGTCTTGAACTATACCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG) and UTR2-sgRNA-R (TTGGTATAGTTCAAGACACCGACGAGCTTACTCGTTTCGTCC) under the PCR conditions described above. Plasmid construction and fusion were performed according to Example 1, and the plasmid was transformed into strains KZ125 and KZ151. The constructed donor DNA, the required sgRNA expression vector, and the integration site are shown in Table 2. A fusion Donor was constructed using primers UTR2-UF (GTGCCAGACGGTTATAAGAACACC), UTR2-UR (TTCAGGCGAAAATAATAGCAACGAAC), UTR2-DF (GTTCGTTGCTATTATTTTCGCCTGAATGTCTAAGGCCATAAGAGACATTGG), and UTR2-DR (CTTGACCATAGCATCGGTG TTGC). The resulting strain after knocking out UTR2 in strain KZ151 was named KZ177.
[0107] from Figure 4 It can be observed that, in xylose fermentation experiments, compared with the control strain KZ125, UTR2 knockout can increase OD. 600 The efficiency reached 38.5% (144h). To demonstrate the universality of these target genes, the above genes were knocked out in strain KZ151. The results showed that UTR2 knockout improved xylose utilization by 10.8% (96h). Figure 4 ).
[0108] Example 3: Pichia pastoris synthesizes fatty acids from xylose.
[0109] To evaluate the production performance of these strains, it is important to consider their suitability as a carbon source for fatty acid synthesis from xylose. Prototrophic strains are beneficial for cell growth and the production of free fatty acids; therefore, it is necessary to reintroduce the HIS4 gene into these strains. The strategy for in situ HIS4 gene reintroduction involves replacing the RAD52 gene with the HIS4 gene and selecting positive clones for xylose fermentation. Four reintroduced strains were selected: PC101, KZ161(GS115,faa1Δ,PNSI-3::P GAP -LpXI*-T FBA2,PNSI-4::P GAP -KpXK-T PMP20 ,PNSI-10::P TPI1 -OpTKL1-T ADH2 +P ADH2 -OpTAL1-T DAS1 ,PNSI-8::P TEF1 -SsRPE1-T FBP1 +P TPI1 -SsRKI1-T DAS1 ,PNSII-1::P GAP -hCas9-T Aox1 ,PNSII-3::T DAS1 -CkPTA-P HTX1 -BbxfPK-T AOX1 ,gre3Δ,pbs2Δ,PpTFGRΔ)、KZ177(GS115,faa1Δ,PNSI-3::P GAP -LpXI*-T FBA2 ,PNSI-4::P GAP -KpXK-T PMP20 ,PNSI-10::P TPI1 -OpTKL1-T ADH2 +P ADH2 -OpTAL1-T DAS1 ,PNSI-8::P TEF1 -SsRPE1-T FBP1 +P TPI1 -SsRKI1-T DAS1 ,PNSII-1::P GAP -hCas9-T Aox1 ,PNSII-3::T DAS1 -CkPTA-P HTX1 -BbxfPK-T AOX1,gre3Δ,pbs2Δ,utr2Δ). HIS4 gene in situ complementation strategy: Use primers HIS4P2-F (GAGGATCTCCTGATGACTGACTCACTG) and HIS4T2-R (GATCTATCGAATCTAAATGTAAGTTAAAATCTCTAAATAATTAAATAAGT). Obtain HIS4 complement donors by PCR amplification under the PCR conditions described above. Select strains requiring HIS4 complementation, without gRNA and selection markers, and directly transform them into HIS4 donors. The recovery medium YPD from the transformation process must be completely removed. Wash the cells twice with ddH2O and select them on SD plates. Select the growing single clones and culture them in Delft liquid supplemented with 20 g / L glucose. After primer verification, streak them on SD plates again for preservation. Use 20 g / L (X20) xylose as a carbon source to synthesize fatty acids. The final OD of strains KZ161H and KZ177H is... 600 The values were 13.1 and 14.2, respectively, indicating a significant improvement in xylose utilization. Figure 5 (a, b). In comparison, the free fatty acid production of these two strains reached 100 mg / L and 89.2 mg / L, respectively. Figure 5 c).
[0110] The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.
[0111] sequence
[0112] SEQ ID NO: 1(LpXI*=LpXI) T63I _ V162A )
[0113]
[0114] SEQ ID NO:2(PpXK)
[0115]
[0116] SEQ ID NO:3(OpTAL1)
[0117] ATGTCTTCTTTGGAACAATTGAAAGCTGCTGGTACTGTTGTTGTTACTGATACTGGTGAATTTGAATCTATTGCTAAATATACTCCACAAGATGCTACTACTAATCCATCTTTGATTTTAGCTGCTTCTGAAAAACCACAATATGCTAAATTGATTGATGTTGCTGTTGATTATGCTAAAGATAAAGGTTCTTCTGCCGAAGAGAAAGCGAACATTGCCTTGGATAGATTGTTGGTTGAATTTGGTAAAGAGATTTTGAAAATTGTTCCTGGTAGAGTTTCTACTGAAGTAGACGCTAGGTTGTCATTCGATAAGGAGGCTACTATTAAGAAGGCTTTGGAGATAATTGAACTATATAAGTCTTTTGGGTATTGATAAGGAAAAGATATTAATCAAAATTGCTTCTACGTATGAAGGTATTTTGGCTGCTAGAGAATTGGAAGAAAAATATGGTGTTCATTGTAATTTGACTTTGTTGTTTTCTT TTGTTCAAGCTGTTGCTTGTGCTGAAGCTAAAGTTACTTTGATTTCTCCATTTGTTGGTAGAATTATGGATTGGTATAAAGCTAAAACTGGTAAAACATATGAAGGTAAAGAGGACCCGGGGGTTCAATCTGTTACTCGCATCTATAATTACTATAAGAAATATGGCTATAAGACTATTGTTATGGGTGCTTCTTTTAGAAATGTTGGTGAAATTACTGCTTTGGCTGGTTGATTATTTGACTATTGCTCCAAAATTGTTGGAAGAATTGATGAATTCTAAACAACCTGTTCCAAAAGTTTTGGATGCTTCTGCTGCGCAATCTTGTTCTGAAGAAAAAGTCAGTTATATTGATGACGAAGCTAAATTCAGATTTCTCTTGAAATGAAGATGCTATGGCTACTGAAAAATTGTCTGAAGGTATTAGAAAATTTTCTGCTGATTGTGTTACTTTGTTGAATGTTTTGAAAGCTAAATTTGAATAA
[0118] SEQ ID NO:4(OpTKL1)
[0119]
[0120] SEQ ID NO: 5(SsRKI1)
[0121] ATGTCTTCTTTGTCTTTGGTTGAACAAGCTAAAAAATCTGCTGCTTATCAAGCTGTTGATGAAAATTTTCCTGTTTCTGCTAAAGTTGTTGGTATTGGTTCTGGTTCTCTGTTGTTTATGTTGCTGAAAGAATTGGTCAATTGGCTAATAAAGATTCATTTGTCTGCATTCCTACTGGATTTCAATCTAAACAGTTGATTATTGATAATGGTTTGAAATTGGGTGCAATTGAACAATTTCCTGAAATTGATATTGCTTTTGATGGTGCTGATGAAGTTGATCCTTGCTTTGAATTTGATTAAAGGTGGAGGTGCTTGTTTGTTTCAAGAAAAATTGGTTGCTGCTTCTGCTAAAACT TTTGTTGTTGTCGCAGACTATAGGAAAAAATCTGATAATTTGGGTATTCAATGGAAACAAGGAGTTCCAATCGAAATCGTCCCAAAATTCTTACGCTAAAGTTATTCAAGACTTGAAAAAATTAGGTGCTATTACTGTTAATTTGAACAAGGTGGTTCTGCTAAAGCTGGTCCAATTATTACTGATAATAACAATTTTTTGTTGGATGCTGATTTTGGTGCTATTAAAGATCCAAAAGCTTTGCATGATCAAATTAAAGCTTTGGTTTGTTGTTGAAACTGGTTTGTTTTACTTCTATGGCTGCTAAATCTTATTTTGGTGAACAAGATGGTCAAGTTAATATTTGGTCTATTTAA
[0122] SEQ ID NO: 6(SsRPE1)
[0123] ATGGTTCAACCAATTATTTCTCCATCTATTTTGGCTTCTGATTTTGCTAATTTGGGGTTCTCATTGTAAATGTATTGTTAATGGTGGTGCTGAATGGTTGCATTTGGATGTTATGGATGGTCATTTTGTTCCAAATATTTCTTTGGGTGCTCCAATTATTGCTTCTTTGAGAAAACAATTTCCAAGATCTGATCCAAATCCTGTTTTTTTTTGATTGTCATATGATGGTTTCTAATCCTGAACAATGGATTGAAGATATTGCTAAAGCTGGTGGTGACGGTTATACTTTTCATTTTGAAGCTACTGATGATGCTTTGAGAACTATTAAAAAAGTTAAAGCTGCTGGTATGA AAGTTGGTGTTTCTGTTAAACCAAAAACTCCTGTTGAAGTTTTGTTTCCAATTGTTGAAGAAAATTGATTTGGCTTTGGTTATGACTGTTGAACCTGGTTTTGGTGGTCAAAAATTTATGCCTGAAATGATGGCTAAAGTTGAGATTTTGAGAAATAAATATCCTGATTTGAATATTGAAGTTGATGGTGGTTTGGCTAAAGATACTATTGATGCTGCAGCTAAAGCTGGTGCTAATGTTATTGTTGGTGGTACTTCTGTTTTTGGTGCTGAAAATCCTGCTGAAGTTATTGATTTTTTGAGATCTTCTGTTGCTACTTCTTTGACTGCTAAAGGTTTGTTGACTAAATAA
[0124] SEQ ID NO:7(Bbxfpk)
[0125]
[0126] SEQ ID NO:8(CkPTA)
[0127]
[0128] SEQ ID NO:9(GRE3-sgRNA 20bp)
[0129] TTCAGTTCCAAAAACGACTG
[0130] SEQ ID NO:10(PBS2-sgRNA 20bp)
[0131] TGATGACGAAAAGAACGTGG
[0132] SEQ ID NO:11(PpTFGR-sgRNA 20bp)
[0133] GGCTTCGGATGAGATAACGG
[0134] SEQ ID NO:12(UTR2-sgRNA 20bp)
[0135] GGTGTCTTGAACTATACCAA
[0136] SEQ ID NO:13
[0137]
Claims
1. A method for constructing an engineered strain of Pichia pastoris using xylose as the sole carbon source, characterized in that: The engineered strain was obtained by reconstructing the XI-XK pathway, the non-oxidative phase of PPP, and the PK-PTA pathway in the host strain through intracellular xylose assimilation pathway. Alternatively, the engineered strain obtained above can be cultured in a culture system using xylose as the sole carbon source to obtain a Pichia pastoris engineered strain with the sole carbon source. Alternatively, the engineered strain can be obtained by optimizing key gene targets and / or metabolic pathways of the above-mentioned engineered strain or the Pichia pastoris engineered strain with the sole carbon source.
2. The method for constructing Pichia pastoris engineered strains using xylose as the sole carbon source according to claim 1, characterized in that: The xylose isomerase gene LpXI* from *Lactobacillus fermentum*, xylulose kinase gene PpXK from *Pichia pastoris*, transaldehyde gene OpTAL1 and transketolase gene OpTKL1 from *Hansenula polymorpha*, ribose 5-phosphate isomerase 1 gene SsRKI1 and ribulose 5-phosphate epimerase 1 gene SsRPE1 from *Pichia stylosa*, phosphate transketolase gene BbxfPK from *Bifidobacterium breve*, and acetylphosphotransferase gene CkPTA from *Clostridium kluyveromyces* were continuously and stably expressed in the host strains.
3. The method for constructing Pichia pastoris engineered strains using xylose as the sole carbon source according to claim 2, characterized in that: The host strain is Pichia pastoris, which overexpresses the RAD52 gene derived from Pichia pastoris and knocks out the acyl-CoA synthase gene FAA1 to produce high levels of fatty acids.
4. The method for constructing Pichia pastoris engineered strains using xylose as the sole carbon source according to claim 2, characterized in that: The DNA fragment P GAP -LpXI*-T FBA2 It integrates into the PNS I-3 site of the recombinant strain's chromosome. The DNA fragment P GAP -PpXK-T PMP20 It integrates into the PNS I-4 site of the recombinant strain's chromosome; The DNA fragment P TPI -OpTKL1-T ADH2 +P ADH2 -OpTAL1-T DAS1 It integrates into the PNS I-8 site of the recombinant strain; The DNA fragment P TEF1 -SsRKI1-T DAS2 +P TPI -SsRPE1-T AOX1 It was integrated into the PNS I-10 site of the recombinant strain; The DNA fragment T DAS1 -CkPTA-P HTX1 -BbxfPK-KpOPT-T AOX1 It was integrated into the PNS II-3 site of the recombinant strain; The nucleotide sequence of the LpXI* gene is shown in SEQ ID NO: 1; The nucleotide sequence of the PpXK gene is shown in SEQ ID NO: 2; The nucleotide sequence of the OpTAL1 gene is shown in SEQ ID NO: 3; The nucleotide sequence of the OpTKL1 gene is shown in SEQ ID NO: 4; The nucleotide sequence of the SsRKI1 gene is shown in SEQ ID NO: 5; The nucleotide sequence of the SsRPE1 gene is shown in SEQ ID NO: 6; The nucleotide sequence of the BbxfPK gene is shown in SEQ ID NO: 7; The nucleotide sequence of the CkPTA gene is shown in SEQ ID NO:
8.
5. The method for constructing Pichia pastoris engineered strains using xylose as the sole carbon source according to claim 2, characterized in that: The engineered bacteria knock out one or more of the following: the xylose metabolism branching pathway mediated by aldose reductase Gre3, the Hog-MAPK pathway mediated by mitogen-activated protein kinase kinase Pbs2, and the carbon metabolism transcription factor regulation mediated by glucose repression-related transcription factor PpTFGR.
6. The method for constructing Pichia pastoris engineered strains using xylose as the sole carbon source according to claims 1, 2, and 5, characterized in that: The engineered strain of Pichia pastoris, which was obtained as the sole carbon source, was subjected to reverse metabolic engineering to knock out UTR2 (encoding chitin transglycosylase) to obtain the engineered strain.
7. The method for constructing Pichia pastoris engineered strains using xylose as the sole carbon source according to any one of claims 1-6, characterized in that: The construction method also includes the reintroduction of the HIS4 gene.
8. A method for constructing Pichia pastoris strains using xylose as the sole carbon source, as described in claim 1, characterized in that, The Pichia pastoris engineered strain was constructed using the construction method described in claim 1, which utilizes xylose as the sole carbon source.
9. The application of the engineered Pichia pastoris strain as described in claim 8, which utilizes xylose as the sole carbon source, characterized in that: The application of the engineered bacteria in the preparation of fatty acids using xylose as a carbon source.