Salt-activated beta-galactosidase mutant E154V and application thereof

By mutating the amino acid of β-galactosidase 4E8D, the E154V mutant was obtained, which solved the problem of activity loss of β-galactosidase in high-salt environment and achieved activity improvement and cost reduction under high-salt conditions.

CN121380031APending Publication Date: 2026-01-23YUNNAN NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511621849.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-07
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing β-galactosidases suffer significant activity loss in high-salt environments, leading to increased costs and reduced production efficiency in industrial applications. They are also ill-suited for high-salt environments such as whey, brown algae extracts, and phosphate buffer solutions for biopharmaceutical use.

Method used

By mutating glutamic acid at position 154 of recombinant wild-type β-galactosidase 4E8D to valine, a β-galactosidase mutant E154V with salt activation properties was obtained. The rate of the enzymatic reaction was regulated by adding salt solutions such as CH3COOK, CH3COONa, K3PO4, and Na3PO4 to the reaction system.

Benefits of technology

The mutant E154V significantly enhances hydrolysis activity in low-to-medium concentration salt solutions, with a maximum increase of 11.41 times. It adapts to high-salt industrial environments, improves reaction efficiency and controllability, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380031A_ABST
    Figure CN121380031A_ABST
Patent Text Reader

Abstract

The invention discloses a salt activated beta-galactosidase mutant E154V and application thereof. The amino acid sequence of the mutant is shown as SEQ ID NO. 1. In a system without adding salt, the hydrolytic activity of E154V to a substrate p-nitrophenyl-beta-D-galactopyranoside (pNPG) is lower, the activity of E154V in a system with salt is remarkably improved, and in a 500 mM potassium acetate solution, the hydrolytic activity of the mutant to the pNPG is improved by 11.41 times and is improved by 124.26% compared with that of a recombinant wild enzyme without adding salt; the hydrolytic activity to galactooligosaccharide is improved by 22.13 times, and is improved by 58.72% compared with that of a recombinant wild enzyme without salt. The mutant is suitable for a technical application scene in which the enzymatic reaction rate needs to be adjusted, the reaction efficiency and controllability can be effectively improved, and a better solution is provided for enzyme catalysis application in the fields of agriculture, food processing, biotechnology and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to a beta-galactosidase mutant E154V with salt-activated characteristics and its application. BACKGROUND

[0002] Beta-galactosidase (EC 3.2.1.23) has precise glycosidic bond selectivity, can specifically recognize and hydrolyze the beta-1,3-glycosidic bond in oligogalactose (GOS), and is a key tool enzyme for regulating the degree of polymerization of GOS (Zhao X, et al. Journal of Biological Chemistry, 2024, 299(12): 105120-105131). In the field of functional foods, the intestinal utilization rate of long-chain GOS containing beta-1,3-glycosidic bonds is only 50%-60% of that of short-chain GOS, and infant formula and other products need to be converted to improve the activity of fructooligosaccharides (FOS) by enzymatic conversion (Sun H, et al. Food Hydrocolloids, 2023, 142:109458), and companies such as Bainmei have strengthened GOS / FOS combinations in their formulations; in the field of biological medicine, sulfated GOS derivatives need to be enzymatically converted into 300-500 Da short-chain intermediates to serve as precursors of antiviral drugs, and the market gap for such intermediates is significant; in the field of cosmetics, enzymatic regulation of beta-1,3-glycosidic bond content can optimize the moisturizing and permeability of GOS, and the annual growth rate of customized product procurement is 18%-22%. However, the industrial application of this enzyme is severely restricted by salt environments: whey (NaCl 0.4-0.9 mol / L), brown algae extract (potassium chloride 0.3-0.7 mol / L), and phosphate buffer for biological medicine (0.2-0.5 mol / L) contain high salt components, and the activity of traditional enzymes in this environment is lost by 50%-70%, and even aggregated and inactivated, resulting in a 30%-40% increase in cost (Wang Q, et al. Applied and Environmental Microbiology, 2025, 91(5): e02845-24); desalination schemes such as nanofiltration require an additional investment of 2-5 million yuan in equipment, extending the production cycle by 4-6 hours, and also causing a 12%-18% loss of product due to GOS isomerization.

[0003] Therefore, "salt-activated enzymes" have important industrial value, and the development of beta-galactosidase with enhanced activity and regulated by salt solution can not only improve reaction efficiency and controllability, but also better adapt to salt-containing industrial production environments, thereby improving product quality and reducing costs. SUMMARY

[0004] The present application aims to provide a beta-galactosidase mutant with salt activation characteristics, which can controllably regulate the efficiency of enzymatic reaction and can be applied to various technical application scenarios that need to adjust the enzymatic reaction rate through the concentration of salt solution.

[0005] To achieve the above-mentioned application purposes, the present application provides a beta-galactosidase mutant E154V with salt activation characteristics, which is obtained by mutating glutamic acid at position 154 of recombinant wild-type beta-galactosidase 4E8D to valine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 1.

[0006] The present application also provides a coding gene for the above-mentioned beta-galactosidase mutant E154V with salt activation characteristics e154v , and the nucleotide sequence thereof is shown in SEQ ID NO. 2.

[0007] The present application also provides a recombinant expression vector carrying the above-mentioned coding gene, and the vector is preferably selected from the pET series, and more preferably pET-28a (+).

[0008] The present application also provides a host bacterium carrying the above-mentioned recombinant expression vector, and the bacterium is preferably selected from Escherichia coli, and more preferably BL21 (DE3).

[0009] The activity of the mutant is enhanced and regulated by salt solution, and can be better applied to the technical field that needs to control the enzyme activity through the concentration of salt solution, and can be especially applied to the fields of agriculture, food processing, animal husbandry and biotechnology.

[0010] The present application also provides a method for improving the hydrolysis activity of mutant E154V on oligogalactose, which is used to improve the hydrolysis activity of mutant E154V on oligogalactose by adding salt in the reaction system, and especially adding 500 mM CH3COOK in the reaction system can significantly improve the hydrolysis activity on galactosan.

[0011] The beta-galactosidase mutant E154V with salt activation characteristics provided by the present application has the following advantages: The mutant (E154V) has only 18.07% of the hydrolysis activity of the recombinant wild enzyme on nitrophenyl-beta-D-galactopyranoside (hereinafter referred to as pNPG), but has salt solution activation characteristics, and the pNPG hydrolysis activity is significantly improved in low-concentration CH3COOK, CH3COONa, K3PO4 and Na3PO4 solutions, with a maximum increase of 11.41 times; wherein the optimum temperatures of the recombinant wild enzyme and the mutant are 40 ℃ and 30 ℃, respectively, and the optimum pH is 6.0, and when the concentration of CH3COOK, CH3COONa, K3PO4 and Na3PO4 solution is less than 1 M, the hydrolysis activity of the recombinant wild enzyme on pNPG has no significant change or is inhibited to a certain extent, while the mutant is activated in the above-mentioned solutions to different degrees, and the activation of CH3COOK and CH3COONa is particularly obvious, which is specifically manifested as follows: in the CH3COOK solution with a final concentration of 150-500 mM and the CH3COONa solution with a final concentration of 120-500 mM, the hydrolysis activity of the mutant on pNPG tends to be stably improved, with an average increase of about 11 times, a maximum increase of 124.26% compared with the recombinant wild enzyme without salt, a maximum increase of 22.13 times compared with the mutant without salt, and an increase of 58.72% compared with the recombinant wild enzyme without salt, which exhibits a significant salt activation characteristic; in the K3PO4 solution with a final concentration of 120-300 mM and the Na3PO4 solution with a final concentration of 120-500 mM, the hydrolysis activity of the mutant on pNPG is increased by 100.13% compared with the recombinant wild enzyme without salt, and is increased by 10.08% compared with the mutant without salt. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 The activity determination results of the recombinant wild enzyme 4E8D and the mutant E154V in the present application under different pH conditions.

[0013] Figure 2 The activity determination results of the recombinant wild enzyme 4E8D and the mutant E154V in the present application under different temperature conditions.

[0014] Figure 3 The activity changes of the recombinant wild enzyme 4E8D (a) and the mutant E154V (b) in the present application in the CH3COOK solution with a final concentration of 20-1000 mM.

[0015] Figure 4 The activity changes of the recombinant wild enzyme 4E8D (a) and the mutant E154V (b) in the present application in the CH3COONa solution with a final concentration of 20-1000 mM.

[0016] Figure 5The changes in the activity of recombinant wild-type enzyme 4E8D (a) and mutant E154V (b) in solutions with a final concentration of 20-1000 mM K3PO4 in this invention are shown.

[0017] Figure 6 The changes in the activity of recombinant wild-type enzyme 4E8D (a) and mutant E154V (b) in Na3PO4 solutions with final concentrations of 20-500 mM are shown in this invention.

[0018] Figure 7 The difference in the hydrolytic activity of wild-type enzyme 4E8D and mutant E154V in CH3COOK without salt and at a final concentration of 500 mM is shown in this invention. Detailed Implementation

[0019] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Some of the experimental materials and reagents used in this invention: 1) Strains and vectors: The competent Escherichia coli cells BL21(DE3) and expression vector pET-28a(+) used in this study were purchased from Suzhou Hongxun Biotechnology Co., Ltd.

[0021] 2) Enzymes and other biochemical reagents: p-nitrophenyl-β-D-galactopyranoside (pNPG) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; plasmid miniprep kit was purchased from Omega; QuickMutation... TM The gene site-directed mutagenesis kit was purchased from Beyotime Biotechnology Co., Ltd.; DpnI digestive enzyme was purchased from Beyotime Biotechnology Co., Ltd.; low molecular weight standard protein marker was purchased from Takara Biotechnology Co., Ltd.; isopropyl-β-D-thiogalactoside (IPTG) was purchased from Solarbio Science & Technology Co., Ltd.; galactan containing β-1,3-glycosidic bonds was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; glucose assay kit was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; all other reagents were of analytical grade.

[0022] 3) LB medium: Accurately weigh 10 g of Tryptone, 5 g of Yeast extract, and 10 g of NaCl, and dissolve them in 1000 mL of distilled water, adjusting the pH to natural (approximately 7.0). For solid media, add 2.0% (w / v) agar.

[0023] Note: The experimental methods of the following examples not specifically described, refer to the specific methods listed in the book of "Molecular Cloning Experiment Guide" (third edition) J. Sambrook, or according to the kit and product instructions. The experimental methods involved, such as no special instructions, are conventional methods, and the materials, reagents, etc., such as no special instructions, can be obtained from commercial channels.

[0024] Experimental Example 1 Preparation of mutant E154V, construction and transformation of expression vector 1) Download the amino acid sequence of β-galactosidase 4E8D (see SEQ ID NO. 3, number: AAK74249.1) and its corresponding nucleotide sequence from the GenBank database 4e8d (see SEQ ID NO. 4, number: AE005672.3:64955-66742).

[0025] 2) Commission Suzhou Hongxun Biotechnology Co., Ltd. to optimize, modify, synthesize and construct recombinant plasmid for the sequence 4e8d First, the codon and GC content of the sequence are optimized to obtain the optimized sequence 4e8d (see SEQ ID NO. 5). Add 2 nucleotides (CC) before the start codon and add 6×histidine His tag coding sequence after the start codon; and introduce six nucleotides (CTCGAG) after the stop codon, thereby obtaining the sequence 4e8d-opt (see SEQ ID NO. 6), and synthesizing it. Finally, in order to avoid introducing redundant nucleotide sequences in the recombinant wild enzyme gene sequence, the synthesized 4e8d-opt is connected with pET-28a(+) vector to construct recombinant plasmid s4e8d-opt -pET-28a(+). s4e8d-opt s4e8d-opt 3) The recombinant plasmid -pET-28a(+) is transformed into E. coli BL21(DE3) competent cells by conventional heat shock transformation method, and finally the recombinant expression strain BL21(DE3) /

[0026] carrying the gene is obtained, which can express the recombinant wild enzyme, and its amino acid sequence is shown in SEQ ID NO. 7. s4e8d-opt s4e8d-opt 4) The strain BL21(DE3) / s4e8d-opt carrying the recombinant plasmid pET-28a(+) obtained above is transformed into E. coli BL21(DE3) competent cells by conventional heat shock transformation method, and finally the recombinant expression strain BL21(DE3) /

[0027] s4e8d-opt- s4e8d- opt ​​Inoculated in LB medium containing 50 μg / mL kanamycin at 0.1% content, cultured overnight at 37 ℃, 180 rpm, and the plasmid was extracted using a plasmid extraction kit s4e8d - opt -pET-28a(+) plasmid.

[0028] 5) Recombinant expression plasmid pET-28a(+) was used as a template, and mutant primers were designed using the Novozyme online primer design website (https: / / crm.vazyme.com / cetool / singlepoint.html). The specific sequences are as follows, and the designed primers were synthesized by Beijing Qikexin Biotechnology Co., Ltd. s4e8d Forward primer F (SEQ ID NO. 8):

[0029] 5'- GCAGGTGGTGAACGAATATGGCAGCTATGGCG -3'; Reverse primer R (SEQ ID NO. 9): 5'- ATTCGTTCACCACCTGCATCATCAGAATGTTGC -3'. Mutated using QuickMutation TM Gene Site Mutation Kit, and the PCR reaction parameters were as follows: 95 ℃ pre-denaturation for 3 min, then 95 ℃ denaturation for 30 sec, 65 ℃ annealing for 30 sec, 68 ℃ extension for 8 min, 20 cycles; 68 ℃ extension for 15 min; finally 4 ℃ cooling for 30 min. The recombinant plasmid containing the sequence was obtained by PCR amplification

[0030] -pET-28a(+) which can express mutant E154V in host bacteria. opt e154v 6) The PCR product was digested with Dpn I enzyme at 37 ℃ for 3 h to remove the template DNA that did not occur mutation.

[0031] 7) Transformation and identification: the digestion product was transformed into E. coli BL21(DE3) competent cells by heat shock transformation method, and the recombinant strain BL21(DE3) / carrying the coding gene was obtained.

[0032] Subsequently, sequencing was performed by Kunming Biosciences Biotechnology Co., Ltd., and the sequencing results confirmed that the nucleotide sequence of the mutant E154V was as shown in SEQ ID NO. 2, and the amino acid sequence encoded thereby was as shown in SEQ ID NO. 1. e154v e154v

[0033] ​​Description: E154V refers to the glutamic acid at position 154 of wild-type β-galactosidase 4E8D (SEQ ID NO. 3) is mutated to valine, and recombined with the carrier, and the amino acid sequence is shown as SEQ ID NO. 1.

[0034] E154V (SEQ ID NO. 1): MHHHHHHTRFEIRDDFYLDGKSFKILSGAIHYFRVPPEDWYHSLYNLKALGFNTVETYVAWNLHEPCEGEFHFEGDLDLEKFLQIAQDLGLYAIVRPSPFICAEWEFGGLPAWLLTKNMRIRSSDPAYIEAVGRYYDQLLPRLVPRLLDNGGNILMMQVVNEYGSYGEDKAYLRAIRQLMEECGVTCPLFTSDGPWRATLKAGTLIEEDLFVTGNFGSKAPYNFSQMQEFFDEHGKKWPLMCMEFWDGWFNRWKEPIITRDPKELADAVREVLEQGSINLYMFHGGTNFGFMNGCSARGTLDLPQVTSYDYDALLDEEGNPTAKYLAVKKMMATHFSEYPQLEPLYKESMELDAIPLVEKVSLFETLDSLSSPVESLYPQKMEELGQSYGYLLYRTETNWDAEEERLRIIDGRDRAQLYVDGQWVKTQYQTEIGEDIFYQGKKKGLSRLDILIENMGRVNYGHKFLADTQRKGIRTGVCKDLHFLLNWKHYPLPLDNPEKIDFSKGWTQGQPAFYAYDFTVEEPKDTYLDLSEFGKGVAFVNGQNLGRFWNVGPTLSLYIPHSYLKEGANRIIIFETEGQYKEEIHLTRKPTLKHIKGENL.

[0035] e154v Coding gene sequence (SEQ ID NO. 2):

[0036] Amino acid sequence of wild-type enzyme 4E8D (SEQ ID NO. 3): MTRFEIRDDFYLDGKSFKILSGAIHYFRVPPEDWYHSLYNLKALGFNTVETYVAWNLHEPCEGEFHFEGDLDLEKFLQIAQDLGLYAIVRPSPFICAEWEFGGLPAWLLTKNMRIRSSDPAYIEAVGRYYDQLLPRLVPRLLDNGGNILMMQVENEYGSYGEDKAYLRAIRQLMEECGVTCPLFTSDGPWRATLKAGTLIEEDLFVTGNFGSKAPYNFSQMQEFFDEHGKKWPLMCMEFWDGWFNRWKEPIITRDPKELADAVREVLEQGSINLYMFHGGTNFGFMNGCSARGTLDLPQVTSYDYDALLDEEGNPTAKYLAVKKMMATHFSEYPQLEPLYKESMELDAIPLVEKVSLFETLDSLSSPVESLYPQKMEELGQSYGYLLYRTETNWDAEEERLRIIDGRDRAQLYVDGQWVKTQYQTEIGEDIFYQGKKKGLSRLDILIENMGRVNYGHKFLADTQRKGIRTGVCKDLHFLLNWKHYPLPLDNPEKIDFSKGWTQGQPAFYAYDFTVEEPKDTYLDLSEFGKGVAFVNGQNLGRFWNVGPTLSLYIPHSYLKEGANRIIIFETEGQYKEEIHLTRKPTLKHIKGENL.

[0037] Coding sequence of wild-type enzyme 4E8D e154v (SEQ ID NO. 4):

[0038] 4e8d Optimized sequence (SEQ ID NO. 5):

[0039] 4e8d Optimized, engineered sequence (SEQ ID NO. 6):

[0040] Recombinant wild-type enzyme 4E8D (SEQ ID NO. 7): MHHHHHHTRFEIRDDFYLDGKSFKILSGAIHYFRVPPEDWYHSLYNLKALGFNTVETYVAWNLHEPCEGEFHFEGDLDLEKFLQIAQDLGLYAIVRPSPFICAEWEFGGLPAWLLTKNMRIRSSDPAYIEAVGRYYDQLLPRLVPRLLDNGGNILMMQVENEYGSYGEDKAYLRAIRQLMEECGVTCPLFTSDGPWRATLKAGTLIEEDLFVTGNFGSKAPYNFSQMQEFFDEHGKKWPLMCMEFWDGWFNRWKEPIITRDPKELADAVREVLEQGSINLYMFHGGTNFGFMNGCSARGTLDLPQVTSYDYDALLDEEGNPTAKYLAVKKMMATHFSEYPQLEPLYKESMELDAIPLVEKVSLFETLDSLSSPVESLYPQKMEELGQSYGYLLYRTETNWDAEEERLRIIDGRDRAQLYVDGQWVKTQYQTEIGEDIFYQGKKKGLSRLDILIENMGRVNYGHKFLADTQRKGIRTGVCKDLHFLLNWKHYPLPLDNPEKIDFSKGWTQGQPAFYAYDFTVEEPKDTYLDLSEFGKGVAFVNGQNLGRFWNVGPTLSLYIPHSYLKEGANRIIIFETEGQYKEEIHLTRKPTLKHIKGENL.

[0041] Preparation of recombinant wild-type β-galactosidase 4E8D and mutant E154V 1) The recombinant strain BL21(DE3) / 4e8d and BL21(DE3) / s4e8d-opt The activated bacteria were inoculated into fresh LB medium (containing 50 μg / mL kanamycin) at an inoculation amount of 1%, and cultured at 37 °C, 180 rpm for about 2-3 h until the OD

[0042] 2) The activated bacteria were inoculated into fresh LB medium (containing 50 μg / mL kanamycin) at an inoculation amount of 1%, and cultured at 37 °C, 180 rpm for about 2-3 h until the OD 600When the OD600 reached 0.6-0.8, IPTG was added to a final concentration of 0.7 mM to induce the expression of the recombinant protein, and the culture was continued to be shaken at 20 ℃ and 160 rpm for about 20 h.

[0043] 3) After the induction culture was completed, the bacteria were collected by centrifugation at 4 ℃ and 6000 rpm for 8 min. Then, the bacteria were resuspended in an appropriate amount of McIlvaine buffer (pH=7.0) and subjected to ultrasonic disruption in a low-temperature water bath. After the disrupted cell homogenate was centrifuged at 12000 rpm for 30 min, the supernatant was collected as a crude enzyme solution. The target protein was purified by using a Nickel-NTA Agarose affinity chromatography column and eluted with a gradient of 0-500 mM imidazole.

[0044] 4) The protein sample obtained above was added to a pH=7.0 McIlvaine buffer dialysis solution at a volume ratio of 1:100 for dialysis. The dialysis bag (mw: 14000) was cut into small pieces of appropriate length (10-20 cm), boiled in boiling water for 30 min, and then thoroughly washed with double-distilled water. The purified recombinant wild-type enzyme 4E8D and mutant E154V obtained in 3) were loaded into the dialysis bag, and the ends of the dialysis bag were reserved for 3-5 cm in length and sealed with dialysis clamps. The dialysis sample was placed in the dialysis buffer and dialyzed at 4 ℃, and the dialysis solution was replaced every 2 hours for a total of 3 times.

[0045] Experimental Example 3 Property determination of recombinant wild-type β-galactosidase 4E8D and mutant E154V The enzyme activity determination method used the pNP method, and p-nitrophenyl-β-D-galactopyranoside (pNPG) was used as the substrate to determine the activity of the recombinant wild-type enzyme 4E8D and mutant E154V. First, a pNPG solution with a final concentration of 2 mM was prepared, and the buffer was adjusted to the required pH. The reaction system included 50 μL of enzyme solution and 200 μL of 2 mM pNPG substrate. The substrate was preheated at the reaction temperature for 5 min, 50 μL of appropriately diluted enzyme solution was added, and the reaction was terminated after 10 min by adding 750 μL of 1 M Na2CO3. After the reaction mixture was cooled to room temperature, the amount of released pNP was determined at a wavelength of 405 nm. At the same time, a control group was set up, in which 750 μL of 1 M Na2CO3 was added first, followed by the enzyme solution.

[0046] 1 enzyme activity unit (U) was defined as the amount of enzyme required to decompose 1 μmol of substrate to produce pNP per minute.

[0047] The enzyme activity determination method: the calculation formula of enzyme activity is as follows: Enzyme activity (U / mL) = c x n / (t x v) Wherein: c is the amount of p-nitrophenol after enzyme reaction (pmol) calculated by p-nitrophenol standard equation; n is the enzyme liquid dilution multiple; t is the enzyme and substrate reaction time (min); v is the enzyme liquid volume involved in the reaction (mL).

[0048] 1) pNP method for measuring the activity of recombinant wild-type enzyme 4E8D and mutant E154V under different pH conditions At 37 ℃, using McIlvaine buffer (pH=3.0, 4.0, 5.0, 6.0, 6.5, 7.0, 8.0) and 0.2 M glycine-NaOH (pH=9.0, 10.0) buffer, pNPG as substrate, reaction for 10 min, the enzyme activity of recombinant wild-type enzyme 4E8D and mutant E154V was determined. The results are shown in e154v As shown in the table, the optimum pH of wild-type enzyme 4E8D and mutant E154V is 6.0.

[0049] 2) pNP method for measuring the thermal activity of recombinant wild-type enzyme 4E8D and mutant E154V In the buffer with pH=6.0, pNPG as substrate, the reaction temperature range was 0-60 ℃, and the reaction was carried out for 10 min to determine the enzyme activity of purified recombinant wild-type enzyme 4E8D and mutant E154V. The results are shown in Figure 1 As shown in the table, the optimum temperature of wild-type enzyme 4E8D and mutant E154V is 40 ℃ and 30 ℃, respectively, and compared with recombinant wild-type enzyme 4E8D, the optimum temperature of mutant E154V is reduced by 10 ℃.

[0050] 3) pNP method for measuring the activity of recombinant wild-type enzyme 4E8D and mutant E154V in CH3COOK Under the optimum pH and 37 ℃ conditions, p-nitrophenyl-β-D-galactopyranoside (pNPG) was used as the substrate, and CH3COOK was added with a final concentration of 0, 20, 50, 100, 120, 150, 200, 300, 500, 1000 mM, and then the appropriate dilution of enzyme solution was added and reacted for 10 minutes, followed by determination of the enzyme activity of wild-type enzyme 4E8D and mutant E154V in different concentrations of CH3COOK.

[0051] The results are shown in Figure 2As shown in the figure, a represents the assay results of recombinant wild-type enzyme 4E8D, and b represents the assay results of E154V mutant. The results show that within the final CH3COOK concentration range of 0-1000 mM, the activity of recombinant wild-type enzyme 4E8D did not change significantly; conversely, the activity of E154V mutant showed a significant activation phenomenon. When the final CH3COOK concentration was 150-500 mM, compared with the unsalted condition, the enzyme activity of E154V tended to steadily increase, with an average increase of more than 11 times, exceeding the enzyme activity level of wild-type enzyme 4E8D without salt, with an average increase of 113.74%. Among these, the hydrolytic activity against pNPG increased by a maximum of 11.41 times, and by a maximum of 124.26% compared with the unsalted recombinant wild-type enzyme.

[0052] 4) The pNP method was used to determine the activities of recombinant wild-type enzyme 4E8D and mutant E154V in CH3COONa. At the optimal pH and 37 °C, CH3COONa was added to final concentrations of 0, 20, 50, 100, 120, 150, 200, 300, 500, and 1000 mM using p-nitrophenyl-β-D-galactopyranoside (pNPG) as a substrate, followed by the addition of appropriately diluted enzyme solution and reaction for 10 minutes. Subsequently, the enzyme activities of wild-type enzyme 4E8D and mutant E154V in CH3COONa at different concentrations were measured.

[0053] The results are as follows Figure 3 As shown in the figure, a represents the assay results of recombinant wild-type enzyme 4E8D, and b represents the assay results of mutant E154V. The results indicate that when the final concentration of CH3COONa is in the range of 0-1000 mM, the enzyme activity of recombinant wild-type enzyme 4E8D does not change significantly with increasing CH3COONa concentration. However, when the final CH3COONa concentration is 120-500 mM, the specific activity of E154V is approximately 11-fold higher than that in the unsalted environment, exceeding the enzyme activity level of wild-type enzyme 4E8D in the unsalted state, with an average increase of 109.57%. Specifically, the hydrolytic activity against pNPG is increased by a maximum of 10.96-fold, and by a maximum of 116.09% compared to the unsalted recombinant wild-type enzyme.

[0054] 5) The pNP method was used to determine the activities of recombinant wild-type enzyme 4E8D and mutant E154V in K3PO4. Under optimal pH and 37°C conditions, K3PO4 was added to final concentrations of 0, 20, 50, 100, 120, 150, 200, 300, 500, and 1000 mM using p-nitrophenyl-β-D-galactopyranoside (pNPG) as a substrate, followed by the addition of appropriately diluted enzyme solution and reaction for 10 minutes. Subsequently, the enzyme activities of wild-type enzyme 4E8D and mutant E154V in different concentrations of K3PO4 were measured.

[0055] The results are as follows Figure 4 As shown in the figure, a represents the assay results of recombinant wild-type enzyme 4E8D, and b represents the assay results of mutant E154V. The results indicate that the enzyme activity of recombinant wild-type enzyme 4E8D remained essentially unchanged when the final K3PO4 concentration ranged from 0 to 1000 mM. Conversely, the specific activity of mutant E154V in K3PO4 solutions with final concentrations of 120-300 mM exceeded that of the wild-type enzyme in the unsalted system, with a specific activity more than 9-fold higher than that in the unsalted environment, and exceeding the enzyme activity level of wild-type enzyme 4E8D in the unsalted state, with an average increase of 94.03%. Specifically, the hydrolytic activity against pNPG increased by a maximum of 10.01-fold, representing a maximum increase of 98.99% compared to the unsalted recombinant wild-type enzyme.

[0056] 6) PNP assay to determine the activities of recombinant wild-type enzyme 4E8D and mutant E154V in Na3PO4. At the optimal pH and 37 °C, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as a substrate, Na3PO4 was added at final concentrations of 0, 20, 50, 75, 100, 120, 150, 200, 300, 400, and 500 mM, followed by the addition of appropriately diluted enzyme solution and reaction for 10 minutes. Subsequently, the enzyme activities of wild-type enzyme 4E8D and mutant E154V in different concentrations of Na3PO4 were measured.

[0057] The results are as follows Figure 5 As shown in the figure, a represents the measurement results of recombinant wild-type enzyme 4E8D, and b represents the measurement results of mutant E154V. The results show that the activity of recombinant wild-type enzyme 4E8D did not change significantly in Na3PO4 reaction systems with final concentrations of 0-500 mM. However, the E154V mutant exhibited a Na3PO4 concentration-dependent change in enzyme activity. When the final Na3PO4 concentration in the system was 120 mM-500 mM, its specific activity increased by approximately 9 times compared to the unsalted condition, exceeding the enzyme activity level of wild-type enzyme 4E8D without salt, with an average increase of 92.43%. Specifically, the hydrolytic activity against pNPG increased by a maximum of 10.08 times, and by a maximum of 100.13% compared to the unsalted recombinant wild-type enzyme.

[0058] Experimental Example 4: Effect of CH3COOK on the activity of hydrolyzed galactooligosaccharides in mutant E154V and product analysis 1) Determination of the hydrolytic activity of mutant E154V on galactooligosaccharides in the absence of salt and in CH3COOK. The glucose oxidase-peroxidase (GOD-POD) method was used to detect the hydrolysis activity of galactooligosaccharide. In the reaction system, no salt group and 500 mM CH3COOK treatment group were set at 37 DEG C constant temperature reaction 120 min. After the reaction was terminated by boiling water bath treatment for 5 min, 20 μL of reaction solution was taken, and GOD-POD kit was used for glucose quantitative detection. Three repeats were set in the experiment, and the non-specific degradation was excluded by setting the enzyme-free reaction system as a blank control. 1 enzyme activity unit (U) is defined as the amount of enzyme required to catalyze 1 μmol of galactooligosaccharide hydrolysis to generate glucose per minute.

[0059] The results are shown in Table 1. Figure 6 Figure 7 As shown in Table 1, in 500 mM CH3COOK, the hydrolysis activity of mutant E154V to galactooligosaccharide is significantly improved by 22.13 times compared with no salt, which is improved by 58.72% compared with the recombinant wild enzyme without salt and improved by 35.06% compared with the recombinant wild enzyme with salt.

[0060] In summary, the active salt solution enhanced and regulated β-galactosidase mutant E154V provided by the application has an optimum temperature of 30 DEG C and an optimum pH of 6.0. When no salt is added, the hydrolysis activity of the mutant to pNPG is only 18.07% of that of wild enzyme 4E8D, but it has the characteristic of being activated by salt solution. In low concentration CH3COOK, CH3COONa, K3PO4 and Na3PO4 solution, the hydrolysis activity of the mutant to pNPG is significantly improved, and the maximum improvement is 11.41 times, which can exceed the activity level of the recombinant wild enzyme without salt, and the highest improvement is 124.26%. The hydrolysis activity of E154V to galactooligosaccharide is improved by 22.13 times compared with itself without salt, and improved by 58.72% compared with wild enzyme without salt.

[0061] In view of the significant salt activation characteristics of E154V mutant, in practical application, the concentration of salt solution in the reaction environment can be adjusted to realize the enhancement and regulation of the enzymatic reaction rate. This characteristic has broad application prospects in the fields of agriculture, food processing, animal husbandry and biotechnology.

[0062] Although the content of the application has been described in detail by the above preferred embodiments, it should be recognized that the above description should not be considered as limiting the application. After reading the above content, various modifications and alternatives of the application will be obvious to those skilled in the art. Therefore, the protection scope of the application should be defined by the appended claims.

Claims

1. A β-galactosidase mutant E154V having a salt-activated property, characterized in that, The amino acid sequence of the mutant E154V is shown as SEQ ID NO.

1.

2. The gene encoding the mutant E154V of β-galactosidase according to claim 1. e154v characterized in that The e154v The nucleotide sequence encoding the gene is shown as SEQ ID NO.

2.

3. A recombinant expression vector comprising the coding gene according to claim 2. e154v 3. A recombinant expression vector comprising the coding gene according to claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The vector is selected from pET-28a(+).

5. An expression strain comprising the coding gene of claim 2. e154v 5. An expression strain comprising the coding gene of claim 2.

6. The expression bacteria according to claim 5, characterized in that, The bacteria are selected from E. coli BL21 (DE3).

7. Mutant E154V as claimed in claim 1 or the encoding gene as claimed in claim 2 e154v Applications in the field of industrial technology.

8. Use according to claim 7, wherein the compound is ###0002### The field includes the fields of agriculture, food processing, animal husbandry and biotechnology.

9. A method for improving the hydrolytic activity of the mutant E154V of claim 1 on galactooligosaccharides, characterized in that, The activity of the mutant E154V in hydrolyzing galacto-oligosaccharides is improved by adding a salt in the reaction system.

10. The method of claim 9, wherein, The salt solution is 20-1000 mM CH3COOK, CH3COONa, K3PO4 and 20-500 mM Na3PO4.