Method for breeding black sheep

By constructing expression cassettes containing PK5 and EDN3 genes and performing gene editing, the problem of white skin and colored hair in mammals was solved, resulting in the breeding of black sheep, which achieved black skin and hair, increased economic value, and avoided oxidative stress.

CN121380198APending Publication Date: 2026-01-23INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511986453.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

In existing technologies, most mammals have white skin and colored hair, lacking a stable melanin deposition type of black phenotype, which leads to reduced economic value and is accompanied by oxidative stress and organ pathological damage. The lack of effective regulatory factors leads to the inactivation of melanocytes in the skin.

Method used

By constructing expression cassettes containing PK5, β-globin introns, and EDN3 genes, and introducing them into cells using vectors for gene editing, specific expression of melanocytes in sheep skin and hair follicles was achieved. Black sheep were then bred using somatic cell nuclear transfer, embryo microinjection, or chimeric methods.

Benefits of technology

The black sheep breed has been successfully developed, with its skin, hair, head, oral mucosa, scleral mucosa, epididymis, and ears all turning black. This has improved its nutritional and economic value and prevented oxidative stress and organ pathological damage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380198A_ABST
    Figure CN121380198A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of animal breeding, in particular to a method for breeding black sheep. The method comprises the following steps: introducing an expression cassette into a cell to obtain a transgenic cell; and carrying out somatic cell nuclear transplantation cloning by adopting the transgenic cells to obtain the black sheep. The expression cassette comprises an intron of PK5 and beta-globin, and an EDN3 gene, the PK5 comprises a nucleotide sequence as shown in SEQ ID NO. 2; and the EDN3 gene comprises a nucleotide sequence as shown in SEQ ID NO. 4. A specific expression cassette and a carrier are researched, the black sheep of which the skin, hair, tongue, oral mucosa, eye white mucosa, epididymis and ears all become black can be prepared through somatic cell cloning on the basis of cells edited by the carrier, and important application value and economic value are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal breeding technology, and in particular to a method for breeding black sheep. Background Technology

[0002] In the animal kingdom, skin and hair color, determined by pigmentation, are important biological traits. This trait plays a crucial role not only in the survival and reproduction of a species (such as providing environmental camouflage, participating in courtship displays, protecting against ultraviolet radiation, and assisting in thermoregulation), but is also closely related to the economic value of a particular species. In nature, the vast majority of mammals have white or light pink skin, with relatively few animals possessing black skin (such as polar bears, zebras, and Silkie chickens). For example, the black skin of polar bears, hidden beneath their white fur, helps them absorb and retain heat in cold environments. In animal husbandry, specific skin colors are often considered markers of high-quality traits; for instance, Silkie chickens are highly sought after in the market due to their unique black skin and white fur. Furthermore, many local breeds of pigs have black or brown coats and are considered high-quality breeds, but their skin is actually primarily white, exhibiting a "white skin, colored hair" phenotype.

[0003] However, in major economically important animals (such as sheep and goats), their skin typically exhibits a non-pigmented white phenotype. Existing special breeds, such as the Lanping Black-boned Sheep, while exhibiting black deposits throughout their tissues and deep staining of internal organ membranes and periosteum, retain a white skin phenotype. Research indicates that this trait in the Lanping Black-boned Sheep stems from increased red blood cell count, elevated hemoglobin levels, and systemic iron overload, leading to the deposition of metheme in multiple tissues. Histological and molecular analyses confirm that this is a pathological process caused by insufficient FRRS1L expression due to a mutation in the FRRS1L gene's 3′-UTR, resulting in the accumulation of metheme in reticuloendothelial cells and macrophages. Notably, this metheme overload-driven pigmentation is often accompanied by oxidative stress and systemic inflammation, leading to pathological damage to critical organs such as the kidneys and liver. Furthermore, even with the darkening of internal organs due to metheme in the blood, the skin phenotype remains white. Currently, no natural sheep or goat breeds have been found whose skin consistently exhibits a melanin-deposited black phenotype.

[0004] The color of skin and hair is primarily determined by the type, quantity, and distribution of melanin in tissues. There are two main types of melanin in mammals: eumelanin (brownish-black) and pheomelanin (reddish-yellow). Melanin production begins during embryonic development, when neural crest cells differentiate into melanocytes and migrate to the basal layer of the epidermis and hair follicles. Melanocytes implanted in the epidermis differentiate into epidermal melanocytes, responsible for skin pigmentation; while those implanted in hair follicles differentiate into follicular melanocytes, responsible for hair color.

[0005] The current biological challenge lies in the fact that, although melanocytes are present in the epidermis during the embryonic period in most mammals, mature and functional melanocytes are difficult to detect in the skin of adult individuals, resulting in white skin. At the same time, their hair follicles can maintain an active population of melanocytes, thus producing colored hair. This differential regulation of "absence or inactivation of epidermal melanocytes" and "maintenance of hair follicle melanocytes" in adult individuals is the fundamental reason for the "white skin and colored hair" phenotype in animals such as black-haired pigs and black-haired sheep.

[0006] Although current research indicates that signaling pathways such as WNT, MC1R, KIT, and EDN, as well as transcription factors such as MITF, SOX10, and PAX3, play important roles in melanocyte development, there is still no clear conclusion regarding the key regulatory factors that determine the long-term survival and functional maintenance of melanocytes in the skin epidermis. Melanin possesses antioxidant activity, immunomodulatory activity, hypoglycemic effects, hypolipidemic effects, hepatoprotective effects, anti-aging effects, gastrointestinal protective effects, radiation protection effects, and iron supplementation effects. Therefore, extracting melanin from natural resources and using it as a food additive or directly as a functional health food is an important future development direction. Furthermore, animals with black fur are highly sought after in the market due to their unique characteristics. Given the potential advantages of black skin in biological function and specific economic value, breeding new breeds of sheep with corresponding traits has significant economic value. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention provides a method for breeding black sheep.

[0008] In a first aspect, the present invention provides an expression cassette comprising: PK5, an intron of β-globin, and the EDN3 gene; The PK5 gene comprises the nucleotide sequence shown in SEQ ID NO.2; the EDN3 gene comprises the nucleotide sequence shown in SEQ ID NO.4.

[0009] Furthermore, the introns of the β-globin comprise a nucleotide sequence as shown in SEQ ID NO.3.

[0010] Furthermore, it also includes screening elements; Preferably, the screening element is an OCT4-NEO screening marker gene self-splicing element; More preferably, the self-cleaving element comprises a nucleotide sequence as shown in SEQ ID NO.5.

[0011] Secondly, the present invention provides a carrier comprising the aforementioned expression box.

[0012] Furthermore, a 5PB terminus is included before the PK5 gene, and a 3PB terminus is included after the EDN3 gene (or, if there is a selection element, a selection element). The 5PB end includes the nucleotide sequence shown in SEQ ID NO.1, and the 3PB end includes the nucleotide sequence shown in SEQ ID NO.6.

[0013] The nucleotide sequence shown in SEQ ID NO.1: CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGGCGCGCCATTCTAGATTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCA。

[0014] The nucleotide sequence shown in SEQ ID NO.2:

[0015] The nucleotide sequence as shown in SEQ ID NO.3: GTGAGTTTGTGGAGTCCTCAATATTCTCCTTCTTCTTTTTATGGTCAAGCTCATGTCATGGGGAGAGGGCTGAATGGCAGGACGTGGTTTAAAATGGAGAAGATGTATTCTGGTTAGAGTGTTAAGGACTTCTGGTTAGAGTGTTAAGAACCATTTAGATTCTTTTAACCTCTTTGCTCTTGCCTGGAAATCCCATGGGTGGAGGAGCCTGGTAGGCTGCAGTCCATGGGATTGCTAAGAGTCAGACATGACTGAGCGACGTCACTTTCACTTTTCACTTTCATGCATTGGAGAAGGAAATGGCAACCCACTTCAGTGTTCTTGCCTGGAGAATCCCGGGATGGGGGAGCCTGGTGGGCTGCCGTCTATGGGGTCGCACAGAGTCGGACATGACTGAAGCGACTTAGCAGCAACCTCTTTGCTCACAATAATCATTTCTTCAGATTCATTCTTGTTCTCTGTTGTCTGCAATGTCTTCTCTTTTTAATTATACTCTTTGAGTGTTCAATTTCAAAAAAGACTTCATCTACTTTAAAAATGATATTTAATATTTTCCCCTTATCTGTTCCTTTCAAGGGATAAAATGTTGTATTGCTTTTTGAAATGATTCAAAATAATAAAAATGATAACAAGTTCTGGATTAAGATAGAAAGAGAGAAACATTTCTAAATATAAATTCAACCTGATATGGGTAGCTTCACATCAGCAGTAGCATCTATACTTCAGTCATCTTTGTGCTAATATCCTAGGGGCACAGCTTGGGATGAATCTGAAATACTCTGAATCTAACCTGGGTAACTGCACTAACCCTGCCCTTGCTTAATGTCTTTTCCACACAG。

[0016] The nucleotide sequence as shown in SEQ ID NO.4: ATGGAGCTGGGGCTGTGCTTCCTTTTCGGGCTCGCTGTGACCTCCGCCGCAGGATGGGTGCCTCACCCCCAGTCTGGGGATGCTGGCAGGAGCAGCATGCCCCGGGCCCCCTCTGCAGCCAGATCGGAGGGGGACACCAAGGAGACGGTGGCCACCATGGCAGTCCGGGGTCCAAGCCCCAGAAGCCCTTGGCGGGAGCAGGGACCAAGTCAGTTTGGGAAGCAGGGGGCCGAGGGGGTCCCTGTGCACCACCGAGCCCGGCGCTGTACATGTTTTACCTACAAGGACAAAGAGTGCGTCTACTATTGCCACCTGGACATCATCTGGATCAACACTCCTGAACGGACTGTGCCCTATGGACTGTCCAGCTACAGAGGCAGCGGAAGCAGGGGCAGGAGGTCGGCTGGGCAGTTCCCGCAGAGCCCACAGCCGGTGAAGGGGACACTGCGCTGTGCCTGCACGGAGAGCGATGATGACGCCTGCTTGCAGTTCTGCACCTGGTCCCTGGCTGCCCGCGGGCCCCCTCTGGAGCCTAGCACCACGTCTGTGCCTGAGGAGGTCTGCTGA。

[0017] The nucleotide sequence shown in SEQ ID NO.5:

[0018] The nucleotide sequence shown in SEQ ID NO.6: TAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTAGTATGTAAGTGTAAATAATAAAAACTTAATATCTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGTTAA.

[0019] The vectors described in this invention include: plasmid vectors (extrachromosomal circular DNA molecules derived from bacteria or yeast), viral vectors (modified viruses that have had their pathogenicity and self-replication capabilities removed, but retain their ability to efficiently infect cells and deliver genetic material into cells), bacteriophage vectors, or artificial chromosome vectors (e.g., bacterial artificial chromosome BAC or yeast artificial chromosome YAC).

[0020] Thirdly, the present invention provides a cell comprising the aforementioned expression cassette or the aforementioned vector.

[0021] Fourthly, the present invention provides a method for cultivating transgenic animals, comprising: using the aforementioned expression cassette or the aforementioned vector to introduce transgenic cells into cells; or directly using the aforementioned cells as transgenic cells; The transgenic cells were used to edit the animals.

[0022] Furthermore, the editing includes any one or more of the following methods: somatic cell nuclear transfer, embryo microinjection, or chimeric methods.

[0023] Furthermore, the transgenic cells are selected from one or more of the following: somatic cells, fertilized eggs, embryonic stem cells, induced pluripotent stem cells, or reproductive stem cells.

[0024] Furthermore, the animal in question is a mammal; Preferably, the animal is a sheep.

[0025] The present invention has the following beneficial effects: This invention has developed an expression cassette that can be specifically expressed in sheep through somatic cell nuclear transfer, embryo microinjection, or chimera methods to produce black sheep. These sheep not only have black skin and hair, but also black head, oral mucosa, scleral mucosa, epididymis, and ears.

[0026] This invention is the first to prepare the Wuzhi sheep breed through somatic cell cloning, and the obtained Wuzhi sheep has high nutritional and economic value. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0028] Figure 1 This is a diagram of the pPB-PK5-EDN3-OCT4-NEO-plus carrier provided in Embodiment 1 of the present invention.

[0029] Figure 2 This is the primer design diagram for positive integration pPB-PK5-EDN3-OCT4-NEO-plus cell clone identification PCR provided in Example 2 of the present invention.

[0030] Figure 3 This is a diagram of the K5-F / R identification results provided in Embodiment 2 of the present invention.

[0031] Figure 4 The Suffolk sheep and wild-type Suffolk sheep of the F0 generation of black trait provided in Embodiment 3 of the present invention; wherein, BQ represents black sheep and WT represents wild-type Suffolk sheep.

[0032] Figure 5 This is a PCR identification image of black sheep provided in Example 4 of the present invention.

[0033] Figure 6 This is a skin and coat phenotypic identification diagram of the black sheep provided in Embodiment 4 of the present invention. BQ represents black sheep and WT represents wild-type Suffolk sheep.

[0034] Figure 7 The images provided in Embodiment 4 of this invention are phenotypic identification diagrams of the tongue, oral mucosa, scleral mucosa, epididymis, and ears of the Wuzhi sheep. BQ represents the Wuzhi sheep, and WT represents the wild-type Suffolk sheep.

[0035] Figure 8 This is a Masson-Fontana staining result of the basal layer of the back skin of black sheep and wild-type sheep provided in Example 4 of the present invention. BQ represents black sheep, which has a phenotype of black hair and black skin, and WT represents wild-type Suffolk sheep, which has a phenotype of white hair and white skin.

[0036] Figure 9This is a Masson-Fontana staining result of the dermal layer of the back skin of black sheep and wild-type sheep provided in Example 4 of the present invention. BQ represents black sheep, with a phenotype of black hair and black skin, and WT represents wild-type Suffolk sheep, with a phenotype of white hair and white skin.

[0037] Figure 10 The images shown are Masson-Fontana staining results of the hair follicles on the backs of black sheep and wild-type sheep provided in Example 4 of this invention. BQ represents black sheep, which has a phenotype of black hair and black skin, and WT represents wild-type Suffolk sheep, which has a phenotype of white hair and white skin. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0039] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0040] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0041] In the following examples, DMEM culture medium, trypsin, PBS buffer, and FBS are all commercially available, for example, from Gibco or Life Technologies.

[0042] In the following examples, the shock buffer and shock cup are commercially available, for example, from LONZA.

[0043] Example 1: Construction of pPB-PK5-EDN3-OCT4-NEO-plus vector 1. Construction of pPB-PK5-OCT4-NEO-plus vector The main process of the construction method involves synthesizing four genes, namely G-P5-1, G-P5-2, G-P5-3, and G-P5-4, using gene synthesis methods. These four genes were then amplified into a vector using a GIBSON assembly kit and fused into the pUC57 vector.

[0044] The specific procedure is as follows: digest the pUC57 vector with Afl III and AatII enzymes, recover the 1.8kb backbone vector, and then assemble it with the above 4 PCR fragments in one step using GIBOSIN to construct pPB-PK5-OCT4-NEO-plus.

[0045] (2) Construction of pPB-PK5-EDN3-OCT4-NEO-plus vector The main construction process involves synthesizing a gene, EDN3 (SEQ ID NO.3), and then constructing it into the pPB-PK5-OCT4-NEO-plus vector using an enzyme digestion and ligation method. Specifically, the pPB-PK5-OCT4-NEO-plus vector is digested with NotI, dephosphorylated, and the 13kb backbone vector is recovered. Then, the EDN3 gene is digested with NotI to synthesize the vector, the 600bp fragment is recovered, and the pPB-PK5-EDN3-OCT4-NEO-plus is constructed in one step. This vector contains key elements including the PB element, the 5' end regulatory region of K5, the β-globin intron element, the EDN3 gene, and the OCT4-NEO self-cleaving element (see [link to documentation]). Figure 1 ).

[0046] The sequence number is as follows: 1-983bp is the 5PB end, SEQ ID NO.1; 1001-6253bp is PK5, SEQ ID NO.2; 6277-7115bp is β-globin intron, SEQ ID NO.3; 7128-7694bp is EDN3, SEQ ID NO.4; 8243-13751bp is OCT4-NEO self-cutting element, SEQ ID NO.5; and 13764-14005bp is the 3PB end, SEQ ID NO.6.

[0047] Example 2: Obtaining transgenic positive cell clones In this embodiment, a method for preparing a transgenic positive cell clone includes: Establishment of sheep fetal fibroblasts.

[0048] The establishment method is based on patent ZL202110740406.3.

[0049] 2. Electroporation of sheep fetal fibroblasts and screening of cell clonal sites.

[0050] (1) Two days before electroporation, 2×10 5The sheep fibroblast cell line obtained in step 1 above was revived in a 6-well plate and 4 mL of DMEM medium containing 10% (v / v) fetal bovine serum (FBS) was added. The plate was then incubated at 37°C in a 5% CO2 incubator.

[0051] (2) After the cells in the 6-well plate have grown to a confluence, approximately 1×10 6 Digest cells with 1 mL of 0.25% trypsin solution. Centrifuge at 1000g for 5 min to pellet the cells. Wash the cell pellet once with PBS buffer. Resuspend the cells in 100 μL of electroporation buffer to obtain a cell suspension.

[0052] (3) Add 3 μg of expression vector pPB-K5-EDN3 and 1 μg of pCAG-PB enzyme vector prepared in Example 1 to 100 μL of the cell suspension obtained in (2) above, mix and transfer into an electroporation cuvette.

[0053] (4) Electrolyze the cells with an electric field strength of 1.2KV / cm and a pulse time of 1ms.

[0054] (5) Transfer the electrolyzed cells into a 60 mm cell culture dish; add 4 mL of DMEM culture medium containing 10% (volume percentage) fetal bovine serum, and culture in a CO2 incubator. Once the cells have recovered their growth status, they are selected by G418.

[0055] (6) When the cell clones in the culture dish grow to a diameter of more than 2 mm, remove the culture medium, rinse with DPBS, cover the clone cluster with a cloning loop, add about 100 μL of 0.1% trypsin at 37°C, digest for about 3 min, add DMEM medium containing 20% ​​(v / v) FBS to stop digestion, gently pipette and transfer to a 48-well plate for expansion culture.

[0056] (7) When the cell fusion rate in the 48-well plate reaches 90%, half of the cells are digested and used for cell clone genotype identification, while the remaining half are cultured in the well plate.

[0057] (8) After centrifuging the cells used for genotyping at 1000g for 5min, discard the supernatant and add 10-20μL of cell lysis buffer (50mm KCl, 2.5mm MgCl2, 10mm Tris-HCl, 0.45% NP40, 0.45% Tween 20 and 0.2mg / mL proteinase K) according to the amount of cell precipitate.

[0058] 3. Identification of positive cell clonal sites.

[0059] (1) Use 3 μL of cell lysate as a template for PCR identification. Use primer pairs consisting of K5-F / R, 5PB-K5-F1 / R1, and 3PB-K5-F1 / R1 (see primer design location). Figure 2 PCR amplification was performed.

[0060] K5-F: TCGGCTCCTAGATAACAGA; K5-R:AAAAGTTCAAAGACGGCCCT; 5PB-K5-F1: TGCTTGTCAATGCGGTAAGT; 5PB-K5-R1:AAAGAAAGAGGCAGTGTCCC; 3PB-K5-F1: ATCGATTGATTTACGGCGCT; 3PB-K5-R1:GACGCATGTGTTTTATCGGTC.

[0061] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0062] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0063] The amplified sizes were 1484bp, 2110bp, and 2339bp, respectively. Figure 3 Example of identification results for K5-F / R.

[0064] After purifying and sequencing the amplification products obtained from the above PCR amplification, cloned sheep were prepared.

[0065] Example 3: Preparation of embryos and cloned sheep via nuclear transfer 1. In vitro maturation of sheep oocytes.

[0066] Ovaries were retrieved from the slaughterhouse and transported back to the laboratory. Follicles measuring 3-6 mm on the surface of the ovary were aspirated using a 20 mL syringe equipped with an 18-gauge needle. Under a stereomicroscope, cumulus-oocyte complexes (COCs) with ≥2 layers of cumulus cells, dense structure, and homogeneous cytoplasm were selected and cultured in an in vitro maturation medium for 22 hours.

[0067] 2. Somatic cell preparation.

[0068] Using the serum starvation method, when the cells (the gene-edited positive cell clones constructed in Example 2) reached 80% confluence, they were subjected to serum starvation treatment, that is, the FBS concentration in the culture medium was reduced from 20% to 0.5% and cultured for 2-5 days. The cells were digested, centrifuged and washed according to conventional methods, and finally the cell pellet was resuspended in 1 mL of micromanipulation solution for use as donor cells.

[0069] 3. Enucleation of recipient oocytes and nuclear transfer of donor cells.

[0070] Enucleation of mature oocytes was performed using a blind aspiration method. After cumulus exfoliation of mature oocytes (22 h old), oocytes with homogeneous cytoplasm, a clear perivitelline space, and intact cell membranes were selected and placed in a micromanipulation droplet. Under micromanipulation, the first polar body and a small amount of cytoplasm near it were aspirated. A single, round, smooth somatic cell (15-20 μM in diameter) with strong refractive properties was selected and injected subzonal pellucida of the enucleated oocyte through the enucleation needle insertion point, ensuring close contact between the donor cell and the oocyte membrane. 25-30 oocytes were processed per batch. After all procedures were completed, the donor cell-oocyte cytoplasm pair was transferred to culture medium and incubated for 1-2 hours in a 5% CO2, 100% humidity incubator.

[0071] 4. Integration and activation.

[0072] The reconstructed oocytes were transferred in batches to the fusion medium and equilibrated for 3 minutes. After washing three times with the fusion / activation solution, five oocytes per batch were placed in a fusion tank filled with fusion medium. The reconstructed oocytes were moved with a drawn, fine-tipped solid glass needle to make the donor cell-recipient oocyte membrane contact surface parallel to the electrode. A 30 μs, 2.0 kV / cm DC pulse was applied using an ECM2001 fusion instrument to induce fusion and activate the cells. The cells were washed five times with culture medium and immediately transferred to a mineral oil-covered embryo culture medium. After incubation at 5% CO2 and 100% humidity for 0.5 to 1 hour, the cells were removed and the fusion was assessed under a stereomicroscope.

[0073] 5. Embryo culture.

[0074] The successfully fused reconstructed embryos were washed five times with embryo culture medium and then transferred to embryo culture medium. Eight to ten reconstructed embryos were cultured in 30 μL droplets each, and the cleavage rate was recorded after 48 h of culture.

[0075] 6. Embryo transfer.

[0076] Select recipient ewes in estrus at the same time. Anesthetize them with sedative nigra II. After disinfecting the abdomen, make an 8-10cm incision along the midline of the abdomen, and pull out the ovary and fimbriae of the oviduct. Insert a transfer tube containing selected embryos at least 5cm into the oviduct (to the ampulla-isthmus junction) through the fimbriae, and inject the qualified embryos. The transferred embryos include two types: one is embryos developed to the 2 / 4 / 8 cell stage, with equal division of blastomeres and no cytoplasmic debris; the other is embryos at the 1 / 2 cell stage, where 2-cell embryos divide equally and single-cell embryos are compact. The procedure is sutured. After embryo transfer, administer the agonist benzoxazole hydrochloride (0.15mL) intramuscularly to the lateral hind leg of each ewe to relieve the anesthesia. Then, administer oxytetracycline (5mL) intramuscularly to each ewe to prevent subsequent inflammation and infection.

[0077] 7. The cloned sheep is born.

[0078] After five months of gestation, the cloned sheep was born, resulting in F0 generation cloned sheep that expressed EDN3 and exhibited a whole-body melanin phenotype (e.g. Figure 4 (As shown).

[0079] Example 4: Identification of F0-positive sheep 1. Identification of F0 generation sheep DNA.

[0080] After the F0 generation cloned sheep were born, ear tissue was collected by ear tagging and preserved in alcohol before being sent back to the laboratory. The tissue fragments were placed in a 1.5 mL centrifuge tube and homogenized to obtain a cell suspension. The suspension was then centrifuged at 10,000 rpm (~11200×g) for 1 min. The supernatant was discarded, and 200 μL of buffer GA was added. The suspension was vortexed until completely resuspended. 20 μL of proteinase K (20 mg / mL) and 200 μL of anhydrous ethanol were added, and the mixture was thoroughly vortexed for 15 seconds. A flocculent precipitate may appear at this point; a brief centrifugation was performed to remove any water droplets from the inner wall of the tube cap. The solution and the flocculent precipitate were then added to an adsorption column CB3 (placed in a collection tube). The column was centrifuged at 12,000 rpm (~13400×g) for 30 seconds. The waste liquid was discarded, and the adsorption column CB3 was returned to the collection tube. Add 500 μL of buffer GD to the adsorption column CB3 (please check that anhydrous ethanol has been added before use), centrifuge at 12000 rpm (~13400×g) for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into a collection tube. Add 600 μL of wash buffer PW to the adsorption column CB3 (please check that anhydrous ethanol has been added before use), centrifuge at 12000 rpm (~13400×g) for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into a collection tube (repeat this step twice). Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm (~13400×g) for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for 5 minutes to thoroughly dry any remaining wash liquid in the adsorption material. Transfer the CB3 adsorption column into a clean centrifuge tube. Add 20 μL of ddH2O dropwise to the center of the adsorption membrane, incubate at room temperature for 5 min, and centrifuge at 12000 rpm (~13400 × g) for 2 min. Collect the solution in the centrifuge tube. Detect the genomic DNA concentration using 0.7% agarose gel electrophoresis. Measure the concentration and purity of the genomic DNA at 260 / 280 nm wavelengths, adjust to an appropriate concentration, and store at -20℃. Simultaneously, use primers consisting of K5-F / R (primer design location see...) Figure 2 PCR amplification was performed using the following primer pairs: K5-F: TCGGCTCCTAGATAACAGA, K5-R:AAAAGTTCAAAGACGGCCCT.

[0081] The reaction system consisted of 20 μL of 1 μL DNA template, 1 μL primer F1 (10 μM), 1 μL primer R1 (10 μM), 10 μL 2×Taq PCR Master Mix, and 7 μL ddH2O.

[0082] Reaction program: 95℃ for 3 min; 95℃ for 15 s, 57℃ for 15 s, 72℃ for 1 min 30 s, 30 cycles; 72℃ for 5 min, store at 4℃.

[0083] PCR was followed by first-generation sequencing.

[0084] Figure 5 The image shows the PCR sequencing results. All cloned sheep have integrated the EDN3 gene, and the sequencing results are completely in line with expectations.

[0085] 2. Observation of F0 positive sheep black pheasant traits.

[0086] There are two main methods. The first is to shave off the wool from the WT control sheep and the positive sheep, and then observe and take pictures to determine whether the skin is black. The second is to slaughter the WT control sheep and the positive sheep normally, and then systematically observe the overall color of various parts of their bodies (such as the back, legs, and tongue) and take pictures to determine whether the skin is black.

[0087] (1) The results are as follows Figure 6 As shown, the skin and hair of wild-type WT sheep were observed to be white using two methods, while the skin and hair of positive sheep were black.

[0088] (2) From Figure 7 It can also be seen that, in addition to the skin and hair turning black, the tongue, oral mucosa, scleral mucosa, epididymis and ears of the positive sheep also turn black.

[0089] 3. Masson-Fontana staining of F0-positive sheep skin and hair follicles.

[0090] Masson-Fontana staining utilizes the inherent reducing properties of melanin. Through the redox reaction of silver ammonia solution (i.e., silver ammonia complex), a black metallic silver precipitate is generated, which can be directly and sensitively displayed under a light microscope to show the presence and distribution of melanin. It is a classic technique for diagnosing the presence of melanin.

[0091] Masson staining was performed on the back skin and hair follicle tissue of WT control sheep and positive sheep. The WT control sheep showed a white hair and white skin phenotype on their backs, while the positive sheep showed a black hair and black skin phenotype on their backs. From the results ( Figures 8-10 It can be seen that: from Figure 8 It can be seen that the basal layer of the back skin of WT control sheep (WT sheep) has no melanin in most parts, and a small amount of melanin can be seen in a few parts; positive sheep (BQ-END3 overexpressing sheep) have a large amount of melanin in the basal layer of the back skin.

[0092] from Figure 9It can be seen that there is no melanin in the dermis of the back skin of WT sheep; while a large amount of melanin can be seen in the dermis of the back skin of positive sheep (BQ sheep).

[0093] from Figure 10 It can be seen that most of the hair follicles on the back of WT sheep do not contain melanin, and a small number of hair follicles may contain melanin, but the hair color is white and there is no melanin in the hair; positive sheep (BQ sheep) have a small amount of melanin in the hair follicles on the back of their skin, and the hair color is black.

[0094] In summary, this study successfully created a gene-edited cloned sheep with a novel black trait. The resulting black sheep exhibits black skin, hair, tongue, oral mucosa, scleral mucosa, epididymis, and ears, with abundant melanin expression in the dermis, stroma, and hair follicles. This novel black sheep possesses significant application and economic value.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An expression box, characterized in that, include: PK5, β-globin introns, and the EDN3 gene; The PK5 gene comprises the nucleotide sequence shown in SEQ ID NO.2; the EDN3 gene comprises the nucleotide sequence shown in SEQ ID NO.

4.

2. The expression box according to claim 1, characterized in that, The introns of the β-globin include the nucleotide sequence shown in SEQ ID NO.

3.

3. The expression box according to claim 1 or 2, characterized in that, It also includes a screening element, which is an OCT4-NEO screening marker gene self-splicing element.

4. A carrier, characterized in that, Includes the expression box as described in any one of claims 1-3.

5. The carrier according to claim 4, characterized in that, The gene includes a 5PB terminus before PK5 and a 3PB terminus after EDN3. The 5PB end includes the nucleotide sequence shown in SEQ ID NO.1, and the 3PB end includes the nucleotide sequence shown in SEQ ID NO.

6.

6. A cell, characterized in that, Includes the expression box as described in any one of claims 1-3, or the carrier as described in claim 4 or 5.

7. A method for cultivating black-feathered animals, characterized in that, include: Transgenic cells are obtained by introducing the expression cassette according to any one of claims 1-3 or the vector according to claim 4 or 5 into cells; Alternatively, the cells described in claim 6 may be used directly as transgenic cells; The transgenic cells were used to edit the animals.

8. The method according to claim 7, characterized in that, The editing includes any one or more of the following: somatic cell nuclear transfer, embryo microinjection, or chimeric methods.

9. The method according to claim 7 or 8, characterized in that, The transgenic cells are selected from one or more of the following: somatic cells, fertilized eggs, embryonic stem cells, induced pluripotent stem cells, or reproductive stem cells.

10. The method according to claim 7 or 8, characterized in that, The animal in question is a sheep.

Citation Information

Patent Citations

  • High-efficiency sheep embryo skeletal muscle primary cell culture method

    CN113186155A

  • Animal cell overexpressing matrix metalloprotease-9(MMP-9) and use thereof

    JP2013223487A

  • Foxn1 and pigmentation

    US20050191242A1

  • Transgenic animals with customizable traits

    WO2014145196A2

  • 3D suspension method for growing autologous melanocyte by inducing ips cells and application thereof

    WO2019210887A2