A visual detection kit for realizing the resistance of botrytis cinerea to methoxy acrylate fungicides based on rpa-crispr / cas12a
By utilizing the RPA-CRISPR/Cas12a system and specific RPA primer pairs and fluorescent reporter probes, a rapid, simple, and visual detection of methoxyacrylate fungicides by Grape Botrytis cinerea was achieved, solving the problem of field detection and improving the sensitivity and specificity of the detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
- Filing Date
- 2025-12-23
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies make it difficult to quickly and easily detect the resistance of grape botrytis cinerea to methoxyacrylate fungicides in the field. Traditional detection methods require specialized equipment and have long testing cycles.
Using the RPA-CRISPR/Cas12a system, specific RPA primer pairs are used to amplify cytb gene mutation sites, and combined with specific crRNA and fluorescent reporter probes, rapid and visual detection is achieved.
The method enables the detection of resistance to methoxyacrylate fungicides in grape botrytis cinerea within one hour under constant temperature conditions, simplifying the operation, reducing dependence on equipment, and improving the sensitivity and specificity of the detection.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant pathogenic fungal resistance detection, specifically involving a visualization detection kit based on RPA-CRISPR / Cas12a to detect resistance of grape botrytis cinerea to methoxyacrylate (QoIs) fungicides and its field application. Background Technology
[0002] During grape cultivation, Botrytis cinerea (Glaucus spp.) Botrytis cinerea Botrytis cinerea, caused by fungal infection, is one of the major fungal diseases hindering the green development of the grape industry and causing significant economic losses. Botrytis cinerea can damage grapes during the flowering and fruiting stages, invading through wounds, natural openings, and direct penetration of the epidermis. It causes light brown lesions that later develop into dark brown, sunken spots, leading to the rotting and deterioration of inflorescences and fruits. In high humidity environments, a grayish-brown mold layer appears on the affected areas, and in severe cases, flower spikes and fruits fall off. Furthermore, the multi-pathway infection characteristics of Botrytis cinerea significantly reduce the effectiveness of single control methods (such as physical barriers like bagging or contact fungicides).
[0003] Currently, the control of Botrytis cinerea (grape gray mold) both domestically and internationally mainly relies on single-site fungicides from chemical agents. These fungicides include succinate dehydrogenase inhibitors (SDHI) and methoxyacrylates (QoIs) that act on the fungal respiratory chain; benzimidazole fungicides (MBCs), N-aniline carbamates (NPCs), and dicarboximide fungicides (DCFs) that interfere with normal cell division; sterol biosynthesis inhibitors (SBIs) that inhibit ergosterol biosynthesis; and other fungicides such as benzylpyrroles, pyridineamines, and aniline pyrimidines. Although these agents are highly effective against Botrytis cinerea, the problem of resistance to some agents is becoming increasingly prominent, mainly manifested in point mutations at the target sites of the agents, overexpression of target proteins, and ectoexcretion. Therefore, establishing rapid field detection methods for Botrytis cinerea resistance to methoxyacrylate (QoIs) fungicides is crucial for guiding scientific pesticide use and is an important means to achieve efficient control of grape gray mold.
[0004] Currently, the main technologies for detecting antibiotic resistance in pathogens are bioassays and molecular assays. While these methods offer high accuracy, they require operators with a certain level of expertise, have long testing cycles, and rely on complex equipment, making rapid field testing difficult. In contrast, the RPA combined with the CRISPR-Cas system enables rapid on-site detection within one hour under constant temperature conditions without complex instruments. After successful binding of the specific crRNA to the target, it activates the trans-cleavage activity of Cas12a, indiscriminately cleaving ssDNA (FQ-Reporter) present in the system, releasing a fluorescent signal for visual detection.
[0005] Given the increasingly serious field resistance of Botrytis cinerea to methoxyacrylate (QoIs) fungicides in grape production, this study developed an RPA-CRISPR / Cas12a-FQ-Reporter visual resistance detection method. This method helps to promptly assess the development of Botrytis cinerea resistance and provides scientific guidance for the control of gray mold. Summary of the Invention
[0006] To address the limitations of current traditional methods for detecting pathogen resistance, the present invention aims to provide a rapid, simple, and visually perceptible method for assessing the field resistance of Botrytis cinerea to methoxyacrylate (QoIs) fungicides.
[0007] The objective of this invention can be achieved through the following technical solutions:
[0008] A visualization detection composition for detecting resistance of Grape Botrytis cinerea to methoxyacrylate (QoIs) fungicides based on RPA-CRISPR / Cas12a, comprising the following components: for amplifying... cytb Specific RPA primer pairs for gene mutation sites, targeting cytb Specific crRNA and fluorescent reporter probes for gene mutation sites.
[0009] The cytb A point mutation in the gene (SEQ ID No. 5) from GGT to GCT resulted in the change of amino acid at position 143 from glycine to alanine (G143A) (Gao Jing, Zhou Mingguo. Research progress on resistance to SDHIs and QoIs fungicides [J]. Modern Pesticides, 2022, 21(05):7-12+33).
[0010] The gray mold strain cytb The nucleotide sequence of the gene with point mutation is shown in SEQ ID No. 4 in the sequence listing.
[0011] The amplification containing cytb In the specific RPA primer pairs for gene mutation sites:
[0012] The nucleotide sequence of the forward primer (GCTcytb-F1) is shown in SEQ ID No. 1 of the sequence listing.
[0013] The nucleotide sequence of the reverse primer (GCTcytb-R1) is shown in SEQ ID No. 2 of the sequence listing.
[0014] To improve the specificity of crRNA recognition, a mismatched base (underlined, changing A to U) is artificially introduced at the mutation site -2; specifically, the target... cytb The nucleotide sequence of the specific crRNA (Bccytb1) at the gene mutation site is shown in SEQ ID No. 3 in the sequence listing.
[0015] The fluorescent reporter probe (FQ-Reporter) used for visual detection is an ssDNA with a 5' end modified with a FAM fluorescent group and a 3' end labeled with a BHQ1 quenching group. Specifically, the nucleotide sequence is: 5'6-FAM-TTTAAAAAATTT-BHQ1-3'.
[0016] A further aspect of the present invention provides a visual detection method for detecting resistance of Grape Botrytis cinerea to methoxyacrylate (QoIs) fungicides based on RPA-CRISPR / Cas12a, comprising the following steps:
[0017] S1. Extract genomic DNA from the sample to be tested;
[0018] S2. RPA amplification of the genomic DNA of the sample to be tested is performed using the specific RPA primer pair described above;
[0019] S3. The product amplified by RPA is added to a solution containing LbCas12a (Cpf1), NEBuffer 2.1, RNase-free water, dithiothreitol (DTT), the fluorescent reporter probe (FQ-Reporter), and the specific crRNA for reaction.
[0020] S4. After the reaction is complete, observe the fluorescence phenomenon of the product under a UV flashlight with a wavelength of 365 nm.
[0021] Furthermore, in step S1, genomic DNA of the sample to be tested is extracted using the CTAB method.
[0022] Furthermore, in step S2:
[0023] (1) In order to improve the intolerance of Cas12a to DNA, the present invention will perform asymmetric RPA amplification to obtain ssDNA for subsequent CRISPR-Cas12a reaction: in the specific primer pair used for RPA amplification, the concentration of the forward primer is 2 μM and the concentration of the reverse primer is 10 μM. The amplification of ssDNA is achieved by changing the primer concentration ratio.
[0024] (2) The reaction conditions are: 43℃, 20 min.
[0025] Furthermore, in step S3, the reaction conditions are: 37°C for 30 min.
[0026] Preferably, the concentration of the fluorescent reporter probe in the CRISPR-Cas12a system is 1000 nM. The final concentration of LbCas12a in the CRISPR-Cas12a system is 300 nM. In the CRISPR-Cas12a system, the molar ratio of LbCas12a to crRNA is 2:1.
[0027] Furthermore, in step S4, immediately after the reaction is completed, the product is irradiated with a 365 nm ultraviolet flashlight. Based on the fluorescence, the appearance of green fluorescence indicates that the pathogen has developed resistance to methoxyacrylate (QoIs) fungicides, while the absence of green fluorescence indicates that the pathogen has not developed resistance to methoxyacrylate (QoIs) fungicides.
[0028] The technical solution provided by this invention firstly achieves the amplification of a certain amount of ssDNA on the basis of amplified dsDNA by reducing the concentration of RPA forward primer and increasing the concentration of RPA reverse primer. Then, the product is added to the solution system of CRISPR-Cas12a and fluorescent reporter probe.
[0029] Technical mechanism of the present invention:
[0030] (1) By changing the primer concentration ratio, the RPA amplification system contains one excess primer and one restriction primer. In the later stage of the cycle amplification, the restriction primer is exhausted, and the excess primer continues to amplify one DNA strand in one direction on the basis of dsDNA, eventually producing a large amount of ssDNA.
[0031] (2) The Cas12a / crRNA complex recognizes mutations within 1-8 bp after the PAM (5ˈ-TTTN / NAAA-3ˈ) site, i.e., the seed region, with high specificity. However, the mutations described in this invention... cytbThe location of the gene base mutation is outside the seed region recognized by the complex, reducing the sensitivity of CRISPR-Cas12a to mutations. The complex can recognize ssDNA without the PAM site, which not only expands the application range of Cas12a but also shows that Cas12a is intolerant to ssDNA mutations. Therefore, this invention, based on this, artificially introduces a mismatched base at the mutation site-2 position to improve the specificity of the entire detection system. Simultaneously, only when the DNA of the test sample matches the specific crRNA described above can the indiscriminate trans-cleavage activity of Cas12a be activated, cleaving the fluorescent reporter probe in the system, thereby emitting green fluorescence under a 365 nm UV flashlight. One mismatched base is present in resistant strains, while two mismatched bases are present in sensitive strains, better distinguishing between sensitive and resistant strains.
[0032] Beneficial technical effects of the present invention:
[0033] (1) By reducing the concentration of the RPA forward primer and increasing the concentration of the RPA reverse primer, a certain amount of ssDNA can be amplified on the basis of the amplified dsDNA, thereby improving the sensitivity of the detection reaction.
[0034] (2) The specificity of the entire detection system was improved by artificially introducing a mismatched base at the -2 position of the mutation site in crRNA. This detection method can detect whether Grape Botrytis cinerea is sensitive or resistant to methoxyacrylate (QoIs) fungicides within one hour. Attached Figure Description
[0035] Figure 1 This is a schematic diagram illustrating the experimental principle of the present invention.
[0036] Figure 2 Figure 4 shows the gel electrophoresis diagram of the optimized RPA amplification system in Example 4. M: DL2000 DNA Marker, CK: negative control (RNase-free water). Figure A shows the optimized RPA reaction time, Figure B shows the optimized RPA primer concentration ratio, and Figure C shows the optimized RPA reaction temperature.
[0037] Figure 3 This is a real-time fluorescence data graph of the time-optimized CRISPR-Cas12a detection system in Example 5. The negative controls are all RNase-free water.
[0038] Figure 4 The images show fluorescence visualization results and real-time fluorescence data of the CRISPR-Cas12a detection system with optimized FQ-Reporter concentration in Example 5. The negative control is RNase-free water.
[0039] Figure 5 The images show the fluorescence visualization results and real-time fluorescence data of the optimized reaction ratio of LbCas12a and crRNA in the CRISPR-Cas12a detection system in Example 5. The negative control is RNase-free water.
[0040] Figure 6 The images show the fluorescence visualization results and real-time fluorescence data of the CRISPR-Cas12a detection system with optimized LbCas12a concentration in Example 5. The negative control is RNase-free water.
[0041] Figure 7 The images show the fluorescence visualization results and real-time fluorescence data specific to the CRISPR-Cas12a detection system in Example 6. The negative controls are all RNase-free water.
[0042] Figure 8 The images show fluorescence visualization results and real-time fluorescence data of the CRISPR-Cas12a detection system in Example 7. The negative control is RNase-free water. Detailed Implementation
[0043] The present invention will be described in detail below through specific embodiments, but this does not limit the invention in any way. Unless otherwise specified, the methods in the following embodiments are conventional methods.
[0044] In this invention, "resistant strains" refers to *Botrytis cinerea* strains that exhibit resistance to methoxyacrylate (QoIs) fungicides. Botrytis cinerea "Resistant strains" refer to Botrytis cinerea strains that are sensitive to methoxyacrylate (QoIs) fungicides. Botrytis cinerea ).
[0045] The gray mold strains involved in this invention are all strains preserved by the Institute of Plant Protection, Beijing Academy of Agricultural and Forestry Sciences. Sensitive and resistant strains have been identified in the early stages using conventional technical methods.
[0046] Activated *Botrytis cinerea* strains were inoculated onto solid PDA medium containing pyraclostrobin fungicide (concentrations of 0, 20, and 50 μg / mL). After 3–4 days of cultivation, the growth of the strains was observed. Strains that grew normally on 50 μg / mL PDA plates were identified as resistant strains. Simultaneously, the batch of *Botrytis cinerea* strains was purified, and their genomic DNA was extracted and amplified by conventional PCR. cytb The gene fragments and products were sent to Beijing Nuosai Genome Research Center Co., Ltd. for sequencing to obtain the strain sequence. The sequencing results were consistent with the results of the resistance phenotype determination.
[0047] Example 1: Design and screening of specific RPA primer pairs:
[0048] 1.1 This invention selects several susceptible and resistant strains that have been previously established using conventional techniques, and uses primers Bccytb-F1 / R1 to target *Botrytis cinerea* strains. cytb The gene was amplified using standard PCR. Successful amplification was confirmed by 2% agarose gel electrophoresis. cytb The PCR products were sent to Beijing Nuosai Genome Research Center Co., Ltd. for sequencing. The standard strain of *Botrytis cinerea* was downloaded from the NCBI website. cytb Gene sequence. The sequencing results returned by the company, along with those from the standard strain... cytb The gene sequence was aligned to nucleotides using MAFFT version 7, and sequence analysis was performed using Bioedit software to identify mutation sites. Using Oligo 7.0 primer design software, following RPA primer design principles, 30 bp forward and reverse primers were designed, resulting in an amplified fragment of 230 bp containing the mutation site (sequence 4 in the sequence listing). Specific RPA primers were synthesized at Sangon Biotech Beijing branch.
[0049] Conventional PCR amplification cytb Primer pair sequences for the gene:
[0050] Bccytb-F1: 5ˈ -CGTCGGCCATATAAAAGGTC -3ˈ (SEQ ID No. 6);
[0051] Bccytb-R1: 5ˈ - CTCCATCCACCATACCTACA -3ˈ (SEQ ID No. 7).
[0052] Standard PCR amplification reaction system (50 μL): 1.1 x S4 Fidelity PCR Mix 44 μL, Bccytb-F1 2 μL, Bccytb-R1 2 μL, template DNA 2 μL.
[0053] Standard PCR amplification procedure: First, incubate at 98℃ for 2 min; then incubate at 98℃ for 10 s, 54℃ for 15 s, and 72℃ for 10 s for 35 cycles; finally, incubate at 72℃ for 5 min; store at 4℃.
[0054] 1.2 RPA primer pairs were screened according to the RPA reaction system recommended by the TwistAmp® Basic (UK, TwistDX) kit.
[0055] Isothermal RPA amplification reaction system (50 μL): Rehydration buffer 29.5 μL, Forward primer (10 μM) 2.5 μL, Reverse primer (10 μM) 2.5 μL, RNase-free water 11 μL, DNA template 2 μL, MgOAc (280 nM) 2.5 μL.
[0056] Except for MgOAc, all other components were mixed and added to a tube containing lyophilized RPA amplification enzyme. MgOAc was added last to the cap. After centrifugation and mixing, the tube was placed in a 37°C constant temperature instrument for amplification for 30 min.
[0057] 1.3 After RPA amplification is complete, 50 μL of the amplification product is added to a centrifuge tube containing 150 μL of ddH2O. Then, 200 μL of phenol:chloroform:isoamyl alcohol (25:24:1) solution is added in a fume hood. After vortexing and mixing, the mixture is centrifuged at 12,000 rpm for 5 min. After the reaction is complete, 20 μL of the supernatant is transferred to a new PCR tube. Finally, 2 μL of 10x DNALoadingbuffer is added and vortexed.
[0058] 1.4 6 μL of product was spotted into the wells of a prepared 2% agarose gel for electrophoresis. A 2000 bp DNA marker was selected as a control. Electrophoresis was performed at 130 V and 400 mA for 25 min. After electrophoresis, the banding results were observed using a gel imaging system from Beijing Cyber-Tech. The RPA primers (GCTcytb-F1 / GCTcytb-R1) with the best amplification effect were finally selected for subsequent experiments.
[0059] The nucleotide sequences of the RPA primer pairs are shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing.
[0060] 1.5 Set the concentration of the forward primer GCTcytb-F1 to 1 μM and the reverse primer GCTcytb-R1 to 10 μM for the RPA primer pair. Other operations are described in 1.2-1.4 of Example 1. By changing the primer concentration ratio, ensure that the amount of ssDNA required for subsequent experiments is amplified.
[0061] Example 2: Design and screening of specific crRNAs:
[0062] 1.1 Using the aforementioned Botrytis cinerea strain cytbThe nucleotide sequence of the gene with point mutation was used as a template for designing crRNA. To improve the sensitivity of the crRNA to mismatches, it was truncated to 18 bp after the PAM site, covering the target mutation site, and a mismatched base was artificially introduced near the mutation site.
[0063] 1.2 RPA amplification products were subjected to CRISPR-Cas12a reaction to screen for the best crRNA.
[0064] CRISPR-Cas12a reaction system (20 μL): DEPC-H2O 12.2 μL, NEBuffer 2.1 (10×) 2 μL, LbCas12a (5 μM) 0.4 μL, RNase inhibitor (40 U / μL) 0.5 μL, DTT (0.1 mmol / L) 0.5 μL, crRNA (10 μM) 0.4 μL, FQ-Reporter (10 μM) 2 μL, RPA amplification product 2 μL.
[0065] 1.3 Add the RPA amplification product to the PCR tube cap, and finally mix all reaction components, centrifuge, and place in a 37℃ constant temperature instrument for amplification for 30 min.
[0066] 1.4 Immediately after the CIRSPR-Cas12a reaction, the product was irradiated with a 365 nm UV flashlight to observe fluorescence. Finally, the crRNA (Bccytb1) that could specifically distinguish between sensitive and resistant strains was screened out.
[0067] The crRNA nucleotide sequence (Bccytb1) is shown in SEQ ID No. 3 in the sequence listing.
[0068] Example 3: Design of a fluorescent reporter probe
[0069] The fluorescent reporter probe described in this invention is an ssDNA labeled with the fluorescent group FAM at one end and the quenching group BHQ1 at the other end.
[0070] Fluorescent reporter probe (FQ-Reporter) nucleotide sequence: 5ˈ6-FAM-TTTAAAAAATTT-BHQ1-3ˈ.
[0071] Example 4: Optimization Design of RPA Amplification System
[0072] To obtain the optimal RPA amplification reaction system, the present invention employs the following optimization design:
[0073] (1) The RPA reaction temperature was fixed at 37℃, and the primer ratio F:R = 1:10. The time gradient was set to 20, 25, 30, 35, 40, and 45 min. At each time point, DNA from one sensitive (strain 249) and one resistant (strain 246) strain was selected as templates, and negative controls were also included. After the RPA reaction, the DNA amplification effect was analyzed by 2% agarose gel electrophoresis. Figure 2 As shown in Figure A, the resistant strain exhibited ssDNA amplification bands at 20 min (its migration rate was visually lower than that of 230 bp dsDNA). To meet the requirements of rapid detection, 20 min was selected as the optimal reaction time.
[0074] (2) The RPA reaction temperature was fixed at 37℃ and the reaction time at 20 min. Primer concentration ratios were set at 1:5, 1:10, 1:20, 1:30, and 1:40. For each concentration ratio, one sensitive (strain 134) and one resistant (strain 242) DNA strain were selected as templates, and negative controls were included in each. After the RPA reaction, the DNA amplification effect was analyzed by 2% agarose gel electrophoresis. Figure 2 As shown in Figure B, the resistant strain exhibited ssDNA amplification bands at a ratio of 1:5 (its migration rate was visually lower than that of 230bp dsDNA), and the ratio tended to stabilize at 1:20. To prevent excessive ssDNA from forming complex structures that would hinder the subsequent recognition of the Cas12a / crRNA complex, a 1:5 primer concentration ratio was chosen as the optimal one.
[0075] (3) The RPA reaction time was fixed at 20 min, and the primer ratio F:R = 1:5. Temperature gradients were set at 33℃, 35℃, 37℃, 39℃, 41℃, 43℃, and 45℃. At each temperature, one sensitive (strain 134) and one resistant (strain 242) DNA strain were selected as templates, and negative controls were included in each case. After the RPA reaction, the DNA amplification effect was analyzed by 2% agarose gel electrophoresis. Figure 2 As shown in Figure C, the resistant strain can amplify the clearest band of ssDNA at 43℃, and 43℃ is selected as the optimal reaction temperature.
[0076] Example 5: Optimized Design of CRISPR-Cas12a Detection System
[0077] To obtain the optimal CRISPR-Cas12a detection system, the present invention employs the following optimization design:
[0078] (1) The final concentrations of all solutions in the CRISPR-Cas12a system were kept constant. Time gradients were set at 5, 10, 15, 20, 25, and 30 min. At each time point, DNA from one sensitive (strain 134) and one resistant (strain 242) strain was used as templates for three replicates, with negative controls included in each. The reaction was performed using a real-time quantitative PCR instrument, with fluorescence signals measured every 1 min. After the reaction was terminated, the product was transferred to a new PCR tube, and fluorescence was immediately observed using a 365 nm UV flashlight. Figure 3 As shown, a significant difference in fluorescence signals was observed between the sensitive and resistant strains at 30 min of reaction, and these strains could be visually distinguished at this time point under a 365 nm UV flashlight. Therefore, 30 min was selected as the optimal detection time for CRISPR-Cas12a.
[0079] (2) The reaction time of the CRISPR-Cas12a system was fixed at 30 min. The final concentration gradient of the fluorescent probe (FQ-Reporter) in the system was set to 200, 400, 600, 800, 1000, 1200, and 1400 nM, while the final concentrations of other solutions in the system remained unchanged. For each concentration, DNA from one sensitive (strain 134) and one resistant (strain 242) strain was selected as templates for three replicates, and negative controls were set for each. The reaction was performed using a real-time quantitative PCR instrument, and the fluorescence signal was measured once every 1 min. After the reaction was terminated, the product was transferred to a new PCR tube, and the fluorescence was immediately observed using a 365 nm UV flashlight. Figure 4 As shown, after 30 minutes of reaction, combined with gel imaging and fluorescence signals, it can be seen that sensitive and resistant strains can be distinguished visually at 1000 nM. Therefore, 1000 nM was selected as the optimal final concentration for the FQ-Reporter.
[0080] (3) The reaction time and fluorescent probe (FQ-Reporter) of the CRISPR-Cas12a system were fixed at 1000 nM. The final ratio gradient of LbCas12a:crRNA in the system was set to 2:1, 1:1, 1:2, 1:4, and 1:5, while the final concentrations of other solutions in the system remained unchanged. For each concentration ratio, DNA from a sensitive (strain 134) and a resistant (strain 242) strain was used as templates for three replicates, and negative controls were set up for each. The reaction was performed using a real-time quantitative PCR instrument, and the fluorescence signal was measured once every 1 min. After the reaction was terminated, the product was transferred to a new PCR tube, and the fluorescence was immediately observed using a 365 nm UV flashlight. Figure 5As shown, after 30 min of reaction, combined with gel imaging and fluorescence signal analysis, a visually identifiable significant difference was observed at an LbCas12a:crRNA ratio of 2:1. Therefore, 2:1 was selected as the optimal final LbCas12a:crRNA ratio.
[0081] (4) To account for detection costs, based on the optimal LbCas12a:crRNA ratio of 2:1, the final concentration gradient of LbCas12a in the system was set to 150, 200, 250, 300, 350, 400, 450, and 500 nM, while the final concentrations of other solutions in the system remained unchanged. For each concentration ratio, DNA from one sensitive (strain 134) and one resistant (strain 242) strain was used as templates for three replicates, with negative controls included in each. The reaction was performed using a real-time quantitative PCR instrument, and fluorescence signals were measured every 1 minute. After the reaction was terminated, the product was transferred to a new PCR tube, and fluorescence was immediately observed using a 365 nm UV flashlight. Figure 6 As shown, after 30 min of reaction, combined with gel imaging and fluorescence signals, it can be seen that sensitive and resistant strains can be visually distinguished at LbCas12a = 300 nM. Therefore, 300 nM was selected as the optimal final concentration of LbCas12a.
[0082] Example 6: Specificity of RPA / CRISPR-Cas12a detection system
[0083] To evaluate the detection specificity of this invention, an optimal CRISPR-Cas12a reaction system was used. RPA primers were employed to test GCTcytb-F1 / R1 against grape gray mold resistance and susceptible strains, and against grape white rot fungus (…). Coniella vitis Grape anthracnose bacteria ( Colletotrichum viniferum Grape blight pathogen ( Neopestalotiopsis sp.), Grape rot fungus ( Paraeutypella citricola Five common grape pathogens were amplified using RPA, with a negative control included. The amplified products were used as templates for CRISPR-Cas12a detection. The reaction was performed using a real-time quantitative PCR instrument, with fluorescence signals measured every 1 minute. Each strain was tested in triplicate. After the reaction was terminated, the products were transferred to new PCR tubes, and fluorescence was immediately observed using a 365 nm UV flashlight. Figure 7 As shown, after 30 min of reaction, combined with gel imaging and fluorescence signals, significant visual differences were observed between the Grape Botrytis-resistant strain and other tested strains. This indicates that the RPA combined with CRISPR-Cas12a detection method established in this study has good specificity for Grape Botrytis-resistant strains.
[0084] Example 7: Sensitivity of RPA / CRISPR-Cas12a Detection System
[0085] To determine the sensitivity of the RPA / CRISPR-Cas12a-based detection method of this invention, the template from a known Grape Botrytis cinerea resistant strain (strain 242) was serially diluted 10-fold to establish seven concentration gradients: 45 ng / μL, 4.5 ng / μL, 450 pg / μL, 45 pg / μL, 4.5 pg / μL, 450 fg / μL, and 45 fg / μL. The reaction was performed using a real-time quantitative PCR instrument, with fluorescence signals measured every 1 minute, and each concentration was repeated in triplicate. After the reaction was terminated, the product was transferred to a new PCR tube, and fluorescence was immediately observed using a 365 nm UV flashlight. Figure 8 As shown, after 30 min of reaction, combined with gel imaging and fluorescence signal analysis, it can be seen that the fluorescence signal of the Grape Botrytis cinerea-resistant strain was significantly higher than that of the control group at DNA concentrations of 45 ng / μL, 4.5 ng / μL, and 450 pg / μL. Therefore, the detection limit of this invention based on RPA / CRISPR-Cas12a is 450 pg / μL.
[0086] The above descriptions are the preferred embodiments of the present invention and are not intended to limit them. Any modifications, improvements or equivalent substitutions made based on the present invention should be included within the scope of protection of the present invention.
Claims
1. A composition for visually detecting resistance of Grape Botrytis cinerea to methoxyacrylate fungicides based on the RPA-CRISPR / Cas12a system, characterized in that, Includes the following components: used for amplifying substances containing cytb Specific RPA primer pairs for gene mutation sites, targeting cytb Specific crRNA and fluorescent reporter probes for gene mutation sites; The cytb Gene mutation sites refer to cytb A point mutation in the gene, changing GGT to GCT, results in the amino acid at position 143 changing from glycine to alanine. The specific RPA primer pair consists of an upstream primer as shown in SEQ ID No. 1 of the sequence listing and a downstream primer as shown in SEQ ID No. 2 of the sequence listing; against cytb The sequence of the specific crRNA at the gene mutation site is shown in SEQ ID No. 3 in the sequence listing; The structure of the fluorescent reporter probe is: 5ˈ6-FAM-TTTAAAAAATTT-BHQ1-3ˈ; FAM is the fluorescent group of the probe, and BHQ1 is the quenching group of the probe.
2. A visual detection method for the resistance of Grape Botrytis cinerea to methoxyacrylate fungicides, characterized in that, The method of detecting a sample using the visualization detection composition according to claim 1 includes the following steps: S1. Genomic DNA was extracted from the sample using the CTAB method; S2. RPA amplification of genomic DNA of the sample to be tested using the specific RPA primer pair described in claim 1; the ratio of forward primer to reverse primer concentration is 1:5, the concentration of forward primer is 2 μM, and the concentration of reverse primer is 10 μM; the RPA amplification reaction conditions are: 43℃, 20 min. S3. The product amplified by RPA is added to a CRISPR-Cas12a system containing LbCas12a, NEBuffer 2.1, enzyme-free water, dithiothreitol, the fluorescent reporter probe, and the specific crRNA; the concentration of the fluorescent reporter probe in the CRISPR-Cas12a system is 1000 nM; the final concentration of LbCas12a in the CRISPR-Cas12a system is 300 nM; the molar ratio of LbCas12a to crRNA in the CRISPR-Cas12a system is 2:1; the reaction conditions are: 37℃, 30 min. S4. After the reaction is complete, place the product under a 365 nm ultraviolet flashlight to observe the fluorescence phenomenon. Based on the fluorescence, the appearance of green fluorescence indicates that the tested pathogen has developed resistance to methoxyacrylate fungicides, while the absence of green fluorescence indicates that the tested pathogen has not developed resistance to methoxyacrylate fungicides.
Citation Information
Patent Citations
CN105132556A
CN109706258A
CN118755869A
CN120905394A