Method for drawing mouse full-coverage protein interaction network through bacterial single cell transcriptome sequencing

Abstract

The invention discloses a method for drawing a mouse full-coverage protein interaction network through bacterial single cell transcriptome sequencing. The method comprises the following steps: firstly, extracting mRNA (messenger ribonucleic acid) of pan-tissue of a mouse, and then obtaining a cDNA (complementary deoxyribonucleic acid) library by adopting a modified random primer or an oligo-dT primer; carrying out homogenization treatment on the mouse protein library; the method comprises the following steps: transforming plasmids of a BACTH bacteria double-hybrid system to obtain transformed plasmids; carrying out homologous recombination on the transformed plasmids of the sample library and the double hybrid system, and introducing into DHM1 escherichia coli for screening to obtain positive PPI clone with a mutual composition library; and carrying out single-cell transcriptome sequencing on the screened clones based on random primers to construct the mouse protein interaction network. The method is used for carrying out high-throughput screening on mice after thousands of positive PPI combinatorial clones are obtained by'library-to-library 'bacteria or yeast double hybrids, and identifying the same Barcode cDNA combinatorial pairs to realize PPI network identification in different species, among species and in hybridization technology system extensive scenes.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of protein interaction screening, and in particular to a method for constructing a mouse protein interaction network by bacterial single-cell transcriptome sequencing. BACKGROUND

[0002] Proteins are the direct executors of life activities, and their interactions constitute the core network that maintains cellular homeostasis and physiological functions. Protein-protein interaction network (PPI Network) systematically describes the complex relationships formed by proteins in cells, and is a key basis for revealing the molecular mechanisms of life processes. Mapping a high-precision and high-coverage protein interaction network not only helps to understand basic life processes such as cell signaling, metabolic regulation, transcriptional regulation, and developmental differentiation, but also provides important references for disease molecular mechanism research, drug target discovery, and new treatment strategy design. In mammals, mice are one of the most important model organisms, and are highly similar to humans in terms of genome structure, developmental physiology, and disease models. They are the core experimental animals for studying human diseases and verifying the effects of candidate drugs. Therefore, constructing a protein interaction network that covers the entire mouse genome, has high resolution and high accuracy, has irreplaceable scientific and application value for promoting basic biological research, precision medicine, and drug development.

[0003] However, existing protein interaction research techniques still have significant limitations. Traditional methods such as yeast two-hybrid (Y2H), co-immunoprecipitation (Co-IP), and affinity purification-mass spectrometry (AP-MS) are based on pairwise or limited combination interaction screening methods, and belong to the typical "one-to-one" detection mode. Such methods require prior knowledge of the coding sequences of interacting proteins and rely on heterologous expression systems for step-by-step validation. The experimental period is long, the labor is large, the detection throughput is limited, and it is difficult to cover all potential protein interaction relationships. This methodological limitation leads to significant coverage blind spots in previously obtained protein interaction maps, which can only reflect information about part of the key pathways or protein complexes, and cannot achieve systematic and global analysis of the mouse protein interaction network.

[0004] Therefore, there is an urgent need for a new method that can realize the mapping of a mouse full-coverage protein interaction network, fundamentally breaking through the bottleneck of traditional "one-to-one" detection, solving the problem of limited detection throughput and insufficient coverage range of the prior art, and realizing the truly full-coverage mapping of the protein interaction network by analyzing tens of thousands of potential protein interaction events in parallel in one experiment, shortening the experimental period, reducing the detection cost, providing systematic and panoramic protein interaction information, revealing the interaction modes between different tissues, different cell types of mice and microorganisms and hosts, and providing comprehensive and accurate interaction information support for functional genomics, disease mechanism analysis and drug research of mouse models. SUMMARY

[0005] In view of the fact that there is currently no high-throughput "library-to-library" protein interaction screening method, the present application provides a "library-to-library" high-throughput screening system and a use method and maps a mouse full-coverage protein interaction network, mainly including a mouse open reading frame obtaining system, a "library-to-library" PPI screening system and a single-cell transcriptome sequencing identification system based on random primers.

[0006] As shown in Figure 1 , the technical solutions of the present application are as follows: 1) Construction of a mouse protein library The mRNA of the whole tissue of a mouse is extracted, and then a modified primer is used to obtain a mouse protein library as the open reading frame of the mouse target sample; 2) Homogenization treatment of the mouse protein library; 3) Modification of the plasmid of the BACTH bacterial two-hybrid system to obtain a modified plasmid; 4) Homologous recombination of the mouse protein library and the modified T18 and T25 plasmids of the two-hybrid system, and introduction into DHM1 E. coli in M63 culture medium containing Amp and Kan resistance and IPTG inducer to screen bacteria with mouse full-coverage positive PPI clones; 5) After obtaining the bacteria with positive PPI clones, high-throughput PPI pair identification is performed based on single-cell transcriptome sequencing based on random primers, and one pair of open reading frames of one cell is a pair of protein interaction pairs, and a mouse full-coverage protein interaction network is constructed.

[0007] The step 1) of constructing the mouse protein library specifically comprises the following steps: firstly, mRNA of the mouse is extracted, and a full-length open reading frame library of the mouse is obtained by using the Smart-seq 3 mode with a modified 3'RT Oligo-dT primer and a TSO primer; and then the mouse open reading frame library is fused to the N-terminal of a plasmid vector, and when the library is obtained, the mRNA of the eukaryote is captured by the Poly-A tail specificity through the Oligo(dT) magnetic beads, and then the cDNA library is obtained by reverse transcription using the modified 3'RT random primer as the mouse protein library, the sequence of the modified 3'RT random primer is SEQ ID No. 1, namely ACTCTGCGTTGATACCACTGCNNNNNNNN, so as to realize the detection of protein interaction with high sensitivity and low false negative.

[0008] The sequence of the modified 3'RT Oligo-dT primer is SEQ ID No. 4, namely ACTCTGCGTTGATACCACTGCTTTTTTTTTTTTTTTTTTT, and the sequence of the modified TSO primer comprises SEQ ID No. 5-7, namely TCGACTCTAGAGGATCCCrGrGrG, TCGACTCTAGAGGATCCCrG, TCGACTCTAGAGGATCCCrGrG.

[0009] The above sequence is optimized according to the sequence of the plasmid vector, the 3'RT sequence is added to the vector by modification, and also corresponds to the sequence on the hydrogel coding microsphere, and the TSO primer is designed according to the sequence of the homologous arm at the 5' end of the vector cloning site.

[0010] The step 2) specifically uses a double-stranded specific nuclease to uniformly process the mouse protein library, reduces the abundance of high-copy genes, makes the concentration of genes in the library tend to be consistent, and improves the efficiency of drawing the protein interaction network and discovering the interaction network of low-abundance genes.

[0011] The step 3) specifically modifies the plasmid of the BACTH bacterial double-hybrid system, links the linker sequence containing the homologous arm, performs single-cell labeling, and forms the modified plasmid. The linker sequence is SEQ ID No. 2, namely AAGCAGTGGTATCAACGCAGAGT, and the modified 3'RT Oligo-dT primer has a homologous sequence, and the linker linker is connected to the 3' position of the MSC multi-cloning site of the vector in the plasmid, and the connection site sequence is SEQ ID No. 3, namely ACTCTGCGTTGATACCACTGCTT.

[0012] The step 4) specifically comprises the following steps: First, the mouse protein library is respectively homogenously recombined with the pUT18C and pKT25 plasmids modified by the BACTH bacterial two-hybrid system to form the pUT18C and pKT25 protein plasmid library, or the open reading frame library obtained by using random primers is respectively homogenously recombined with the pUT18 and pKNT25 plasmids modified by the BACTH bacterial two-hybrid system to form the pUT18 and pKNT25 protein plasmid library, then the plasmid library is electrotransferred into DHM1 E. coli, and positive PPI combination clone screening is performed in M63 culture medium containing Amp and Kan resistance and IPTG inducer, to obtain the bacteria of the positive PPI clone.

[0013] The screening medium is, for example, M63 culture medium (5x M63 culture medium formula: weigh (NH4)2SO4 10 g, KH4PO4 68 g, FeSO4·7H2O 2.5 mg, and vitamin B1 5 mg, add deionized water to 1 L, adjust pH to 7.0 with KOH, and then autoclave).

[0014] The modified plasmid contains the linker sequence AAGCAGTGGTATCAACGCAGAGT, and the bacteria of the positive PPI clone are blue on the screening medium plate.

[0015] The single-cell transcriptome sequencing based on random primers in step 5) is specifically as follows: Firstly, the positive PPI clones screened are transferred to liquid medium for amplification culture, and are fixed by using 4% PFA solution for 8-16 h to crosslink the protein and nucleic acid, then the bacterial cell membrane is permeabilized by using 0.04% Tween-20 PBS, and the E. coli cell wall is punched by using lysozyme, then the in-situ reverse transcription reaction and tailing dA reaction are carried out by using reverse transcriptase and TdT terminal transferase, then the bacterial or yeast is sequentially subjected to single cell encapsulation and cDNA double-strand amplification by using the water gel code microspheres of oligo(dT), so as to obtain a PCR library (referring to the article (Droplet-based high-throughput single microbe RNA sequencing by smRandom-seq) of nature communication), then the PCR library is subjected to end repair and P5 / P7 adapter ligation by using the VAHTS Universal Pro DNA DNA library preparation kit (for Illumina) to construct an Illumina sequencing library, finally, the obtained Illumina sequencing library is subjected to double-end 150 bp sequencing totaling 300 bp sequencing by using the Illumina X plus 25B sequencer, the sequences obtained by sequencing are compared with the reference genome of the mouse species, so as to identify the interacting protein pairs and construct the interacting protein network.

[0016] The high throughput of the application refers to a high-throughput identification technology system that can identify tens of thousands to hundreds of thousands of positive PPI clones at one time.

[0017] The beneficial effects of the application are: The application establishes a high-throughput "library vs. library" PPI screening method and draws a mouse full-coverage PPI network, and the method is suitable for high-throughput screening of tens of thousands of positive PPI combination clones obtained by "library vs. library" bacterial or yeast double-hybridization, and the same Barcode cDNA combination pairs can be identified by single-cell sequencing, so as to realize PPI network identification of different species (model species vs. non-model species, bacteria vs. host), hybridization technology systems (bacterial double-hybridization, yeast single-hybridization), etc., which breaks through the bottleneck of traditional "one-to-one" and a small number of "one-to-many" screening, and has the advantages of high-throughput, high accuracy, low cost and full-coverage protein interaction identification. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is a schematic diagram of the application scheme; Figure 2 is a pKNT25 plasmid map after modification; Figure 3 is a pKT25 plasmid map after modification; Figure 4 Figure 1 is a map of the modified pUT18 plasmid; Figure 5 Figure 2 is a map of the modified pUT18C plasmid; Figure 6 Figure 3 is a positive clone of mouse PPI interaction screened; Figure 7 Figure 4 is a PCR identification of the positive clone of mouse PPI interaction screened; Figure 8 Figure 5 is a mouse PPI interaction network of 20 pairs. DETAILED DESCRIPTION

[0019] The present application will be further described in conjunction with the accompanying drawings and specific embodiments.

[0020] As shown in Figure 1 , the embodiments of the present application are as follows: 1. Mouse open reading frame library acquisition system Collect mouse heart, liver, spleen, lung, kidney, muscle, bone, skin, brain, stomach, intestinal tissue, grind the tissue into powder using liquid nitrogen, then directly lyse and extract mouse RNA according to the TRIzol instructions, detect the integrity and concentration of the RNA by gel electrophoresis and ultraviolet spectrophotometer, and then directly use the optimized Smart-seq 3 method to obtain the full-length open reading frame, the specific method is as follows: use MMLVRT enzyme (such as Maxima H-minus reverse transcriptase enzyme (Thermo Scientific)) without RNaseH activity to perform RT reaction, the reaction system contains 25 mM Tris-HCI pH 8.0-8.4, 30 mM NaCl, 2.5 mM MgCl2, 1 mM GTP, 8 mM DTT, 0.25 U RNase inhibitor, 0.3 mM dNTPs, 0.1 uM TSO primer and 0.1 uM 3'RT primer (3'RT Oligo-dT or 3'RT random primer), RNA, RNA, dNTP and 3'RT primer are denatured at 72°C for 5 min, then immediately placed on ice to add the remaining reagents, RT reaction is performed at 42°C for 90 min, followed by 10 cycles of 50°C for 2 min and 42°C for 2 min. After the RT reaction, use 2X KAPA HiFi HotStartReadyMix to amplify the cDNA library for 25 cycles, and after amplification, use 0.6x VAHTS DNA Clean Beads (N411) to purify the cDNA library.

[0021] 2. To ensure the cDNA library is free of repetitive sequences and covers more transcript information, cDNA homogenization was performed using Duplex-Specific Nuclease (DSN). This was done using the PuYinTe Bio cDNA homogenization kit (FZ1031). First, 200 ng of the cDNA library was mixed with 4x Hybridization buffer and denatured at 98°C for 2 min, then incubated at 68°C for 5 h. Then, 1 μL of DSN and 1 μL of 10×DSN Reaction buffer were added, gently mixed, briefly centrifuged, and incubated at 68°C for 7-20 min to degrade the double-stranded cDNA. Finally, 10 μL of 2×DSN Stop Buffer was added, gently mixed, briefly centrifuged, and incubated at 65°C for 5 min to terminate the reaction. The remaining homogenized single-stranded cDNA was amplified by PCR for library cloning. After amplification, the cDNA library was purified using 0.6x VAHTS DNA Clean Beads (N411).

[0022] 3. Full-coverage PPI screening in mice The purified mouse cDNA library was then combined with the modified T18 / T25 vector ( Figures 2-5 Homologous recombination was performed using the Basic Seamless Cloning and Assembly kit, and the cells were electroporated into DH5α competent cells. Positive clones were verified by PCR and Sanger sequencing. Bacteria were then collected for plasmid extraction from T18-mouse and T25-mouse cDNA libraries. The T18-mouse cDNA library was first electroporated into DH101 E. coli competent cells. DH101 E. coli containing the T18-mouse cDNA library were then used to prepare new competent cells using a supercompetent bacterial preparation kit (Beyotime, D0302). The T25-mouse cDNA library was again electroporated into DH101 competent cells containing the T18-mouse cDNA library. These cells were then plated on M63 medium containing Amp and Kan resistance and IPTG inducer for screening of positive PPI combination clones. Figure 6 ), select single clones and perform PCR again ( Figure 7 After verifying positive clones using Sanger sequencing, mouse PPI clones with full coverage were collected for high-throughput identification.

[0023] 4. Constructing a full-coverage protein-protein interaction map of mice using single-bacterial transcriptome sequencing based on random primers. The collected bacteria are fixed with 4% paraformaldehyde overnight to cross-link the RNA, DNA and proteins inside the bacteria. The cell wall is digested using lysozyme, and the fixed bacteria are permeabilized so as to perform the next step of in situ reverse transcription reaction. The microorganism is used as a reaction container for in situ reaction, random primers are added to bind with the RNA inside the bacteria, total RNA is captured to synthesize cDNA by reverse transcription, and a Poly-A tail is added in situ to the 3' end of the cDNA by terminal transferase (TdT). After each step of the foregoing process is completed, the buffer is washed for about 3-8 times to prevent the influence of residual reagents on the subsequent reaction. The single bacteria and labeled microbeads are packaged into droplets by using a microfluidic device. The Poly-T primer is released from the microbeads by enzyme digestion, the RNA in the bacteria is digested to release the cDNA from the bacteria, the Poly-T primer is combined with the Poly-A tail at the end of the cDNA, and then the specific code is added to the cDNA by extension, and a molecular tag (UMI) is added to each cDNA. After demulsification, the purified cDNA is collected, expanded and added with a sequencing adapter to construct a sequencing library, the cDNA product of rRNA is digested by cas9, the mRNA cDNA product is enriched for high-throughput sequencing, the sequencing data is obtained, and after quality control and filtering, it is aligned to the Ecoli_bw25113 genome, the Unmapping reads are aligned to the human and mouse reference genes, respectively, the number of mouse transcripts and human transcripts detected in the same Barcode and their UMIs is counted by using Feature Counts software, and the UMI threshold is designed to exclude data false positives. When the UMI of the mouse transcript and the human transcript detected by a Barcode is higher, the false positive generated by sequencing is smaller, and the reliability of the interaction pair is higher. Finally, the screened interaction pairs are used to construct a mouse full-coverage protein interaction network, and 6932 pairs of interaction proteins are identified by one screening, wherein 1293 proteins exist in multiple protein interaction phenomena. Figure 8 .

[0024] The above detailed description is used to explain and illustrate the present application, rather than limit the present application, and any modification and change made to the present application within the spirit and protection scope of the claims of the present application, fall within the protection scope of the present application.

[0025] The above description is only the preferred embodiment of the present application, and any equivalent changes or modifications made to the structure, features and principles described in the scope of the present application patent application are included in the scope of the present application patent application The gene sequence involved in the present application is as follows: SEQ ID No. 1: Name: Modified 3' RT random primer DNA sequence DNA type: other DNA ORGANISM: Artificial Sequence / synthetic construct ctggatccaatggcatcttcaacacccgc SEQ ID No. 2: NAME: DNA sequence of linker DNA TYPE: other DNA ORGANISM: Artificial Sequence / synthetic construct AAGCAGTGGTATCAACGCAGAGT SEQ ID No. 3: NAME: Sequence of the junction site of linker in plasmid DNA TYPE: other DNA ORGANISM: Artificial Sequence / synthetic construct ACTCTGCGTTGATACCACTGCTT SEQ ID No. 4: NAME: DNA sequence of the modified 3' RT Oligo-dT primer DNA TYPE: other DNA ORGANISM: Artificial Sequence / synthetic construct ACTCTGCGTTGATACCACTGCTTTTTTTTTTTTTTTTTTT SEQ ID No. 5: NAME: DNA sequence of the modified TSO primer 1 DNA TYPE: other DNA ORGANISM: Artificial Sequence / synthetic construct TCGACTCTAGAGGATCCCrGrGrG SEQ ID No. 6: NAME: DNA sequence of the modified TSO primer 2 DNA TYPE: other DNA ORGANISM: Artificial Sequence / synthetic construct TCGACTCTAGAGGATCCC SEQ ID No. 7: NAME: DNA sequence 3 of engineered TSO primer DNA TYPE: other DNA ORGANISM: Artificial Sequence / synthetic construct TCGACTCTAGAGGATCCCGrG.

Claims

1. A method for mapping a mouse full-coverage protein-protein interaction network by bacterial single-cell transcriptome sequencing, characterized by comprising the following steps: 1) constructing a mouse protein library; extracting mRNA from a mouse whole tissue, and then obtaining a mouse protein library by using a modified primer; 2) homogenizing the mouse protein library; 3) modifying a plasmid of a BACTH bacterial two-hybrid system to obtain a modified plasmid; 4) performing homologous recombination between the mouse protein library and the modified plasmid of the two-hybrid system, and introducing the recombined product into DHM1 Escherichia coli, and then screening a mouse full-coverage positive PPI clone of bacteria in a M63 culture medium containing Amp and Kan resistance and IPTG inducer; and 5) after obtaining the positive PPI clone of bacteria, performing high-throughput PPI pair identification by using single-cell transcriptome sequencing based on a random primer, one pair of open reading frames of a cell being one protein-protein interaction pair, and then constructing a mouse full-coverage protein-protein interaction network. The step 1) of constructing the mouse protein library specifically comprises the following steps: firstly, extracting mRNA of a mouse, and then obtaining a mouse open reading frame library by using a modified 3'RT Oligo-dT primer and a TSO primer in a manner of Smart-seq 3; and then fusing the mouse open reading frame library to an N terminus of a plasmid vector, capturing mRNA of a eukaryote by using Oligo(dT) magnetic beads through a Poly-A tail specificity, and then obtaining a cDNA library as the mouse protein library by using a modified 3'RT random primer for reverse transcription, wherein the modified 3'RT Oligo-dT primer has a sequence of SEQ ID No. 4, the modified TSO primer has sequences of SEQ ID Nos. 5-7, and the modified 3'RT random primer has a sequence of SEQ ID No.

1. The step 2) specifically comprises homogenizing the mouse protein library by using a double-strand specific nuclease. The step 3) specifically comprises modifying the plasmid of the BACTH bacterial two-hybrid system, and linking a linker containing a homologous arm to form a modified plasmid. The linker has a sequence of SEQ ID No. 2, i.e. AAGCAGTGGTATCAACGCAGAGT, and a connection site of the linker in the plasmid is a 3' position of a MSC multi-cloning site of the vector, and the connection site has a sequence of SEQ ID No. 3, i.e. ACTCTGCGTTGATACCACTGCTT. The step 4) specifically comprises: ​ 2. The method of claim 1, wherein the method is for mapping a mouse full-coverage protein interaction network. ​ 3. The method of claim 1, wherein the method is for mapping a mouse full-coverage protein interaction network. ​ 4. The method of claim 1, wherein the method is for mapping a mouse proteome interactome network with full coverage. ​ 5. The method of claim 4, wherein the method is for mapping a mouse interactome with full coverage of proteins by bacterial single-cell transcriptome sequencing. ​ 6. The method of claim 1, wherein the method is a method of bacterial single-cell transcriptome sequencing to map a mouse full-coverage protein interaction network. ​ Firstly, the mouse protein library is respectively homogenously recombined with the pUT18C and pKT25 plasmids modified by the BACTH bacterial double-hybrid system to form the pUT18C and pKT25 protein plasmid libraries, or the open reading frame library obtained by using random primers is respectively homogenously recombined with the pUT18 and pKNT25 plasmids modified by the BACTH bacterial double-hybrid system to form the pUT18 and pKNT25 protein plasmid libraries, then the plasmid libraries are electroporated into DHM1 E. coli, and positive PPI combination clone screening is performed in M63 culture medium containing Amp and Kan resistance and IPTG inducer, to obtain the bacteria of positive PPI clones.

7. The method of claim 1, wherein the method is a method of bacterial single-cell transcriptome sequencing to map a mouse full-coverage protein interaction network. The modified plasmid contains the linker sequence AAGCAGTGGTATCAACGCAGAGT, and the bacteria of positive PPI clones are blue on the screening medium plate.

8. The method of claim 1, wherein the method is a method of bacterial single-cell transcriptome sequencing to map a mouse full-coverage protein interaction network. The single-cell transcriptome sequencing based on random primers in the step 5) is specifically as follows: Firstly, the bacteria of positive PPI clones after screening are transferred into liquid culture medium for amplification culture, and are fixed and treated by using 4% PFA solution for 8-16 h to crosslink the protein and nucleic acid, then the bacterial cell membrane is permeabilized by using PBS containing 0.04% Tween-20, and the E. coli cell wall is punched by using lysozyme, then the in-situ reverse transcription reaction and tailing dA reaction are performed by using reverse transcriptase and TdT terminal transferase, then the water gel coding microspheres of oligo(dT) are added to sequentially perform single-cell encapsulation and cDNA double-strand amplification on the bacteria or yeast, to obtain a PCR library, then the Illumina sequencing library is constructed by using the VAHTS Universal ProDNA DNA Library Preparation Kit to perform end repair and connect P5 / P7 adapters on the PCR library, and finally the obtained Illumina sequencing library is sequenced, the sequences obtained by sequencing are compared with the reference genome of the mouse species to identify the interacting protein pairs, and the interacting protein network is constructed.

Images