Molecular marker closely linked with wheat powdery mildew resistance gene PmCWI16926 and application of molecular marker

By developing the dominant INDEL marker YTU2BS-P12 for the wheat powdery mildew resistance gene PmCWI16926, precise gene mapping and molecular marker-assisted selection of PmCWI16926 were achieved, solving the problem of low wheat breeding efficiency and improving the efficiency and accuracy of powdery mildew resistance breeding.

CN121428142AActive Publication Date: 2026-01-30YANTAI UNIV

Patent Information

Application Number
CN202510969274.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-15
Publication Date
2026-01-30
Estimated Expiration
2045-07-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently utilize powdery mildew resistance genes in wheat's close relatives and ancestors, resulting in low wheat breeding efficiency. Furthermore, with the evolution of pathogen races, many resistance genes have lost their resistance, making it difficult to effectively control powdery mildew.

Method used

A dominant INDEL marker, YTU2BS-P12, closely linked to the wheat powdery mildew resistance gene PmCWI16926 was developed. Through PCR amplification and electrophoresis detection, precise gene localization and marker-assisted selection of PmCWI16926 were achieved.

Benefits of technology

It significantly shortens the breeding cycle, improves breeding efficiency, accurately detects PmCWI16926, and is efficiently applied to wheat powdery mildew resistance breeding, saving costs and improving the efficiency of disease-resistant variety selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
Patent Text Reader

Abstract

The invention discloses a molecular marker closely linked with a wheat powdery mildew resistance gene PmCWI16926. The molecular marker is YTU2BS-P12, and the molecular marker is a molecular marker PmCWI16926. The nucleotide sequence of an upstream primer of the molecular marker is as shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; the molecular marker is used for carrying out PCR (Polymerase Chain Reaction) amplification on to-be-detected wheat genome DNA (Deoxyribose Nucleic Acid) to obtain a corresponding amplification product with the molecular weight According to the molecular marker YTU2BS-P12 closely linked with the wheat powdery mildew resistance gene PmCWI16926, provided by the invention, a genetic mapping group of the PmCWI16926 can be more efficiently detected, and map-based cloning of the PmCWI16926 is facilitated; when the marker is used for molecular marker-assisted selection of PmCWI16926, the breeding period can be shortened, the breeding efficiency can be improved, and the marker can be better applied to wheat breeding for disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological genetic engineering technology, in particular to a molecular marker closely linked to wheat powdery mildew resistance gene PmCW16926 and application thereof. BACKGROUND

[0002] Wheat powdery mildew caused by Blumeria graminis f. sp. tritici (Bgt) seriously threatens the yield and quality of wheat, and this epidemic disease occurs in all wheat-growing regions worldwide (Li, H., Zhou, Y., Xin, W., Wei, Y., Zhang, J., Guo, L. Wheat breeding in northern China: Achievements and technical advances. Crop J. 2019, 7, 718-729.). In China, the area of wheat affected by powdery mildew is about 100 million mu per year in recent years, and the disease has gradually spread to the main wheat-growing regions such as the middle and lower reaches of the Yangtze River, the Huang-Huai-Hai wheat region, etc. Powdery mildew can significantly reduce the yield of affected wheat fields, with a general reduction of 5 - 10%, and in severe cases, the yield reduction can reach 30 - 50%, making it one of the three major fungal diseases of wheat (Qian, Z., Han, G., Yu, N., Liu, C., Han, R., Jameson, P., Wang, J., Zhao, Y., Xiao, B., Liu, R., Zhang, J., Jin, Y., Li, H., Ma, P. Fine mapping of the powdery mildew resistance gene PmXQ-0508 in bread wheat. Crop J. 2024, 12, 1176-1184.). Identifying and cloning different powdery mildew resistance genes carried by wheat, and then breeding excellent disease-resistant varieties, is the most economical and environmentally friendly way to control wheat powdery mildew. So far, more than 100 wheat powdery mildew resistance genes and their alleles have been reported in different wheat types (Zhang, J., Yang, H., Han, G., Xu, H., Liu, R., Yu, N., Han, R., Li, Y., Li, J., Dai, Y., Liu, C., Jin, Y., Ma, P. Fine mapping of Pm71, a novel powdery mildew resistance gene from emmer wheat. Crop J. 2025, 13, 62-68.). However, with the continuous evolution of pathogenic races, many resistance genes have lost their resistance in production. Therefore, in order to reduce the occurrence of powdery mildew and improve the yield and quality of wheat, it is necessary to continuously explore and deploy new resistance resources for breeding programs.Wheat relatives, such as rye (Secale cereale L, 2n = 2x = 14, RR), ice grass (Agropyron cristatum, 2n = 2x = 14, PP), Dasypyrum villosum (2n = 2x = 14, VV), etc., and the ancestors of common wheat, Aegilops tauschii (2n = 2x = 14, DD), Triticum urartu (2n = 2x = 14, AA), T. monococcum L (2n = 2x = 14, AA), wild emmer (T. dicoccum, 2n = 4x = 28, AABB) and T. timopheevii (2n = 4x = 28, AAGG), etc. are all valuable resources of disease resistance genes. It is worth mentioning that more than half of the documented powdery mildew resistance genes are derived from these species resources (Han, G., Wang, J., Yan, H., Cao, L., Liu, S., Li, X., Zhou, Y., Liu, W., Gu, T., Shi, Z., Liu, H., Li, L., An, D. Development and molecular cytogenetic identification of a new wheat-rye 6RL ditelosomic addition and 1R (1B) substitution line with powdery mildew resistance, J. Integr. Agric. 2025, 24, 72-84.).

[0003] Cultivated emmer wheat (Triticum dicoccon Schrank), an old crop with promising future: a review. Genet. Resour. Crop Evol. 2010, 57, 937-962.). This species harbors a wealth of excellent traits, especially resistance to biotic and abiotic stresses, and is an important genetic resource for genetic improvement of common wheat (Feng, K., Cui, L., Lv, S., Bian, J., Wang, M., Song, W., Nie, X. Comprehensive evaluating of wild and cultivated emmer wheat (Triticum turgidum L.) genotypes response to salt stress, Plant Growth Regul. 2018, 84, 261-273.).For example, Pm4a, Pm49, Pm50 and Pm71, etc. important genes are derived from cultivated emmer wheat (Zhu, K., Li, M., Wu, H., Zhang, D., Dong, L., Wu, Q., Chen, Y., Xie, J., Lu, P., Guo, G., Zhang, H., Zhang, P., Li, B., Li, W., Dong, L., Wang, Q., Zhu, J., Hu, W., Guo, L., Wang, R., Yuan, C., Li, H., Liu, Z., Hua, W. Fine mapping of powdery mildew resistance gene MlWE74 derived from wild emmer wheat (Triticum turgidum ssp. dicoccoides) in an NBS-LRR gene cluster. Theor. Appl. Genet. 2022, 135, 1235-1245.).

[0004] After discovering excellent resistance genes, how to efficiently apply them to wheat disease resistance breeding becomes the key. In recent years, wheat breeding technology continues to innovate, and molecular marker-assisted selection breeding has gradually become the core method of wheat powdery mildew resistance breeding. Having efficient, precise and easy-to-use molecular markers is the basis for carrying out molecular marker-assisted selection of target genes. Tracking and detecting target genes through molecular markers can significantly compress the breeding cycle and greatly improve breeding efficiency.

[0005] Cultivated emmer wheat CWI16926-4Y has excellent agronomic performance, and in many years of multi-point field identification, it also shows good resistance to powdery mildew, which is an extremely excellent wheat powdery mildew resistance germplasm resource. Through genetic analysis of seedling powdery mildew resistance and molecular marker detection, it is found that at the seedling stage, the resistance of CWI16926-4Y to the prevalent strain E09 of powdery mildew is controlled by a pair of dominant genes PmCWI16926 located on the 2BS chromosome of wheat, which belongs to a newly discovered wheat powdery mildew resistance gene / allele. Therefore, developing a molecular marker closely linked to the gene PmCWI16926 and applying it to the molecular marker-assisted selection breeding of wheat powdery mildew resistance gene PmCWI16926 has key significance for breeding wheat varieties resistant to powdery mildew and effectively preventing and controlling powdery mildew. SUMMARY

[0006] The application aims to provide a molecular marker closely linked to the wheat powdery mildew resistance gene PmCW116926 and an application thereof, so as to utilize the molecular marker to perform gene positioning and detection on the wheat powdery mildew resistance gene PmCW116926. Molecular marker assisted selection of PmCW116926 is performed by utilizing the marker, so that the breeding cycle can be shortened, the breeding efficiency is improved, and the marker is better applied to wheat disease resistance breeding work.

[0007] The application is realized by the following method: a molecular marker closely linked to the wheat powdery mildew resistance gene PmCW116926, wherein the molecular marker is a dominant INDEL marker YTU2BS-P12. The upstream primer of the molecular marker YTU2BS-P12 is YTU2BS-P12-F, and the nucleotide sequence is as follows: 5'-AGGTAATGTTGAGTGCCGC-3', as shown in SEQ ID NO: 1. The downstream primer of the molecular marker YTU2BS-P12 is YTU2BS-P12-R, and the nucleotide sequence is as follows: 5'-ATCAACTTGTCTTCTCAGTTGTACC-3', as shown in SEQ ID NO: 2. The marker primer of the molecular marker YTU2BS-P12 is used to perform PCR amplification on the wheat genomic DNA to be detected, so that the corresponding amplification product with a molecular weight of 105 bp is obtained, that is, the molecular marker closely linked to the wheat powdery mildew resistance gene PmCW116926.

[0008] The PCR amplification system suitable for the molecular marker is 10 μL, and the PCR amplification system comprises the following components: 50 ng / μL wheat genomic DNA 1.2 μL, 4 μL PCR Master Mix, 10 μM upstream primer 0.25 μL, 10 μM downstream primer 0.25 μL, and sterile deionized water 4.3 μL.

[0009] The PCR amplification program suitable for the molecular marker is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min; and 4℃ preservation.

[0010] The electrophoretic separation program suitable for the amplification product of the molecular marker is as follows: 8% non-denaturing polyacrylamide gel is used for electrophoresis, the amplification product is mixed with 2.5 μL 10xLoading Buffer, 1.3 μL of the mixture is taken for sample loading, electrophoresis is performed at a constant voltage of 220 V for 1.5 h, silver nitrate staining is performed, and then photographing is performed.

[0011] The application provides the application of the molecular marker in close linkage with the wheat powdery mildew resistance gene PmCW116926 in gene location, map-based cloning and marker-assisted selection breeding of the wheat powdery mildew resistance gene PmCW116926.

[0012] The application of the application for detecting whether the wheat powdery mildew resistance gene PmCW116926 is carried in a to-be-tested variety mainly comprises the following steps: (1) extracting fresh leaf genome DNA of a to-be-tested wheat sample; (2) using a primer pair of the molecular marker YTU2BS-P12 to perform PCR amplification on the extracted wheat genome DNA to obtain an amplification product; (3) if a specific band of 105 bp can be amplified, it is indicated that the wheat powdery mildew resistance gene PmCW116926 exists in the to-be-tested wheat; otherwise, the wheat powdery mildew resistance gene PmCW116926 does not exist in the to-be-tested wheat.

[0013] The primer of the molecular marker YTU2BS-P12 comprises an upstream primer YTU2BS-P12-F and a downstream primer YTU2BS-P12-R, the nucleotide sequence of the upstream primer YTU2BS-P12-F is shown in SEQ ID NO:1, namely YTU2BS-P12-F: 5'-AGGTAATGTTGAGTGCCGC-3'; and the nucleotide sequence of the downstream primer YTU2BS-P12-R is shown in SEQ ID NO:2, namely YTU2BS-P12-R: 5'-ATCAACTTGTCTTCTCAGTTGTACC-3'.

[0014] The application of the molecular marker, the PCR amplification system suitable for the marker comprises 10 μL, and the PCR amplification system comprises 1.2 μL of 50 ng / μL wheat genome DNA, 4 μL of PCR Master Mix, 0.25 μL of 10 μM upstream primer, 0.25 μL of 10 μM downstream primer and 4.3 μL of sterile deionized water.

[0015] The PCR amplification program suitable for the marker comprises the following steps: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles, 72℃ extension for 10 min and 4℃ preservation.

[0016] Detection of PCR amplification product: electrophoresis was carried out using 8% non-denaturing polyacrylamide gel, 1.3 μL of the mixture of the amplification product and 2.5 μL 10xLoading Buffer was spotted after mixing, electrophoresis was carried out at 220 V constant voltage for 1.5 h, silver nitrate staining was carried out and then photographing was carried out. According to the electrophoresis result, if a specific band of 105 bp can be amplified, it indicates that the wheat germplasm to be tested contains the wheat powdery mildew resistance gene PmCWI16926, otherwise, the wheat germplasm to be tested does not contain the wheat powdery mildew resistance gene PmCWI16926.

[0017] The present application shows that the resistance of the cultivated emmer wheat CWI16926-4Y to the epidemic strain E09 of powdery mildew at the seedling stage is controlled by a single dominant gene through genetic analysis of seedling stage powdery mildew resistance and molecular marker detection, which is named as PmCWI16926. The polymorphism of 198 pairs of molecular markers uniformly distributed in the whole genome is detected in the resistant pool and the susceptible pool which are composed of the cultivated emmer wheat CWI16926-4Y, the susceptible wheat Langdon (LDN) and 10 pure resistant families and 10 pure susceptible families in the F2 population of CWI16926-4Y x Langdon (LDN), 12 pairs of markers exhibit consistent polymorphism in the resistant and susceptible parents and the resistant and susceptible pools. Then, genotyping is carried out on the 498 F2 population of CWI16926-4Y x Langdon (LDN) by using these markers, PmCWI16926 is located in the 920 kb physical interval (21.70 - 22.62 Mb) of 2BS chromosome by referring to the Durum wheat (Durum wheat cv. Svevo) genome. Further, according to the sequence in the interval of the reference genome, the primer 5.0 software is used to design and screen the Insertion-Deletion (INDEL) marker YTU2BS-P12 which is closely linked to the gene PmCWI16926. The molecular marker YTU2BS-P12 of the wheat powdery mildew resistance gene PmCWI16926 provided in the present application is detected by a genetic segregation population, the genetic distance of the gene PmCWI16926 is only 0.2 cM, which is closely linked to PmCWI16926, can more accurately and efficiently detect the genetic mapping population of PmCWI16926, and is beneficial to the map-based cloning and fine mapping of PmCWI16926.

[0018] The present application provides a molecular marker which is closely linked to the wheat powdery mildew resistance gene PmCWI16926, which is applied in the breeding of wheat resistant to powdery mildew, can greatly save cost, reduce breeding period, is more accurate and efficient, and can be better applied in the breeding of wheat resistant to powdery mildew. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 : Results of primer of molecular marker YTU2BS-P12 detecting resistant cultivated common wheat CWI16926-4Y and susceptible durum wheat Langdon (LDN) and their F2 population.

[0020] M: pUC19; 1: CWI16926-4Y (resistant parent); 2: Langdon (LDN) (susceptible parent); 3-17: F2 population of CWI16926-4Y x Langdon (LDN), wherein 3-7: homozygous resistant family, 8-12: resistant-susceptible segregating family, 13-17: homozygous susceptible family; white arrow is specific band of PmCWI16926. DETAILED DESCRIPTION

[0021] The following examples are intended to better illustrate and enable the present application and are not intended to limit it in any way. Except in the Examples, or where otherwise expressly indicated, all experimental methods were carried out in accordance with conventional methods. Experimental materials, reagents and the like used in the Examples were obtained from commercial suppliers unless otherwise indicated.

[0022] Example 1 Development of molecular marker YTU2BS-P12 of wheat powdery mildew resistance gene PmCWI16926 MATERIALS The resistant parent was cultivated common wheat CWI16926-4Y, and the susceptible parent was durum wheat Langdon (LDN). The F2 population was obtained by selfing the F1 of CWI16926-4Y x Langdon (LDN).

[0023] 2. Extraction of wheat genomic DNA The wheat genomic DNA was extracted by CTAB method, and the process was as follows: (1) Fresh young leaves of the wheat to be tested were taken, frozen in liquid nitrogen, and quickly ground into powder, and then loaded into a 2 mL EP tube; (2) 600-800 μL of CTAB extraction solution was added, and the mixture was incubated at 65°C for 1 h, and the mixture was inverted and mixed every ten minutes during the incubation; (3) An equal volume of chloroform:isopropyl alcohol (24:1) was added, and the mixture was mixed on a shaker for 30 min; (4) The mixture was centrifuged at 8000 rpm / min at room temperature for 10 min, and 400 μL of supernatant was transferred to a 1.5 mL EP tube, 3 volumes of pre-cooled 95% ethanol was added, mixed, and precipitated at -20°C for 0.5 h; (5) The mixture was centrifuged at 12000 rpm / min at room temperature for 10 min, and the supernatant was discarded, and 800 μL of 75% ethanol was added for washing 3 times; (6) Air-dry and precipitate, add 50 μL of ddH2O to dissolve.

[0024] (7) Dilute the DNA stock solution to 50 ng / μL with sterile deionized water as working solution.

[0025] 3. Wheat seedling resistance identification and genetic analysis of powdery mildew Wheat seedling resistance identification was completed in the greenhouse. The resistant parent CWI16926-4Y, susceptible parent Langdon (LDN), F1 hybrid, and F2 population were planted in 128-hole plug trays (3.2 x 3.2 x 4.2 cm). The parents and F1 were identified with at least 20 seeds each, and each F2 population was identified with at least 25 seeds. The susceptible control TN18 was randomly sown and labeled. The greenhouse conditions were controlled at 18-20°C, relative humidity 80%, and photoperiod 14 h light / 10 h darkness. At the one-leaf stage, the powdery mildew strain E09 was inoculated using the sweeping method. After 10-14 days, when the susceptible control TN18 was fully diseased, the phenotype was investigated. The infection type (IT) was recorded according to the 0-4 grade standard. The resistance grade was divided: 0-2 grade was resistant type, and 3-4 grade was susceptible type (Si Qiu Min, Zhang Xin Xin, Duan Xia Yu, Sheng Bao Qin. Identification of physiological races of wheat powdery mildew. Chinese Journal of Agricultural Sciences. 1987, 20: 64-70).

[0026] The investigation results showed that CWI16926-4Y showed high resistance to powdery mildew strain E09 (IT=0), Langdon (LDN) showed high susceptibility (IT=4), and F1 plants showed resistance (IT 0-1), indicating that CWI16926-4Y carried a dominant disease resistance gene. Resistance identification of the F2 population of this combination showed that the resistant to susceptible segregation ratio was 154:53, and the chi-square test was consistent with the segregation ratio of a single dominant gene 3:1 (χ 2 =0.02, P=0.84). In summary, the resistance of CWI16926-4Y to powdery mildew strain E09 is controlled by a single dominant gene, which is named PmCWI16926.

[0027] 4. Fine mapping of PmCWI16926 According to the phenotypic identification results, 10 homozygous resistant families and 10 homozygous susceptible families were selected to construct the resistant pool and the susceptible pool. 198 pairs of molecular markers evenly distributed in the whole genome were used to detect polymorphism of the cultivated two-grain wheat CWI16926-4Y, hard-grain wheat Langdon (LDN) and the resistant pool and the susceptible pool. 12 pairs of markers showed consistent polymorphism in the resistant and susceptible parents and the resistant and susceptible pools. Subsequently, these markers were used to genotype the 498 F2 population of CWI16926-4Y x Langdon (LDN), and PmCWI16926 was located in the interval of 21.70 - 22.62 Mb on wheat chromosome 2BS.

[0028] 5. Development of molecular markers closely linked to PmCWI16926 According to the sequence information of the hard-grain wheat reference genome (Durum wheat cv. Svevo) in the candidate interval 21.70 - 22.62 Mb, primer5.0 software was used to design Insertion-Deletion (INDEL) markers to genotype the F2 population of CWI16926-4Y x Langdon (LDN), and INDEL marker YTU2BS-P12 closely linked to gene PmCWI16926 was obtained, with a genetic distance of only 0.2 cM.

[0029] The primers of molecular marker YTU2BS-P12 include an upstream primer and a downstream primer: The nucleotide sequence of the upstream primer YTU2BS-P12-F is: 5'- AGGTAATGTTGAGTGCCGC -3'; The nucleotide sequence of the downstream primer YTU2BS-P12-R is: 5'- ATCAACTTGTCTTCTCAGTTGTACC -3'.

[0030] The suitable PCR amplification system for this marker is 10 μL, including: 50 ng / μL wheat genomic DNA 1.2 μL, 4 μL PCR Master Mix, 10 μM upstream primer 0.25 μL, 10 μM downstream primer 0.25 μL, and 4.3 μL of sterile deionized water.

[0031] The suitable PCR amplification program for this marker is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min; 4℃ storage.

[0032] The electrophoresis separation procedure of the amplification product is as follows: the amplification product and 2.5 μL 10xLoading Buffer are mixed, 1.3 μL of the mixture is spotted, electrophoresis is carried out at 220 V constant voltage for 1.5 h, silver nitrate staining is carried out, and then photographing is carried out. If a specific band of 105 bp can be amplified, it indicates that the wheat germplasm to be tested contains the wheat powdery mildew resistance gene PmCWI16926, otherwise, the wheat powdery mildew resistance gene PmCWI16926 does not exist in the wheat germplasm to be tested.

[0033] The detection results of the molecular marker are shown in Figure 1 . Among them Figure 1 are the detection results of the molecular marker YTU2BS-P12 on the resistant cultivated two-grain wheat CWI16926-4Y, the susceptible hard-grain wheat Langdon (LDN) and the segregation population of the hybrid offspring of the two. In the figure, M: pUC19; 1: CWI16926-4Y (resistant parent); 2: Langdon (LDN) (susceptible parent); 3-17: F2 population of CWI16926-4Y x Langdon (LDN), wherein 3-7: homozygous resistant family, 8-12: resistant-susceptible segregation family, 13-17: homozygous susceptible family; the white arrow is the specific band of PmCWI16926. The amplification results show that the marker YTU2BS-P12 amplifies a specific band of 105 bp in the resistant parent CWI16926-4Y and the resistant family, and does not amplify the specific band in the susceptible parent Langdon (LDN) and the susceptible family.

[0034] The wheat powdery mildew resistance gene PmCWI16926 is derived from the cultivated two-grain wheat CWI16926-4Y, and is an excellent new gene. At present, there is no related report on the positioning, map-based cloning and molecular breeding of the gene. With the aid of the molecular marker YTU2BS-P12 provided in the present application, the detection of the genetic mapping large population is carried out, which is beneficial to the fine positioning and map-based cloning of the gene PmCWI16926. By introducing PmCWI16926 into the susceptible wheat cultivars, the molecular marker YTU2BS-P12 developed in the present application can efficiently and accurately detect the breeding large population, greatly improving the efficiency and accuracy of transferring the disease resistance gene PmCWI16926, which has extremely important significance for efficient transformation of the gene PmCWI16926 and in-depth analysis of the disease resistance mechanism.

[0035] The above examples are the optimized embodiments of the present application, which are used to illustrate the present application but not to limit the present application. The modifications or equivalent replacements made by the person skilled in the art without departing from the purpose and principles of the embodiments of the present application shall fall into the scope of the present application.

Claims

1. A molecular marker closely linked to wheat powdery mildew resistance gene PmCW116926, wherein an upstream primer nucleotide sequence of the molecular marker YTU2BS-P12 is shown as SEQ ID NO: 1, and a downstream primer nucleotide sequence is shown as SEQ ID NO: 2; PCR amplification is performed on a test wheat genomic DNA using a primer pair of the molecular marker YTU2BS-P12 to obtain a corresponding amplification product with a molecular weight of 105 bp, which is the molecular marker closely linked to the wheat powdery mildew resistance gene PmCW116926.

2. The molecular marker which is tightly linked to the wheat powdery mildew resistance gene PmCW116926 according to claim 1, the suitable PCR amplification system for the marker is 10 μL, which includes: 50 ng / μL wheat genomic DNA 1.2 μL, 4 μL PCR Master Mix, 10 μM upstream primer 0.25 μL, 10 μM downstream primer 0.25 μL, and 4.3 μL sterile deionized water. 3.The molecular marker closely linked to the wheat powdery mildew resistance gene PmCW116926 according to claim 1 or 2, wherein a PCR amplification procedure suitable for the marker is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 40 s, 35 cycles; extension at 72℃ for 10 min; and preservation at 4℃. 4.Use of the molecular marker closely linked to the wheat powdery mildew resistance gene PmCW116926 according to any one of claims 1-3 in gene location, map-based cloning, and marker-assisted breeding of the wheat powdery mildew resistance gene PmCW116926. 5.The use according to claim 4, wherein detection of whether a test variety carries the wheat powdery mildew resistance gene PmCW116926 mainly comprises the following steps: (1) extracting genomic DNA from a test wheat sample; (2) performing PCR amplification on the extracted wheat genomic DNA using a primer pair of the molecular marker YTU2BS-P12 to obtain an amplification product; (3) performing electrophoresis on the amplification product, and judging according to the electrophoresis result; if the wheat DNA can amplify a specific band of 105 bp, it indicates that the test wheat contains the powdery mildew resistance gene PmCW116926; otherwise, the test wheat does not contain the wheat powdery mildew resistance gene PmCW116926. 6.The use according to claim 5, wherein the primer pair of the molecular marker YTU2BS-P12 in step (2) comprises an upstream primer YTU2BS-P12-F and a downstream primer YTU2BS-P12-R, wherein a nucleotide sequence of the upstream primer YTU2BS-P12-F is shown as SEQ ID NO: 1, and a nucleotide sequence of the downstream primer YTU2BS-P12-R is shown as SEQ ID NO:

2.

7. Use according to claim 5, wherein the PCR amplification system to which the label is applied is 10 μL, comprising: 50 ng / μL wheat genomic DNA 1.2 μL, 4 μL PCR Master Mix, 10 μM upstream primer 0.25 μL, 10 μM downstream primer 0.25 μL, and 4.3 μL sterile deionized water.

8. The use according to claim 5, wherein the suitable PCR amplification procedure is: 95℃ pre-denaturation 5 min; 95℃ denaturation 30 s, 55℃ annealing 30 s, 72℃ extension 40 s, 35 cycles; 72℃ extension 10 min; 4℃ preservation.

9. The use according to claim 5, wherein the PCR amplification system to which the label is applied is 10 μL, comprising: 50 ng / μL wheat genomic DNA 1.2 μL, 4 μL PCR Master Mix, 10 μM upstream primer 0.25 μL, 10 μM downstream primer 0.25 μL, sterile deionized water 4.3 μL.

10. The use according to claim 5, wherein the suitable PCR amplification procedure is: 95℃ pre-denaturation 5 min; 95℃ denaturation 30 s, 55℃ annealing 30 s, 72℃ extension 40 s, 35 cycles; 72℃ extension 10 min; 4℃ preservation.

Citation Information

Patent Citations

  • Molecular marker closely linked with wheat powdery mildew resistance gene Pm68, and application of molecular marker

    CN112011637A

  • Primer for amplifying molecular marker closely linked to wheat powdery mildew resistance gene PmCG15-009 and application of primer

    CN117025812A

  • Primer for amplifying molecular marker of powdery mildew resistance gene PmDR776 of cultivated wheat and application of primer

    CN118345188A

  • Molecular marker closely linked with wheat powdery mildew resistance gene PmL424 and application of molecular marker

    CN120272643A

  • Method of creating lines of winter soft wheat with complex resistance to brown and stem rust and powdery mildew

    RU2598275C1

Cited By

  • Primer of molecular marker linked with wheat powdery mildew resistance gene PmD345 and application thereof

    CN122405888A