Specific primer and rapid detection method for detecting or identifying fuscosphaerella cucumerinus and application of fuscosphaerella cucumerinus

Abstract

The invention provides specific primers and a rapid detection method used for detecting or identifying solanum tuberosum and application of the solanum tuberosum, the primer pair is PCTF1 / PCTR1, the nucleotide sequence of an upstream primer PCTF1 is shown as SEQ ID No: 1, and the nucleotide sequence of a downstream primer PCTR1 is shown as SEQ ID No: 2. The target sequence detected by the primer disclosed by the invention is a translation elongation factor (TEF) gene, the gene expression regulation is very conservative, and the gene sequence has high evolution conservative property and can be used as a DNA bar code of a point between species. The specific primer provided by the invention has the advantages of being good in specificity, high in sensitivity, economical, short in time consumption and the like when being used for detecting the brachycladium cucumerinum, and can play an important role in early diagnosis of the angelica sinensis root rot disease caused by Plectosphaerella cinerina.

Description

Technical Field

[0001] This application relates to the field of microbial identification or detection technology, and in particular to specific primers, rapid detection methods and applications for detecting or identifying Cucurbita cucumeroides. Background Technology

[0002] Cucumber spore shell ( Plectosphaerella cucumerina *Cyclocarya paliurus* is a soil-borne / facultative soil-borne pathogen with a wide host range, capable of infecting pathogens that cause various crop diseases. This pathogen primarily targets underground organs such as plant roots, rhizomes, and tubers, and subsequently spreads through the vascular system to above-ground stems, leaves, and fruits, forming a chain of infection from underground to above-ground symptoms. Previous research in my country on *Cyclocarya paliurus* mainly found it in alfalfa root rot and strawberry diseases. Fragaria × ananassa Duch.) Wilt disease, cabbage ( Brassica oleracea L.) root rot, tomato ( Solanum lycopersicum L.) wilting, Coptis chinensis ( Coptis chinensis In wilt disease, the plant's roots rot, the leaves above ground wilt and turn yellow, and the vascular bundles at the base of the stem turn brown.

[0003] Angelica sinensis ( Angelica sinensis Angelica sinensis (Dang Gui) is a medicinal plant belonging to the Apiaceae family. Its roots are used in traditional Chinese medicine for their blood-tonifying and blood-activating effects, earning it the reputation of "nine out of ten prescriptions contain Angelica sinensis." Gansu Province is a major cultivation area for Angelica sinensis in my country, accounting for approximately 65% ​​of the national planting area and over 90% of the total output. Developing a healthy Angelica sinensis industry is of great significance for promoting industrial restructuring and boosting county-level economic development. However, current Angelica sinensis production faces problems such as frequent occurrences of biological diseases like root rot and root rot, severe continuous cropping obstacles, and inadequate seed and seedling quality standards. Root rot and root rot, in particular, have become key factors affecting the yield and quality of "Min Gui" (a type of Angelica sinensis).

[0004] Rapid identification of plant diseases is crucial for early prevention and control. Traditional plant disease diagnosis methods require the isolation, purification, and identification of pathogens after symptoms appear, making it impossible to detect infection before symptoms manifest and thus hinder timely intervention. After pathogen isolation, morphological or molecular identification is necessary to clarify its taxonomic position. However, morphological identification is susceptible to human error and culture conditions, leading to misidentification. While molecular identification methods based on universal eukaryotic gene sequences such as ribosomal interstitial spacer (ITS) and translation elongation factor (TEF) sequences have been widely used in recent years, these methods require pathogen isolation and purification, and PCR amplification results necessitate sequencing and sequence alignment, which are time-consuming and cumbersome, often resulting in misdiagnosis and delayed treatment. Therefore, conventional diagnostic techniques based on disease symptoms cannot detect diseases before they occur, hindering early prevention and control, and failing to meet the requirements for rapid detection. There is an urgent need to develop a highly sensitive and easy-to-use rapid detection technology for the early diagnosis of Angelica sinensis root rot. Summary of the Invention

[0005] In view of this, the purpose of this application is to provide specific primers, rapid detection methods and applications for detecting Cucumber Fibrosum, in order to solve the problem that there is no early diagnostic method for the pathogen of Angelica sinensis root rot in the prior art.

[0006] The technical solution adopted in this application to solve the above-mentioned technical problems is as follows: Embodiments of the present invention provide specific primer pairs for detecting or identifying *Cyclocarya cucumberensis*. The primer pair is PCTF1 / PCTR1, and the nucleotide sequence of the upstream primer PCTF1 is shown in SEQ ID No:1, and the nucleotide sequence of the downstream primer PCTR1 is shown in SEQ ID No:2.

[0007] In some embodiments, SEQ ID No:1 is 5'-TCATGGACGCTACCGTAAGT-3'; SEQ ID No:2 is 5'-TCGAACTTCTCGATCTGTGTG-3'.

[0008] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina )cause The disease is root rot of Angelica sinensis.

[0009] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina ) bacteria The strain number is DTYP001, and the preservation number is CGMCC No. 42271.

[0010] For example, the primer pair PCTF1 / PCTR1 utilizes a variation of a translation elongation factor sequence. The upstream primer PCTF1 was designed based on the interval sequence, and the variant interval sequence is: TCATGGACGCTACCGTAAGTTTTCCCGAAGTCTCAGGCCGAAGAGCCTCAGTTTCACCGTTCCCAAGCTAACCACCTGGCACACAGATCGAGAAGTTCGA. The downstream primer PCTR1 was designed based on the other base sequences of the translation elongation factor.

[0011] Understandably, other base sequences usually refer to relatively conserved regions within the gene, which are downstream. The primer PCTR1 is designed from a highly conserved region, ensuring the success rate and versatility of PCR amplification.

[0012] In some embodiments, the primer pair PCTF1 / PCTR1 is used against Cucurbita cucumeroides. ( Plectosphaerella cucumerina It specifically amplifies a 100bp product.

[0013] In some embodiments, a kit for detecting or identifying *Staphylococcus cucumeroides* includes the special features described above. Heterogeneous primer pairs.

[0014] The specific primer pairs or the kits described above are used for the detection or identification of Cucumber Flocculation. Or it can be used to assist in the identification of the shape of root rot in Angelica sinensis.

[0015] A rapid method for detecting or identifying Cucumber Flocculation Fungus includes the following steps: S01. Isolation and culture of Cucumber Coccidioides, and extraction of Cucumber Coccidioides DNA; S02. Using Cucumber Coccidioides DNA as a template, PCR was performed using the specific primer pairs described above. Amplification; S03, Isolation of PCR amplification products and interpretation of results.

[0016] In S01: In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina ) bacteria The strain number is DTYP001, and the preservation number is CGMCC No. 42271.

[0017] In some embodiments, the method for isolating C. cucumerinum comprises: cutting a 5mm x 5mm tissue block at the diseased-healthy boundary, disinfecting the diseased part with 70% alcohol, then rinsing with sterile distilled water three times, placing into PDA medium, inoculating 2 4 pieces per culture dish, and culturing at 25℃. Selecting colonies with good growth and no contamination, when the mycelium length reaches 2 cm, picking the mycelium at the edge of the colony with an inoculation hook, inoculating again in the center of a new PDA medium, and then repeatedly purifying until the colonies grow uniformly and no contaminants appear.

[0018] In S02, the PCR amplification reaction system comprises: In some embodiments, the PCR amplification reaction system comprises: 0.5 μL of each of the upstream primer PCTF1 and the downstream primer PCTR1, 10 μL of 2x Taq PCR Master Mix, 1 μL of template DNA, and 8 μL of sterile ultrapure water.

[0019] Further, the 2x Taq PCR Master Mix comprises 0.05 U / μL of Taq DNA polymerase, 2+ 10x Buffer, 4 mmol / L of Mg , and 0.4 mmol / L of dNTPs.

[0020] In some embodiments, the PCR amplification reaction procedure comprises: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 40 s, and 72℃ extension for 1 min; 40 cycles; 72℃ final extension for 10 min; and 4℃ storage.

[0021] In S03, the PCR amplification reaction system comprises: In some embodiments, the amplified product is subjected to 1.3% agarose gel electrophoresis analysis, and whether the sample is C. cucumerinum, the pathogenic fungus of the root rot of Angelica sinensis, is determined according to whether a band is amplified.

[0022] Further, two controls are set for the DNA template for detection: a positive control and a negative control. The positive control is the genomic DNA of the pathogenic fungus of the root rot of Angelica sinensis, and the negative control is the genomic DNA of other fungi; if the positive control amplifies a band, and the negative control does not amplify a band, it is determined that the detected fungus is C. cucumerinum, the pathogenic fungus of the root rot of Angelica sinensis; if neither the positive control nor the negative control amplifies a band, it is determined that the detected fungus is not C. cucumerinum, the pathogenic fungus of the root rot of Angelica sinensis.

[0023] Further, the other fungi include Phoma medicaginis Phoma Medicaginis、 Fusarium oxysporum​​​ Fusariumoxysporum、 Phoma herpotrichoides Paraphoma radicina、 Fusarium decemcellulare Fusarium tricinctum、 Phoma clavispora Colletotrichum lentis one or more of them.

[0024] It can be understood that Phoma medicaginis Phoma Medicaginis、 Fusarium oxysporum Fusariumoxysporum、 Phoma herpotrichoides Paraphoma radicina、 Fusarium decemcellulare Fusarium tricinctum、 Phoma clavispora Colletotrichum lentis are all existing species.

[0025] The application does not require a nested PCR reaction system, and can directly use total DNA as a template for one-time PCR amplification to determine the presence or absence of Plectosphaerella cucumerina , and the convenience is improved. It is a very promising early rapid detection and monitoring technology for Angelica root rot pathogen, which can provide strong technical support for the diagnosis of Angelica root rot caused by P. cucumerina .

[0026] The target sequence detected by the primer of the application is the translation elongation factor gene (Transcription elongation factor, TEF), the gene expression regulation is very conservative, and the sequence of the gene has high evolutionary conservation, which can be used as a DNA barcode between species. By detecting the cucumber Peronophythora litchii through the specific primer of the application, the method has the advantages of good specificity, high sensitivity, economy and short time consumption, and can play an important role in early diagnosis of Angelica root rot caused by P. cucumerina . BRIEF DESCRIPTION OF DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings of the embodiments will be briefly introduced below. Obviously, the drawings described below only relate to some embodiments of the application, rather than limit the application, and the drawings include: P. cucumerina is an electropherogram of PCR amplification of the specific primer PCTF1 / PCTR1 of the application; Plectosphaerella is a melting curve (A) and a melting peak (B) of PCR amplification of the specific primer PCTF1 / PCTR1 of the application; cucumerina is a field symptom diagram of Angelica root rot of the application; Phoma is the growth state of the strain DTYP001 of the application on PDA medium; Medicaginis、 Koehrs' rule verification chart for the present application; Fusariumoxysporum、 Conidium chart for strain DTYP001 of the present application; Paraphoma radicina、 Multigene phylogenetic tree chart for strain DTYP001 of the present application; Fusarium tricinctum、 Scanning electron microscope chart for pathogenic bacteria DTYP001 invading angelica root system. DETAILED DESCRIPTION

[0028] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application. In addition, it should be understood that the specific embodiments described herein are only used to illustrate and explain the present application, and are not used to limit the present application.

[0029] In the description of the present application, the term "comprising" means "including but not limited to". The words first, second, third, etc. are only used as labels and do not impose numerical requirements or establish an order.

[0030] In the present application, "and / or" describes the association relationship of the associated objects, which means that there can be three kinds of relationships, for example, A and / or B can represent: A exists alone, A and B exist together, and B exists alone. Wherein A, B can be singular or plural.

[0031] In the present application, "at least one" means one or more, and "multiple" means two or more. "One or more", "at least one of the following" or similar expressions mean any combination of these items, including any combination of single item or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c", can represent: a, b, c, a-b (i.e. a and b), a-c, b-c, or a-b-c, where a, b, and c can be single or multiple.

[0032] Various embodiments of this application may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a hard limitation on the scope of this application; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Furthermore, whenever a numerical range is referred to herein, it means including any referenced number (fraction or integer) within the referred range.

[0033] In a first aspect, embodiments of the present invention provide specificity for detecting or identifying Cucumber Flocculationella. The primer pair is PCTF1 / PCTR1, with the nucleotide sequence of the upstream primer PCTF1 shown in SEQ ID No:1 and the nucleotide sequence of the downstream primer PCTR1 shown in SEQ ID No:2.

[0034] In some embodiments, SEQ ID No:1 is 5'-TCATGGACGCTACCGTAAGT-3'; SEQ ID No:2 is 5'-TCGAACTTCTCGATCTGTGTG-3'.

[0035] In some embodiments, the cucumber coccidioidomyces ( Colletotrichum lentis )cause The disease is root rot of Angelica sinensis.

[0036] In some embodiments, the cucumber coccidioidomyces ( Figure 1 ) bacteria The strain number is DTYP001, and the preservation number is CGMCC No. 42271.

[0037] For example, the primer pair PCTF1 / PCTR1 utilizes a variation of a translation elongation factor sequence. The upstream primer PCTF1 was designed based on the interval sequence, and the variant interval sequence is: TCATGGACGCTACCGTAAGTTTTCCCGAAGTCTCAGGCCGAAGAGCCTCAGTTTCACCGTTCCCAAGCTAACCACCTGGCACACAGATCGAGAAGTTCGA. The downstream primer PCTR1 was designed based on the other base sequences of the translation elongation factor.

[0038] In some embodiments, the primer pair PCTF1 / PCTR1 is used against Cucurbita cucumeroides. ( Figure 1 It specifically amplifies a 100bp product.

[0039] Secondly, embodiments of the present invention provide a kit for detecting or identifying *Staphylococcus aureus*, comprising... This includes the specific primer pairs described above.

[0040] Thirdly, embodiments of the present invention provide the specific primer pairs described above or the specific primer pairs described above. Application of the kit in detecting or identifying Cucumber Flocculation Fungus or in assisting in the identification of the morphology of Angelica Root Rot.

[0041] Fourthly, embodiments of the present invention provide a method for rapid detection or identification of Cucumber Flocculation Fever. Includes the following steps: S01. Isolation and culture of Cucumber Coccidioides, and extraction of Cucumber Coccidioides DNA; S02. Using Cucumber Coccidioides DNA as a template, PCR was performed using the specific primer pairs described above. Amplification; S03, Isolation of PCR amplification products and interpretation of results.

[0042] In S01: In some embodiments, the cucumber coccidioidomyces ( Figure 1 ) bacteria The strain number is DTYP001, and the preservation number is CGMCC No. 42271.

[0043] In some embodiments, the method for isolating *Staphylococcus aureus* includes: cutting a 5mm × 5mm tissue block at the junction of diseased and healthy tissue, disinfecting the lesion site with 70% alcohol, rinsing three times with sterile distilled water, and placing it in PDA medium, inoculating each culture dish with 2... Four pieces were incubated at 25°C. Colonies in good growth condition and free from contamination were selected. When the mycelial length reached 2cm, the mycelium at the edge of the colony was picked up with an inoculation hook and inoculated again into the center of a new PDA medium. This process of isolation and purification was repeated multiple times until the colonies grew uniformly and without any contaminating bacteria.

[0044] In S02: In some embodiments, the PCR amplification reaction system comprises: upstream primer PCTF1 and downstream primer. 0.5 μL each of PCTR1, 10 μL of 2×Taq PCR Master Mix, 1 μL of template DNA, and 8 μL of sterile ultrapure water.

[0045] Further, the 2x Taq PCR Master Mix comprises 0.05 U / μL of Taq DNA polymerase, 10x Buffer, 4 mmol / L of Mg 2+ and 0.4 mmol / L of dNTPs.

[0046] In some embodiments, the reaction procedure of PCR amplification is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 10 s, annealing at 60℃ for 40 s, and extension at 72℃ for 1 min; 40 cycles; final extension at 72℃ for 10 min; and preservation at 4℃.

[0047] In the S03, In some embodiments, the amplification product is subjected to 1.3% agarose gel electrophoresis analysis, and whether the sample is the pathogenic fungus of the root rot of Angelica sinensis, Phoma exigua var. angulata, is determined according to whether a band is amplified.

[0048] Further, two controls are set for the DNA template for detection: a positive control and a negative control, The positive control is the genomic DNA of the pathogenic fungus of the root rot of Angelica sinensis, and the negative control is the genomic DNA of other fungi; if the positive control amplifies a band, and the negative control does not appear a band, it is determined that the detected fungus is the pathogenic fungus of the root rot of Angelica sinensis, Phoma exigua var. angulata; if neither the positive control nor the negative control amplifies a band, it is determined that the detected fungus is not the pathogenic fungus of the root rot of Angelica sinensis, Phoma exigua var. angulata.

[0049] Further, the other fungi include one or more of Phoma medicaginis, Figure 1 Fusarium oxysporum Figure 1 Phoma herpotrichioides Figure 1 Fusarium decemcellulare Figure 1 Figure 1 Colletotrichum trifolii Plectosphaerella cucumerina

[0050] It can be understood that Phoma medicaginis, Plectosphaerella cucumerina Fusarium oxysporum Plectosphaerella cucumerina Phoma herpotrichioides Plectosphaerella cucumerina Fusarium decemcellulare Phoma Medicaginis、 Fusariumoxysporum、 Colletotrichum trifolii Paraphoma radicina、 are all existing fungi.

[0051] Test Example 1 According to the GenBank, the sequences of the pathogenic fungus of the root rot of Angelica sinensis, Fusarium ​​​The sequences of the transcription elongation factor (TEF) genes of fungi in the Ascomycota and other species of fungi were found to be useful in designing tricinctum、 a pair of specific primers for detecting PCTF1 and PCTR1, respectively, and the sequences of the specific primers are: TCATGGACGCTACCGTAAGTTTTCCCGAAGTCTCAGGCCGAAGAGCCTCAGTTTCACCGTTCCCAAGCTAACCACCTGGCACACAGATCGAGAAGTTCGA, and the sequences of the specific primers are: Colletotrichum lentis a pair of specific primers for detecting PCTF1 and PCTR1, respectively, and the sequences of the specific primers are: Phoma Medicaginis、 TCGAACTTCTCGATCTGTGTG-3'. PCTF1: 5'-TCATGGACGCTACCGTAAGT-3' PCTR1: 5'-TCGAACTTCTCGATCTGTGTG-3'.

[0052] Test Example 2 Isolation and purification of the test fungi The samples were collected in Gongzhuang Village, Baisong Township, Kangle County, Linxia Hui Autonomous Prefecture, Gansu Province (35.2° N, 103.5° E) in 2024. The disease was investigated in the planting base, and the symptoms were described. The morphology of the typical diseased plants was described as follows: brown water-stained lesions appeared on the stems, oval brown lesions appeared on the leaves, the leaves turned yellow and withered, the roots turned brown and rotted, and the roots formed fibrous hollows. The diseased plants were collected for isolation and purification of the pathogen.

[0053] Tissue isolation method was used. A 5 mm x 5 mm tissue block was cut at the diseased-healthy interface, the diseased part was disinfected with 70% alcohol, then washed with sterile distilled water three times, and placed in PDA medium, 2 4 pieces per culture dish, and cultured at 25°C. The colonies with good growth state and no contamination were selected, and when the mycelium length reached 2 cm, the mycelium at the edge of the colony was picked with an inoculation hook, and inoculated again in the center of a new PDA medium. Subsequent isolation and purification were performed several times until the colonies grew uniformly and no contaminants were present.

[0054] The colonies obtained by purification were beige or light beige, with a dark pink-white center, a large amount of velvet, a relatively dense surface, occasional radial wrinkles, a neat edge, and a light brown back. The colony morphology was observed, and the conidium morphology was observed under a microscope. The isolates with good growth and typical state were selected for subsequent experiments.

[0055] Test Example 3 Three strains were selected as test strains.

[0056] Extraction of DNA from test strains (1) 20 mg of mycelium was ground into powder with liquid nitrogen and added to a 1.5 ml centrifuge tube. 200 μL Buffer Digestion and 2 μL β-mercaptoethanol were added, followed by 20 μL Proteinase K solution, which was shaken and mixed, and incubated at 56°C for 1 h to completely lyse the cells.

[0057] (2) 100 μL Buffer PF was added, mixed well by inverting, and placed in a -20°C refrigerator for 5 min.

[0058] (3) Centrifugation was performed at 10,000 rpm for 5 min at room temperature, and the supernatant was transferred to a new 1.5 ml centrifuge tube.

[0059] (4) 200 μL Buffer BD was added and mixed well by inverting.

[0060] (5) 200 μL of anhydrous ethanol was added and mixed well by inverting.

[0061] (6) The adsorption column was placed in a collection tube, and the solution and translucent fibrous suspension were added to the adsorption column using a pipette, and left to stand for 2 min, followed by centrifugation at 10,000 rpm for 1 min at room temperature, and the waste liquid in the collection tube was discarded.

[0062] (7) The adsorption column was placed back in the collection tube, 500 μL of PW Solution was added, and centrifugation was performed at 10,000 rpm for 30 s, and the waste liquid in the collection tube was discarded.

[0063] (8) The adsorption column was placed back in the collection tube, 500 μL of Wash Solution was added, and centrifugation was performed at 10,000 rpm for 30 s, and the waste liquid in the collection tube was discarded.

[0064] (9) The adsorption column was placed back in the collection tube, and centrifugation was performed at 12,000 rpm for 2 min at room temperature to remove the residual Wash Solution.

[0065] (10) The adsorption column was removed and placed in a new 1.5 ml centrifuge tube, 50 μL of TE Buffer was added, and left to stand for 3 min, and centrifugation was performed at 12,000 rpm for 2 min at room temperature, and the DNA solution was collected. The extracted DNA can be immediately subjected to the next step of the experiment or stored at -20°C.

[0066] Specific amplification of test strains Using the DNA of the tested bacteria as a template, the primer amplification reaction system was as follows: 20 μL, 0.5 μL each of the upstream primer PCTF1 and the downstream primer PCTR1, 10 μL of 2×Taq PCR Master Mix, 1 μL of template DNA, and 8 μL of sterile ultrapure water. The 2×Taq PCR Master Mix contained 0.05 U / μL Taq DNA polymerase, 10×Buffer, and 4 mmol / L MgSO4. 2+ And 0.4 mmol / L of dNTPs.

[0067] The amplification reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 40 s, 72℃ extension for 1 min; 40 cycles; 72℃ final extension for 10 min; storage at 4℃.

[0068] Agarose gel electrophoresis analysis of amplification products The amplification products were analyzed by 1.3% agarose gel electrophoresis, and the presence or absence of amplified bands determined whether the sample was *Cyclocarya cucumeroides*, the pathogen causing root rot of Angelica sinensis.

[0069] Specifically, determining whether a sample contains the pathogen *Gnaphalium affine*, the pathogen causing root rot of *Angelica sinensis*, based on the presence or absence of a band, involves setting up two controls for the DNA template used in the detection: a positive control and a negative control. These represent the genomic DNA of the pathogen and the genomic DNA of another fungus, respectively. If the positive control shows a band, while the negative control does not, the detected fungus is identified as *Gnaphalium affine*. If neither the positive nor negative control shows a band, the detected fungus is not *Gnaphalium affine*.

[0070] In this invention, primers PCTF1 / PCTR1 target the pathogen causing root rot of Angelica sinensis (… Fusariumoxysporum、 Paraphoma radicina、 Genomic DNA of ) and genomic DNA of other fungi (Alfalfa stem mold) Fusarium tricinctum、 Fusarium oxysporum Colletotrichum lentis Root heterostem mold Plectosphaerella cucumerina Fusarium trifidum P. cucumerina lentil thorny discus P. cucumerina The amplification results are as follows: P. cucumerina , Plectosphaerella cucumerina Phoma Medicaginis、 Fusariumoxysporum、 Paraphoma radicina、 Fusarium tricinctum、 Colletotrichum lentis Figure 1 Figure 1 The "M" in the text refers to a DNA marker, which has multiple bands representing DNA fragments of different sizes. Lanes 1, 2, and 3 represent bands amplified from the pathogen of Angelica sinensis root rot, *Cyclocarya paliurus*. Lane 1 represents the *Cyclocarya paliurus* (…). Plectosphaerella cucumerinaThe strain identified was DTYP001, with accession number CGMCC No. 42271. However, the pathogen of Angelica sinensis root rot, *Cyclocarya cucumeroides*, failed to amplify any bands (lanes 4, 5, 6, 7, and 8), indicating that primers PCTF1 / PCTR1 have very high specificity.

[0071] Figure 1 In the middle, lanes 4-8 are respectively: plant pathogenic fungi. Phoma medicaginis, Fusarium oxysporum, Paraphoma radicina, Fusarium tricinctum, Colletotrichum lentis DNA bands.

[0072] Figure 2 shows the genomic DNA melting curves of the pathogen causing root rot of Angelica sinensis (positive control) and other fungi (negative control). Figure 2 A) and dissolution peak ( Figure 2 B). Figure 2 Figure A shows the melting process of the amplified product as the temperature increases, and the curve represents the pathogen of Angelica sinensis root rot (…). Plectosphaerella cucumerina The melting process of the amplified genomic DNA products of these samples (negative control bacteria); the linear sequence illustrates the melting process of these samples (negative control bacteria). Phoma medicaginis, Fusarium oxysporum, Paraphoma radicina, Fusarium tricinctum, Colletotrichum lentis No obvious specific amplification products were observed within this temperature range. Figure 2 In sample B, the peaks of the pathogen causing root rot of Angelica sinensis were concentrated in the same temperature range, and the peaks were sharp and single, indicating that the PCR amplification product was a specific single product, without primer dimers or non-specific amplification peaks; while the amplification results for the genomic DNA of other fungi (negative control) were smooth straight lines, further demonstrating that the primers were effective against the pathogen causing root rot of Angelica sinensis. Plectosphaerella cucumerina ) specific amplification.

[0073] Embodiments of the present invention provide *Cucumber Coccidioides*, the taxonomic name of which is... Cucumber spore shell ( Plectosphaerella cucumerina The strain number of the Cucumber Scale Bacterium is DTYP001, and the preservation number is CGMCC No. 42271.

[0074] Currently, root rot is a frequent and serious problem in angelica cultivation, but the specific pathogens causing this disease remain unclear. The definition of the original species is ambiguous, especially for Cucumber Scale ( Plectosphaerella cucumerina There is a gap in our understanding of whether this pathogen is responsible for Angelica sinensis root rot. We lack systematic evidence for strain isolation and purification, morphological analysis, and precise identification at the gene level, which makes it impossible to conduct targeted research from the source of the pathogen and restricts the precision of disease control.

[0075] This application isolated a fungus, *Cyclocarya cucumeroides*, from the root of *Angelica sinensis*, and analyzed its morphology and composition. Biological identification revealed it to be Cucumber Scale (Plectosphaerella cucumerina The strain, identified as DTYP001, was identified as having the preservation number CGMCC No. 42271. The pathogen was confirmed to be *Cyclocarya cucumeroides* through a pathogen re-inoculation experiment—Koch's postulates. Plectosphaerella cucumerina DTYP001 is the pathogen causing root rot of Angelica sinensis (Cucumber spores). Plectosphaerella cucumerina )) attributes.

[0076] Current methods for diagnosing root rot in Angelica sinensis rely heavily on field symptom observation, which is highly subjective, inaccurate, and lacks standardized control strains and scientific testing techniques. This makes it difficult to achieve early, rapid, and accurate diagnosis of the disease, often resulting in misdiagnosis and missed diagnosis, delaying the best time for disease control and causing serious losses in yield and quality of Angelica sinensis.

[0077] The strain of this application (Cucumber Glomerella) Plectosphaerella cucumerina DTYP001 was used as a reference standard in the identification of Angelica sinensis root rot disease. Ultimately, it provides a key technical solution to solve the problems of unclear identification of pathogens causing Angelica sinensis root rot, lack of diagnostic methods, and lack of basic support for prevention and control. It fills the research gap in this field and lays the core foundation for the scientific diagnosis and effective prevention and control of Angelica sinensis root rot.

[0078] This application is for Cucumber Scale ( Plectosphaerella cucumerina The strain, with accession number DTYP001, is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China, with accession number CGMCC No. 42271, deposited on October 10, 2025. The biological material (strain) is DTYP001, and its classification and name are *Cyclocarya cucumeroides*. Plectosphaerella cucumerina .

[0079] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina DTYP001's ITS sequence The sequence is shown in the sequence list SEQ ID No:5.

[0080] Furthermore, SEQ ID No:5: CTTCCGTAGGGGGAACCTGCGGAGGGATCATTACTGAGTACTACACTCTCTACCCTTTGTGAACTATTATACCTGTTGCTTCGGCGGCGCCCGCGAGGGTGCCCGCCGGTCTCATCAGAATCTCTGTTTTCGAACCCGACGATACTTCTGAGTGTTCTTAGCGAACTGTCAAAACTTTTAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGCGTTGGGGATCTGCCACGGCAGGCCCCTAAAACCAGTGGCGGACCCGAAGGCCCTCTCCTTTGCGCAGTAGCATCAGCCTCGCATTGGGATCCCTCGGCGTCCTGCCTCTAAACCCCCCACAAGTCCGCTCCGGCGGCACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAGCCGGAGGAA。

[0081] In some embodiments, the NL sequence of the Mycosphaerella melonis ( Plectosphaerella cucumerina ) DTYP001 is shown in SEQ ID No:6 of the sequence list: Furthermore, SEQ ID No:6: AAAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCGTCGGGTACGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTAGGACACCCAGCCCGTGTGACGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAACGGGAGGTATACTCCTTCCAAGGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTCGCTACCAGACTTGGGTTCGGCGGTTCAACCGGGGCCACGCCCCGGGGCATTCCGCCGGCCCAGGCCAGCATCAGCTTTCCGTCGGGGGTAAAGGCGTCGGGAATGTGGCTCCCCTTCGGGGGAGTGTTATAGCCCGTCGTGTCATACCCTTCGGGGGGCTGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTAGCTAGTGACCCGTCTTGAACCACGGACCAT In some embodiments, the Cytospora chrysosperma (C. chrysosperma) is from the root of an Angelica archangelica root root rot pathogen. Plectosphaerella cucumerina ) DTYP001 is from the root of an Angelica archangelica root root rot pathogen.

[0082] Further, the root sample of the Angelica archangelica root root rot pathogen was collected in 2024 from Gongzhuang Village, Bamasong Township, Kangle County, Linxia Hui Autonomous Prefecture, Gansu Province (35.2° N, 103.5° E).

[0083] It can be understood that the above collection site is located in the transition zone between the Loess Plateau and the Qinghai-Tibet Plateau, with a diurnal temperature difference of 10-15°C, an annual rainfall of 500-600mm, a large diurnal temperature difference, and sufficient sunlight, which is suitable for the growth of Angelica. In the planting base, the disease was investigated, the symptoms were described, and typical strains were collected. The strain morphology is described as follows: brown water-stained lesions appear on the stem, oval brown lesions appear on the leaves, the leaves turn yellow and wither, the roots turn brown and rot, and form a waterlogged fibrous shell (such as Figure 3 ); the diseased strains were collected for pathogen isolation and purification.

[0084] The application also provides the use of the C. cucumerinum as a control in identifying angelica root rot disease.

[0085] In some embodiments, the C. cucumerinum is used as a control, and the concentration of the spore suspension of the strain is 4 x 10 6 individuals / mL.

[0086] Test Example Collection, purification and identification of diseased strains Test material Test medium: potato dextrose agar medium (Beijing Solabio Technology Co., Ltd.); Test instruments: main instruments include Nikon optical microscope, critical point drying instrument (Quorum, K850), ion sputtering instrument (hitachi, MC1000), scanning electron microscope (hitachi, SU8100).

[0087] Collection of diseased strains: samples were collected in Gongzhuang Village, Bamosong Township, Kangle County, Linxia Hui Autonomous Prefecture, Gansu Province (north latitude 35.2°, east longitude 103.5°) in 2024. The area is located in the transition zone between the Loess Plateau and the Qinghai-Tibet Plateau, with a diurnal temperature difference of 10-15℃, an annual rainfall of 500-600mm, a large diurnal temperature difference, and sufficient sunlight, suitable for the growth of angelica. The disease was investigated in the planting base, the symptoms were described, and typical diseased strains were collected. The morphology of the diseased strains was described as follows: brown water-stained lesions appeared on the stems, oval brown lesions appeared on the leaves, the leaves turned yellow and withered, the roots were brown and rotten, and formed a fibrous hollow; the diseased strains were collected for pathogen isolation and purification, and the results are shown in Figure 3 .

[0088] Isolation and purification of pathogenic fungi Tissue isolation method was used. A 5mm x 5mm tissue block was cut at the junction of the diseased and healthy parts, the diseased part was disinfected with 70% alcohol, then washed with sterile distilled water three times, and placed in PDA medium, 2 4 pieces were inoculated in each culture dish, and cultured at 25℃. The well-grown colonies without contamination were selected, and when the mycelium length reached 2cm, the mycelium at the edge of the colony was picked with an inoculation hook, and inoculated again in the center of a new PDA medium. Subsequent isolation and purification were performed until the colonies grew uniformly without contamination.

[0089] A typical strain was selected for subsequent experiments, and the number was DTYP001. The growth state of the DTYP001 strain on the PDA medium is shown in Figure 4 , the colony morphology was observed, and the conidium morphology was observed under a microscope. Subsequent experiments were performed.

[0090] The colony of the strain DTYP001 was milky or light yellow, dark pink in the center, and had a large and dense velvet, moist surface, occasional radial folds, and a neat edge. The colony back was light brown, and the diameter was 43.5 mm after 7 days of culture on PDA medium.

[0091] Figure 4 a is the front of the colony, and b is the back of the colony.

[0092] Morphological and molecular biological identification of the pathogenic fungus: Morphological identification The strain meeting the Koch's postulates was inoculated into PDA medium, and the mycelium of the colony edge of the purified cultured fungus was scraped with a sterile toothpick on a clean glass slide. One drop of distilled water was added, the mycelium was crushed, the cover glass was covered, and the mycelium and spores were observed under a microscope. Figure 6 .

[0093] The morphological identification result was as follows: the spore size was 6.3-24.3 μm x 1.4-3.3 μm (average 15.9 μm x 2.2 μm), the conidia were gathered into heads, and were oval or long oval, narrow at both ends and wide in the middle, transparent, smooth surface, thin-walled, 0-1 septum, with an oil ball, size 4.0-8.9 μm x 2.0-4.0 μm, average 6.9 μm x 2.8 μm.

[0094] Molecular biological identification DNA extraction: The genomic DNA of the pathogenic fungus DTYP001 strain was extracted by the CTAB method.

[0095] PCR amplification: PCR amplification was performed using primers ITS1 / 4 and NL1 / 4, respectively. The primer sequences were as follows: ITS1 was as shown in SEQ ID NO. 7: TCCGTAGGTGAACCTGCGG; ITS4 was as shown in SEQ ID NO. 8: TCCTCCGCTTATTGATATGC; NL1 was as shown in SEQ ID NO. 3: GCATATCAATAAGCGGAGGAAAAG; and NL4 was as shown in SEQ ID NO. 4: GGTCCGTGTTTCAAGACGG.

[0096] Amplification system (50.0 ul): genomic DNA (20 ng / ul), 1.0 ul 10x Buffer (containing 2.5 mM Mg2+) 5.0 ul, Taq polymerase (5 u / μL) 1.0 ul, dNTP (10 mM) 1.0 ul, ITS1 primer (10 uM) 1.5 ul, ITS4 primer (10 uM) 1.5 ul [or NL1 primer (10 uM) 1.5 ul, NL4 primer (10 uM) 1.5 ul], ddH2O 39.0 ul.

[0097] Reaction condition: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 40 s, 72℃ extension for 1 min; cycle for 40 times; 72℃ final extension for 10 min; 4℃ preservation.

[0098] ITS sequence sequencing: the PCR product was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing.

[0099] NL sequence sequencing: the PCR product was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing.

[0100] Primer sequence: ITS1 is shown as SEQ ID NO. 1; ITS4 is shown as SEQ ID NO. 8; NL1 is shown as SEQ ID NO. 3; NL4 is shown as SEQ ID NO. 4.

[0101] It can be understood that the primers ITS1 / 4 and NL1 / 4 are respectively subjected to PCR amplification, and the two amplification systems and reaction conditions are the same.

[0102] The genomic DNA of strain DTYP001 was used as a template for PCR amplification and sequencing. The ITS and NL gene sequences obtained by sequencing were compared and analyzed on the BLAST platform of NCBI (https: / / www.ncbi.nlm.nih.gov / ). According to the comparison results, the ITS and NL sequences were trimmed and then concatenated using phylosuit. Then, Mega12 was used to construct a phylogenetic tree by NJ method with bootstrap set to 1000 times.

[0103] According to the comparison results, a phylogenetic tree was constructed, and the results showed that the strain DTYP001 of the present experiment was clustered with Plectosphaerella cucumerina into a branch, and formed a separate branch, which was defined as a new species, named Plectosphaerella cucumerina DTYP001.

[0104] It can be understood that the strain DTYP001 was clustered with Plectosphaerella cucumerina into a branch, and formed a separate branch, which indicated that the two had a close genetic relationship and a large genetic difference. In addition, the fungus had never been reported in Angelica root rot, and therefore was defined as a new species.

[0105] Pathogenicity determination of pathogenic fungi: Pathogenic fungi back-inoculation experiment (Koch's postulate) Potting verification was carried out by using Koch's postulate. The strawberry plant was inoculated by choosing healthy and basically consistent Angelica plants.

[0106] Inoculation of the root of the potted Angelica sinensis by wounding: the spores of the pathogen DTYP001 were washed to prepare a suspension, 0.01% Tween 20 was added, and the suspension was gently shaken until the spores were uniformly dispersed. The concentration of the spore suspension was 4×10 6 After the seedlings were transplanted into the substrate sterilized by high temperature, they were allowed to recover for 7 days. Then, a sterilized scalpel was inserted into the soil near the plant to cause a micro-wound on the root of the plant. 100 mL of the spore suspension with a concentration of 4×10 6 per mL was poured into each plant, and each treatment was repeated 3 times.

[0107] The results of the root-inoculation experiment showed that the Angelica sinensis plants wilted about 21 days after the root-inoculation. The roots were dissected, and the lesions in the roots were found to be consistent with the symptoms of the roots of the diseased plants in the field. Figure 5 The diseased tissues were isolated and purified, and the obtained strain was consistent with the strain used for inoculation. According to the Koch's postulates, the strain DTYP001 is the pathogen of the root rot of Angelica sinensis.

[0108] Figure 5 In the figure, A is a healthy Angelica sinensis plant and root section; B is a plant and root section after inoculation with the pathogenic fungus Sphaerulina fuliginea; C is a root cultured in vitro with sterile water; and D is a root cultured in vitro treated with a spore suspension of Sphaerulina fuliginea. In the figure C and D, the white part is sterile cotton under the roots, Figure 5 The root in C was not treated with any fungus after the treatment with sterile water, and the root system was healthy. Figure 5 As can be seen from D, the root system grew mycelium and showed signs of decay after treatment with the spore suspension of Sphaerulina fuliginea.

[0109] Preparation of samples for scanning electron microscopy After the collection of Angelica sinensis root system samples after pathogenicity assay, place them in 4% glutaraldehyde solution (4°C storage) for 7 days, then rinse the samples 3 times for 15 min each time with 0.1 mol / L pH 7.4 phosphate buffer, then use 1% osmic acid solution prepared with 0.1 mol / L pH 7.4 phosphate buffer to fix the samples at room temperature in the dark for 1-2 h, and then rinse the samples again 3 times for 15 min each time with 0.1 mol / L pH 7.4 phosphate buffer. Cut about 5 mm x 5 mm size leaf tissues, one on each side, and place them in 30%, 50%, 70%, 80%, 90%, 95%, 100%, and 100% (v / v) alcohol for dehydration, each gradient dehydration for 15 min, and finally place the samples in isoamyl acetate for 15 min, and then place the samples in a critical point drying instrument (Quorum, K850) for drying, and after drying, place the samples tightly on a conductive carbon film double-sided tape on the sample table of an ion sputtering instrument (hitachi, MC1000) for gold spraying for about 30 s. Use a field emission scanning electron microscope (hitachi, SU8100) at 3.00 KV to observe the samples.

[0110] The results show that the pathogenic fungus DTYP001 colonizes the surface and interior of Angelica sinensis root system in multiple ways. Under low magnification (such as 500x), obvious structural damage to the root epidermis can be observed, and the mycelium invades the host tissue through the epidermal fissure; under medium-high magnification (1000x-5000x), the fungal hyphae are distributed in a reticular interweaving manner, and a dense mycelial layer is formed in some areas, with a hyphal diameter of about 2-5 μm, and fine ornamentation can be seen on the surface; under high magnification (20000x), the close combination of fungal specialized structures (such as appressoria) and root cells, as well as the morphological response of host cells after infection (including cell wall thickening, intercellular structure destruction, etc.) are clearly presented, such as Figure 8 Plectosphaerella cucumerina Plectosphaerella cucumerina Plectosphaerella cucumerina Figure 5 Figure 5 Figure 5 Figure 5 Figure 8 Plectosphaerella cucumerina Plectosphaerella cucumerina Plectosphaerella cucumerina Figure 5 Figure 5 Figure 5 Figure 5 Figure 8 Plectosphaerella cucumerina Plectosphaerella cucumerina Plectosphaerella cucumerina Figure 5 Figure 5 Figure 5 Figure 5 Figure 8 Plectosphaerella cucumerina Plectosphaerella cucumerina Plectosphaerella cucumerina Figure 5 Figure 5 Figure 5 Figure 5 Figure 8 Plectosphaerella cucumerina Plectosphaerella cucumerina Plectosphaerella cucumerina Figure 5 Figure 5 Figure 5 Figure 5 Figure 8 Plectosphaerella cucumerina Plectosphaerella cucumerina Plectosphaerella cucumerina .

[0111] Meanwhile, specific words are used in the present application to describe the embodiments of the present application. As "one embodiment", "an embodiment", and / or "some embodiments" mean a certain feature, structure or characteristic related to at least one embodiment of the present application. Therefore, it should be emphasized and noted that the "one embodiment" or "one embodiment" or "one alternative embodiment" mentioned in different places in the specification does not necessarily refer to the same embodiment. In addition, certain features, structures or characteristics in one or more embodiments of the present application can be properly combined.

Claims

1. A specific primer pair for detecting or identifying Mycosphaerella melonis, characterized in that, The primer pair is PCTF1 / PCTR1, the nucleotide sequence of the upstream primer PCTF1 is shown as SEQ ID No: 1, and the nucleotide sequence of the downstream primer PCTR1 is shown as SEQ ID No:

2.

2. The specific primer pair for detecting or identifying Mycosphaerella melonis according to claim 1, characterized in that, The disease caused by said Mycosphaerella cucurbitulae Plectosphaerella cucumerina is angelica root rot.

3. The specific primer pair for detecting or identifying Mycosphaerella melonis according to claim 1, wherein, The strain number of the Mycosphaerella melonis ( Plectosphaerella cucumerina ) is DTYP001, and the preservation number is CGMCC No. 42271.​ 4. The specific primer pair for detecting or identifying Mycosphaerella melonis according to claim 1, wherein, The primer pair PCTF1 / PCTR1 specifically amplifies 100 bp for C. cucumerinum. Plectosphaerella cucumerina ) 5. A kit for detecting or identifying Plectosphaerella cucumerina, comprising the specific primer pair of claim 1.

6. Use of the specific primer pair of any one of claims 1 to 4 or the kit of claim 5 in detecting or identifying Plectosphaerella cucumerina or assisting in identifying the form of Angelica root rot.

7. A method for rapid detection or identification of Mycosphaerella melonis, characterized in that, comprising the following steps: S01, isolating and culturing Plectosphaerella cucumerina, and extracting Plectosphaerella cucumerina DNA; S02, using the specific primer pair described above to perform PCR amplification on the Plectosphaerella cucumerina DNA as a template; S03, separating the PCR amplification product and determining the result.

8. The method for rapid detection or identification of Mycosphaerella melonis according to claim 7, characterized in that, a strain of Mycosphaerella melonis (Berk. et Bloxam) Jenkins Plectosphaerella cucumerina having a strain number of DTYP001 and a preservation number of CGMCC No. 42271; and / or The reaction system for PCR amplification is: 0.5 μL of each of the upstream primer PCTF1 and the downstream primer PCTR1, 2x Taq PCR Master Mix 10 μL, 1 μL of template DNA, 8 μL of sterile ultrapure water; and / or The reaction procedure for PCR amplification is: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 40 s, 72℃ extension for 1 min; 40 cycles; 72℃ final extension for 10 min; 4℃ storage; and / or The amplification product is subjected to 1.3% agarose gel electrophoresis analysis, and whether the sample is the pathogen Plectosphaerella cucumerina of Angelica root rot is determined according to whether a band is amplified.

9. The method for rapid detection or identification of Mycosphaerella melonis according to claim 8, characterized in that, Two controls are set for the DNA template for detection: a positive control and a negative control, the positive control is the genomic DNA of the pathogen of Angelica root rot, and the negative control is the genomic DNA of other fungi; if the positive control all amplifies a band, and the negative control does not appear a band, it can be determined that the detected fungus is the pathogen Plectosphaerella cucumerina of Angelica root rot; if neither the positive control nor the negative control amplifies a band, it can be determined that the detected fungus is not the pathogen Plectosphaerella cucumerina of Angelica root rot.

10. The method for rapid detection or identification of Mycosphaerella melonis according to claim 9, characterized in that, Other fungi include Phoma herbarum Phoma Medicaginis, Fusarium oxysporum Fusarium oxysporum, Phoma radicicola Paraphoma radicina, Fusarium decemcellulare Fusarium tricinctum, Colletotrichum trifolii Colletotrichum lentis one or more of.

Images