Application of MetAP2 as target spot in medicine for reducing drug resistance of multiple myeloma cells
By targeting the MetAP2 protein and inhibiting its expression using shRNA and CRISPR/Cas9sgRNA technologies, the problem of bortezomib resistance in multiple myeloma cells has been solved, and the sensitivity of tumor cells to bortezomib has been improved, which has significant potential for clinical application.
Patent Information
- Application Number
- CN202511669196.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-14
- Publication Date
- 2026-02-03
AI Technical Summary
The resistance of multiple myeloma cells to bortezomib is a problem. Existing treatments suffer from drug resistance, significant toxic side effects, and unavoidable resistance due to target mutations. Furthermore, gene knockout and RNA interference have off-target effects and metabolic instability, which limit their application.
Using MetAP2 protein as a target, we developed a drug to target bortezomib resistance in multiple myeloma by inhibiting or knocking down MetAP2 protein expression through shRNA and CRISPR/Cas9sgRNA technologies. We also detected the mRNA and protein expression levels of MetAP2 to predict the degree of drug resistance and affected the sensitivity of tumor cells to bortezomib by overexpressing or knocking down MetAP2.
It effectively reduces the resistance of multiple myeloma cells to bortezomib and increases the sensitivity of tumor cells to bortezomib, providing a new clinical treatment approach with significant clinical and translational value.
Smart Images

Figure CN121450801A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and relates to application of MetAP2 as a target point in a drug for reducing drug resistance of multiple myeloma cells. BACKGROUND
[0002] Multiple myeloma (MM) is a hematological malignancy with the second highest incidence after lymphoma in China. Monoclonal plasma cells in the blood of patients will proliferate and infiltrate in the bone marrow, and secrete a large amount of monoclonal immunoglobulin, which causes end-organ damage, anemia, kidney damage, bone destruction, hypercalcemia and the like, and the prognosis is extremely poor. The application of proteasome inhibitors has improved the prognosis of patients to a certain extent, but the emergence of multidrug resistance (MDR) is a key factor for clinical treatment failure. MM cells will inevitably develop complex drug resistance phenotypes after being continuously exposed to drugs such as BTZ for a period of time, which involves drug metabolism abnormalities, abnormal high expression of proteins and post-translational modification, and ultimately leads to instability of the MM genome and high expression of drug resistance genes.
[0003] In recent years, the development of a series of new drugs has brought new hope and the possibility of cure for the treatment of relapsed and refractory MM, greatly improving the survival rate and prognosis of patients, but also has disadvantages that cannot be ignored. Immunotherapy of tumors, such as CAR-T, is made from cells donated by others. In addition to high cost and inability to be commercialized, safety is also a major problem. Therefore, several clinical trials of CAR-T have been urgently stopped. The development of protein kinase or epigenetic modifier inhibitors and monoclonal antibodies targeting tumor antigens has become a new hotspot in the development of anti-tumor drugs. However, both of them need to continuously occupy the active site of the target protein to block the function, which requires the drug to have sufficient dose, half-life and affinity in the body to saturate the target; therefore, there are disadvantages of large toxic side effects, off-target toxicity; and once the target point appears mutation or overexpression, drug resistance will inevitably occur. Gene knockout and RNA interference can regulate the expression level change of proteins causing diseases, but their off-target effects and metabolic instability limit their wide application.
[0004] Methionine aminopeptidase (MetAP) can remove the N-terminal methionine of new and mature proteins, maintain protein activation, localization, stability, MetAP2, in addition to its methionine aminopeptidase enzyme activity, its expression is related to cell proliferation, and its inactivation can cause cell cycle arrest in the G1 phase, maintain the phosphorylation level of eukaryotic translation initiation factor eIF-2a; It also plays an important role in embryonic development and angiogenesis. MetAP2 knockout can inhibit endothelial cell and tumor cell growth, and is related to tumor poor prognosis. Therefore, it is considered to have an anti-angiogenic drug target and receives more attention. MetAP2 inhibitors have great potential in the design and development of anti-tumor drugs. SUMMARY
[0005] The present application proposes a new treatment target and its application for the drug resistance problem existing in the treatment of relapsed refractory multiple myeloma.
[0006] In order to achieve the above purpose, the present application is realized by adopting the following technical scheme: The present application proposes MetAP2 protein as a target for preparing or screening drugs for reducing the drug resistance of multiple myeloma cells to bortezomib.
[0007] The present application proposes a substance for detecting the mRNA and protein expression levels of MetAP2 in MM.1S-BR, H929-BR and 8226-BR cell lines for preparing or screening a substance for predicting the degree of drug resistance of multiple myeloma.
[0008] The present application proposes MetAP2 protein as a target for preparing or screening products for reducing the tumor load of multiple myeloma.
[0009] The present application proposes a substance for inhibiting or knocking down the expression amount of MetAP2 protein for preparing or screening drugs for reducing the growth of multiple myeloma.
[0010] The present application proposes that the substance for inhibiting or knocking down the expression amount of MetAP2 protein is shRNA, the target sequence is GCAGAAGCACATCGACAAGTT, the forward primer is 5'-CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG-3', and the reverse primer is 3'-GGCCCGTCTTCGTGTAGCTGTTCAAGAGCTCTTGAACAGCTACACGAAGACGAAAAAC-5'.
[0011] Another aspect of the present application provides that the substance for inhibiting or knocking down the expression amount of MetAP2 protein is CRISPR / Cas9 sgRNA, the target sequence is UAUUUUAUUUUGAUCAGCAG, the forward primer is 5'-caccgTATTTTATTTTGATCAGCAG-3', and the reverse primer is 3'-cCTGCTGATCAAAATAAAATAcaaa-5'.
[0012] The present application aims to develop a new efficient molecular target for bortezomib resistance of multiple myeloma by targeting MetAP2, which has great clinical significance and transformation value.
[0013] The present application first establishes a bortezomib-resistant myeloma cell line. The results show that the bortezomib-resistant cell line has enhanced tolerance to bortezomib and increased half-inhibitory concentration of bortezomib.
[0014] The present application detects the mRNA and protein expression levels of MetAP2 in bortezomib-resistant (BTZ resistance, BR-) myeloma cell lines. The results show that the mRNA and protein expression levels of MetAP2 in MM.1S-BR, H929-BR and 8226-BR resistant cell lines are increased.
[0015] The present application further detects the effect of changing the expression of MetAP2 in myeloma cell lines on bortezomib resistance. First, plasmids overexpressing and knocking down MetAP2 are successfully constructed, and the overexpression and knockdown effects are verified in myeloma cell lines. The results show that overexpression of MetAP2 enhances the resistance of tumor cells to BTZ, and knockdown of MetAP2 enhances the sensitivity of tumor cells to BTZ.
[0016] Compared with the prior art, the present application has the advantages and positive effects that: The present application proposes MetAP2 as a new efficient molecular target for developing bortezomib resistance of multiple myeloma, and further detects and verifies the effect of changing the expression of MetAP2 in myeloma cell lines on bortezomib resistance. It provides a new solution for inhibiting tumor growth and improving drug resistance of multiple myeloma, which has great clinical significance and transformation value. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 To construct a BTZ-resistant myeloma cell line. Among them, Figure 1 A is to verify the drug resistance of BR-MM.1S to BTZ, which reduces the apoptosis in 10mM BTZ; Figure 1 B is to verify the drug resistance of BR-H929 to BTZ, which reduces the apoptosis in 10mM BTZ;Figure 1 C. To verify the BTZ resistance of BR-8226, reduced apoptosis in 10 mM BTZ; Figure 1 D. To compare the IC50 of BR-MM.1S and WT-MM.1S to BTZ; Figure 1 E. To compare the IC50 of BR-H929 and WT-H929 to BTZ; Figure 1 F. To compare the IC50 of BR-8226 and WT-8226 to BTZ.
[0018] Figure 2 To detect the expression of MetAP2 in BTZ-resistant myeloma cell lines. Wherein, Figure 2 A. To detect the mRNA level of MetAP2 in MM.1S, H929 and 8226-WT / BR cell lines; Figure 2 B. To detect the protein expression level of MetAP2 in MM.1S, H929 and 8226-WT / BR cell lines.
[0019] Figure 3 To detect the effect of MetAP2 on the tolerance of myeloma cells to BTZ. Wherein, Figure 3 A. To detect the overexpression effect of MetAP2 in myeloma cells by Western blot; Figure 3 B. To detect the IC50 of myeloma cell lines overexpressing MetAP2 to BTZ; Figure 3 C. To quantify Figure 3 IC50 in B; Figure 3 D. To detect the knockdown effect of MetAP2 in myeloma cells by Western blot; Figure 3 E. To detect the IC50 of myeloma cell lines with knockdown of MetAP2 to BTZ; Figure 3 F. To quantify Figure 3 IC50 in E.
[0020] Figure 4 To explore the effect of overexpression / knockdown of MetAP2 on tumor progression using MM mouse models. Wherein, Figure 4 A. To detect the effect of BTZ treatment on tumor volume in MetAP2 knockdown group in MM subcutaneous tumor model; Figure 4 B. To detect the effect of BTZ treatment on survival of mice in MetAP2 knockdown group in MM subcutaneous tumor model; Figure 4 C. To detect the effect of BTZ treatment on tumor volume in MetAP2 overexpression group in MM subcutaneous tumor model; Figure 4 D. To detect the effect of BTZ treatment on survival of mice in MetAP2 overexpression group in MM subcutaneous tumor model; Figure 4 E. To construct a schematic diagram of 5TGM1 MM mouse model;Figure 4 F is the change of survival time of MetAP2 knockdown group mice in 5TGM1 MM mouse model; Figure 4 G is the change of bone destruction of MetAP2 knockdown group mice in 5TGM1 MM mouse model, including bone volume fraction statistics, BV / TV: percentages of bone volume density; trabecula thickness statistics, Tb.Th: trabecula thickness; trabecula number statistics, Tb.N: trabecula numbers; trabecula separation statistics, Tb.Sp: trabecula separation. DETAILED DESCRIPTION
[0021] In order to enable the above-mentioned objects, features and advantages of the present application to be more clearly understood, the following further describes the present application with specific examples. It should be noted that the examples of the present application and the features in the examples can be combined with each other without conflict.
[0022] In the following description, many specific details are set forth in order to provide a thorough understanding of the present application. However, the present application can be practiced in a variety of ways beyond the specific details set forth herein, and, accordingly, the present application is not limited to the specific embodiments disclosed below.
[0023] The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0024] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified, and the percentage of substances not specifically mentioned in the following examples is mass percentage.
[0025] The sources of some experimental materials or the methods of data processing are as follows, and the remaining experimental equipment not specifically mentioned is conventional reagent for biological field experiments.
[0026] The multiple myeloma cell lines include MM.1S (item number: 1101HUM-PUMC000680), H929 (item number: 4201HUM-CCTCC00300), 8226 (item number: 1101HUM-PUMC000083) purchased from National Experimental Cell Resource Sharing Platform (Beijing), and 5TGM1 (item number: CC9099) purchased from Guangzhou Sailuk Biological Technology Co., Ltd. The cells are cultured in RPMI-1640 medium (gbico) containing 15% fetal bovine serum, 100 U / mL penicillin, 0.1 mg / mL streptomycin, and 2 mM L-glutamine.
[0027] Real time PCR identification of MetAP2 mRNA levels in drug-resistant cell lines: mRNA levels of target genes were detected by qPCR (ABI, Q3 real time PCR instrument) to detect changes in transcription levels in wild-type and drug-resistant MM.1S, H929, and 8226 cell lines; gene primers were synthesized by Huada Gene Co., Ltd., and the sequences were as follows: MetAP2: forward primer 5'-CGTAATGAGCTGGATCAAGCCTG-3', reverse primer 5'-CATCCAGTAGGAAATGCCAGGC-3'. Relative expression was calculated using 2 -ΔΔCt Method calculation. The SYBR qPCR Master Mix used was purchased from Vazyme, item number Q312-02.
[0028] Antibodies: METAP2 (D3I1H) monoclonal antibody (Cell Signaling Technology, item number: 12547); Beta Actin monoclonal antibody (proteintech, item number: 66009-1-Ig).
[0029] Experimental animals: 6-8 week old sex-matched C57BL / 6J wild-type mice and NSG immunodeficient mice were purchased from Beijing Sperbio Biotechnology Co., Ltd.
[0030] BTZ: Selleck, S1013.
[0031] CCK8: MCE, HY-K0301.
[0032] Annexin V-FITC apoptosis detection kit (including Annexin V FITC, PI, 1x Binding Buffer): Biyun Tian, C1062S.
[0033] Data analysis: all data were performed in triplicate, and the results were expressed as mean ± standard error (mean ± SEM). Student's t-test was used for analysis of differences between groups. P value <0.05 was considered statistically significant.
[0034] Example 1 Construction of BTZ-resistant myeloma cell lines.
[0035] The drug-resistant cells were induced according to the BTZ concentration gradient of 0.5, 1, 2, 3, 4, 5, and 10 nM. After six months, the change in IC50 of the cells to BTZ was detected. The constructed MM drug-resistant cell lines and the parent cells were treated with 10 nM high concentration of BTZ at the same time, and after 48 h, the cells were stained with Annexin V-FITC and PI, and the apoptosis rate was detected by flow cytometry.
[0036] The specific steps are as follows: 1. Flow cytometry detection of apoptosis Cell preparation: collect cells by digestion, wash with PBS buffer (pH 7.2-7.4), then resuspend the cells to a concentration of 10^6 / mL with 1x Binding Buffer. Staining: take 100 μL of cell suspension, add 5 μL of Annexin V FITC and PI, mix gently, and react at room temperature for 15 minutes in the dark. After the reaction is complete, add 400 μL of 1x Binding buffer to make the total volume of the sample tube 500 μL. After staining is complete, complete the flow cytometry detection within 1 hour to ensure the accuracy and reliability of the data.
[0037] 2. CCK-8 experiment Culture MM.1S / H929 / 8226-WT and MM.1S / H929 / 8226-BR, count the cells, inoculate 10,000 cells into a 96-well plate, add a gradient concentration of BTZ for treatment, culture for 24 h, and detect the absorbance at 450 nm with a microplate reader. Collect data and analyze cell proliferation.
[0038] The results show that the BR-MM.1S / H929 / 8226 cell line is successfully constructed, and the BR cells enhance the tolerance to BTZ (as shown in Figure 1 A-C); the IC50 value of BR-MM.1S / H929 / 8226 to BTZ is increased (as shown in Figure 1 D-F).
[0039] Example 2 Detect the expression of MetAP2 in BTZ-resistant myeloma cell lines.
[0040] Construct the BR-MM.1S / H929 / 8226 cell line, and detect the mRNA and protein levels of MetAP2 compared with the wild-type cells.
[0041] The specific steps are as follows: 1. qPCR First, collect cells and add TRIzol reagent (Invitrogen, 15596018CN) for complete lysis. Then, add chloroform, shake vigorously, and centrifuge to separate the solution into three layers. Carefully pipette the colorless aqueous phase (containing RNA) from the top layer into a new tube, mix with an equal volume of isopropanol, and centrifuge to obtain the RNA precipitate at the bottom of the tube. Wash the precipitate with 75% ethanol, dry briefly, and finally dissolve the precipitate with RNase-free water to obtain the cell RNA, which is then detected for concentration and purity. Reverse transcribe the RNA into cDNA using a reverse transcription reagent (abm, G592) according to the procedure (25°C for 10 min, 42°C for 15 min, 85°C for 5 min, 4°C). Add qPCR primers (forward primer 5'-CGTAATGAGCTGGATCAAGCCTG-3', reverse primer 5'-CATCCAGTAGGAAATGCCAGGC-3'), qPCR mix (Vazyme, product code Q312-02), and load the reaction system into a thermal cycler. Perform PCR cycles according to the set procedure (95°C for 10 min, [95°C for 15 s, 60°C for 60 s] x 40, [95°C for 15 s, 60°C for 1 min, 95°C for 30 s, 60°C for 15 s], 37°C for 5 min), including DNA denaturation, primer binding, amplification, and fluorescence signal detection. Finally, analyze the qPCR results.
[0042] 2. Western Blot The core of Western Blot is to separate proteins by molecular weight using the principle of antigen-antibody specific binding. First, extract the protein sample and determine the concentration. Then, separate proteins of different molecular weights by SDS-PAGE gel electrophoresis. Next, transfer the proteins in the gel to a PVDF membrane by membrane transfer. Then, block the membrane with blocking solution (5% skim milk) at room temperature for 1 hour to block non-specific binding sites. After blocking, incubate the membrane with specific primary antibody MetAP2 and β-actin overnight at 4°C, and then incubate with HRP-labeled secondary antibody (Jackson Lab, 111-035-003; 115-035-003). Finally, develop using a chemiluminescent substrate, and collect and analyze the signal using an imaging system.
[0043] The results show that the MetAP2 transcription level of drug-resistant myeloma cells is higher than that of the control group (as shown in Figure 2 A); the MetAP2 protein level of drug-resistant myeloma cells is higher than that of the control group (as shown in Figure 2 B).
[0044] Example 3 Detect the effect of MetAP2 on the tolerance of myeloma cells to BTZ.
[0045] After overexpression / knockdown of MetAP2 in myeloma cells, gradient concentrations of BTZ were added for treatment, and CCK8 was used to detect the survival of tumor cells.
[0046] The specific steps are as follows: 1. Construction of MetAP2 overexpression plasmid First, obtain the target gene: Extract the RNA of HEK293T cells, obtain cDNA by reverse transcription, as a model, obtain the MetAP2 target gene by PCR, the primers are: forward primer 5'-CGGGATCCATGGCGGGTGTGGAGGAGGT-3', reverse primer 5'-ACGCGTCGACTTAATAGTCATCTCCTCTGC-3'.
[0047] Vector selection and preparation: Selection of overexpression vector: Select pITA vector, screening markers include ampicillin resistance (AmpR) for screening plasmid-containing bacteria; and puromycin for cell screening, for lentivirus packaging, for MM cell infection.
[0048] Vector linearization: Use restriction endonuclease BamHI and SalI to double digest the plasmid vector, open the plasmid at the multiple cloning site to produce sticky ends matching the ends of the target gene.
[0049] Connection of target gene and vector: Recover and purify the linearized vector and the PCR-amplified target gene fragment by agarose gel electrophoresis. Mix the vector and the insert fragment at a molar ratio of 1:7. Use T4 DNA ligase (NEB, M0202S) and use the PCR instrument to set 16°C for overnight ligation. Connect the target gene to the vector backbone to form a complete, circular overexpression plasmid.
[0050] Transformation of ligation product into competent cells: Add the ligation product to high transformation efficiency competent E. coli, and use heat shock method to make the plasmid enter the bacteria. Spread the transformed bacteria on LB agar plates containing ampicillin and incubate at 37°C overnight. Only bacteria successfully transformed with plasmid can grow on antibiotic plates to form single colonies.
[0051] Positive clone screening and identification: 30-50 single clone colonies were picked from the plate and cultured in a small scale. Plasmid extraction was performed (Sangon, AD0102-A). After extraction, the plasmid was digested with restriction enzymes BamHI and Sail. The agarose gel electrophoresis was used to detect whether the vector and the inserted fragment with the expected size were contained.
[0052] Sequencing verification: The plasmid preliminarily identified as positive was sent for sequencing. The universal sequencing primer on the vector was used to ensure that the sequence of the target gene was completely correct and no mutation, deletion or frame shift occurred.
[0053] Plasmid extraction and preservation: The positive clone verified by sequencing was cultured in a large scale. The high-purity and high-concentration plasmid DNA was extracted (Tiangen, DP117). The plasmid was divided and stored at -20°C or -80°C for long-term preservation, which was used for subsequent cell transfection and other experiments.
[0054] 2. Construction of MetAP2 knockdown plasmid Primer design: The pLKO.1 vector was used to construct the knockdown plasmid. The primer of shMetAP2 was designed. Forward primer: 5'-CCGGGCAGAAGCACATCGACAAGTTCTCGAGGCAGAAGCACATCGACAAGTTTTTTTG-3', reverse primer: 5'-AATTCAAAAAGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGC.
[0055] Oligo annealing system and procedure: System: forward primer 100 μM, 1 μL, reverse primer 100 μM, 1 μL, 10x buffer (TakaRa, SD0303) 2 μL, ddH2O 16 μL.
[0056] Procedure: 95°C 5 min, 37°C 90 min, 25°C 10 min, 4°C keep.
[0057] Vector pLKO.1 digestion system and procedure: System: vector 3 μg, EcoRI 1 μL, AgeI 1 μL, CutSmart buffer (NEB, B7204S) 5 μL, ddH2O to 50 μL.
[0058] Program: incubate in PCR instrument for 3 hours at 37℃, perform agarose gel electrophoresis (1%), two theoretical bands, about 2 kb and 7 kb, discard the 2 kb band, and the 7 kb band is used for subsequent use, and gel recovery (Vazyme, DC301) is performed.
[0059] Vector and target fragment connection system and program: System: 100 ng of recovered vector obtained in the previous step, 2.5 μL of annealed product, 1 μL of T4 ligase (NEB, M0202S), 1 μL of 10×T4 buffer, and ddH2O to 10 μL.
[0060] Program: use the PCR instrument with a hot lid temperature of 50℃, and incubate at 16℃ for 1 hour.
[0061] Finally, perform transformation, pick single colony bacteria, use LB liquid medium with added ampicillin for small-scale shaking culture, and use small plasmid extraction (Sikaojie, AD0102-A) to extract the plasmid. After extracting the plasmid, perform double enzyme digestion verification with restriction enzymes EcoRI and AgeI, and detect whether it meets the theoretical size by agarose gel electrophoresis. Select the plasmid for company sequencing analysis and cell level verification.
[0062] 3. Lentivirus packaging and infection of MM cells First, use HEK293T cells in a 10 cm cell culture dish for lentivirus packaging. Packaging system: psPAX2 6 μg, pMD2G 4 μg, target plasmid 8 μg, opti-MEM 500 μL, PEI transfection reagent 90 μL (5 times the total plasmid), gently mix, then stand at room temperature for 15 min, then slowly add drop by drop to the cell culture medium, and perform cell replacement after 4-6 hours. Replace with fresh cell culture medium with serum. Collect cell supernatant (lentivirus supernatant) at 24 hours and 48 hours after transfection. Mix the collected supernatant, centrifuge at 2000 rpm for 10 min at room temperature, remove the cell debris in the supernatant, then use a 0.45 μm needle filter (SORFA, 622120) for filtration. Mix the filtered virus with 40% PEG8000 at a ratio of 3:1, the final concentration of PEG8000 is 10%, and place it in a 4 degree horizontal shaker for slow shaking overnight. The next day, centrifuge the supernatant at 4000 rpm for 1 hour at 4℃, discard the supernatant, and resuspend the precipitate with serum-free medium to concentrate it 100 times. After the virus is aliquoted, it is stored at -80 for use. Add an appropriate amount of virus to the supernatant of the MM cells to be infected, replace the fresh medium after 12 hours of virus infection, continue to culture for 48 hours, then use puromycin for resistance screening for 2 weeks, and obtain infected MM cells for experimental detection.
[0063] 4. Determination of the half maximal inhibitory concentration of BTZ on MM cells MM cells stably overexpressing (lentivirus infection) MetAP2 and MM cells knockdown (lentivirus infection) MetAP2 were plated into 96-well plates, and gradient concentrations of BTZ were added, with 6 replicates in each group. After 24 hours of action, CCK8 (MCE, HY-K0301) was added and incubated at 37°C for 1 hour. The absorbance at 450 nm was measured using a microplate reader, and IC50 curves were prepared for quantitative analysis.
[0064] The results show that overexpression of MetAP2 in myeloma cells increases the half maximal inhibitory concentration of BTZ on tumor cells (as shown in Figure 3 A-C); and knockdown of MetAP2 in myeloma cells reduces the half maximal inhibitory concentration of BTZ on tumor cells (as shown in Figure 3 D-F).
[0065] Example 4 The effect of overexpression / knockdown of MetAP2 on tumor progression was explored using a MM mouse model.
[0066] A MM subcutaneous tumor model was established using MetAP2 knockdown / overexpressing myeloma cell lines. Intraperitoneal injection of 0.5 mg / kg BTZ was started at the third week of model establishment, with twice a week for three weeks. Changes in subcutaneous tumor volume and mouse survival were detected. A MetAP2-KD5TGM1 myeloma cell line was injected into the bone marrow cavity of C57BL / KaLwRij MM mice. Intraperitoneal injection of 0.5 mg / kg BTZ was started at the third week of model establishment, with twice a week for two weeks. Changes in mouse survival and bone destruction relief were observed.
[0067] The specific steps are as follows: 1. Establishing a MM subcutaneous tumor mouse model 1 x 10 ^6 MM.1S myeloma cells with knockdown / overexpression of MetAP2 were transplanted subcutaneously into immunodeficient mice (NSG) to grow into measurable tumor masses for subsequent BTZ efficacy evaluation and survival analysis.
[0068] 2. Establishing a MM mouse model injected into the bone marrow cavity 1 x 10 ^6Knockdown MetAP2 5TGM1 myeloma cells are injected into the bone marrow cavity of C57BL / KaLwRij mice in situ, and the model is established in the third week. Start injecting 0.5 mg / kg BTZ intraperitoneally, twice a week, for two weeks. Survival analysis is performed, and the bone destruction is detected by Skyscan 1276 micro-CT system, including bone volume fraction histogram, BV / TV: percentages of bone volume density; trabecular thickness histogram, Tb.Th: trabecula thickness; trabecular number histogram, Tb.N: trabecula number; and trabecular separation histogram, Tb.Sp: trabecula separation.
[0069] The results show that in the MM subcutaneous tumor model, the MetAP2 knockdown group has slower tumor growth (as shown in Figure 4 A), longer survival (as shown in Figure 4 B), the MetAP2 overexpression group has faster tumor growth (as shown in Figure 4 C), and shorter survival (as shown in Figure 4 D); in the 5TGM1 bone marrow cavity injection model, the MetAP2 knockdown group has longer survival (as shown in Figure 4 E-F), increased bone volume fraction, trabecular thickness, and trabecular number, and reduced trabecular separation (as shown in Figure 4 G).
[0070] The above is only a preferred embodiment of the present application, and is not intended to limit the present application in other forms. Any person skilled in the art can use the disclosed technical content to make changes or modifications to equivalent embodiments applied to other fields, but any simple modification, equivalent change, and modification of the above embodiments made in accordance with the technical essence of the present application, without departing from the technical solution content of the present application, still belongs to the protection scope of the present application.
Claims
1. Application of MetAP2 protein as a target in preparation or screening of drugs for reducing the drug resistance of multiple myeloma cells to bortezomib.
2. Application of substances for detecting the mRNA and protein expression levels of MetAP2 in MM.1S-BR, H929-BR and 8226-BR cell lines in preparation or screening of substances for predicting the drug resistance degree of multiple myeloma.
3. Application of MetAP2 protein as a target in preparation or screening of products for reducing the tumor load of multiple myeloma.
4. Application of substances for inhibiting or knocking down the expression of MetAP2 protein in preparation or screening of drugs for reducing the growth of multiple myeloma.
5. The use according to claim 2, characterized in that, The substance for inhibiting or knocking down the expression of MetAP2 protein is shRNA, the target sequence is GCAGAAGCACATCGACAAGTT, the forward primer is 5'-CCGGGCAGAAGCACATCGACAAGTTCTCGAGAACTTGTCGATGTGCTTCTGCTTTTTG-3', and the reverse primer is 3'-GGCCCGTCTTCGTGTAGCTGTTCAAGAGCTCTTGAACAGCTACACGAAGACGAAAAAC-5'.
6. Use according to claim 2, characterized in that, The substance for inhibiting or knocking down the expression of MetAP2 protein is CRISPR / Cas9 sgRNA, the target sequence is UAUUUUAUUUUGAUCAGCAG, the forward primer is 5'-caccgTATTTTATTTTGATCAGCAG-3', and the reverse primer is 3'-cCTGCTGATCAAAATAAAATAcaaa-5'.