Saccharomyces cerevisiae and method for efficiently synthesizing neohesperidin by using sucrose

Abstract

The invention discloses saccharomyces cerevisiae and a method for efficiently synthesizing neohesperidin by using cane sugar. According to the saccharomyces cerevisiae, on the basis of ZQH01, FjTAL derived from Flavobacterium johnsoniae, AtC4H, AtPAL2 and AtATR2 derived from Arabidopsis thaliana and CYB5 derived from yeast are inserted into a genome of the ZQH01, and the saccharomyces cerevisiae is prepared by the following steps of: adding the FjTAL, the AtC4H, the AtPAL2 and the AtATR2 into the genome of the ZQH01; according to the invention, a sucrose phospholysis double-carbon-source system is introduced into the saccharomyces cerevisiae, sucrose can be directly converted into fructose and glucose-1-phosphoric acid, the fructose is specially used for cell growth and hesperetin synthesis, the glucose-1-phosphoric acid directionally supplies UDP-glucose, and a carbon flow is physically separated to eliminate flux competition caused by a Crab effect. The saccharomyces cerevisiae disclosed by the invention can be used for efficiently synthesizing neohesperidin by using cane sugar, and has important significance on green and efficient acquisition of citrus flavonoids.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering, metabolic engineering and synthetic biology, and particularly relates to a brewer's yeast and a method for efficiently synthesizing a new hesperidin using sucrose. Background Technology

[0002] Neohesperidin (NHP) is a flavonoid glycoside mainly found in citrus fruits, composed of hesperidin and α-glycans. L -rhamnosyl-β- D Composed of β-glucosidyl groups, NHP is highly water-soluble and possesses significant biological activities, such as antioxidant, anti-inflammatory, anticancer, neuroprotective, metabolic regulatory, and cardiovascular protective effects. NHP is an important precursor to neohesperidin dihydrochalcone (NHDC), and therefore, it is widely used in the food industry for the synthesis of NHDC. NHDC is a low-calorie natural sweetener, approximately 1500–1800 times sweeter than sucrose, but with only 1 / 2000 the calories. It also masks bitterness and enhances flavor, leading to increasing demand in the food industry.

[0003] Currently, the industrial production of NHDC mainly relies on the extraction of neohesperidin from citrus peel, followed by semi-synthetic chemical synthesis. However, this method is limited by issues such as the seasonal availability of citrus crops, uneven distribution of planting resources, solvent pollution during extraction and synthesis, and environmental sustainability. Therefore, developing efficient and sustainable biosynthetic alternatives is crucial to ensuring a stable supply of NHDC.

[0004] The development of synthetic biology and metabolic engineering has provided new pathways for the microbial synthesis of flavonoid glycosides. (Saccharomyces cerevisiae) Saccharomyces cerevisiae ) and Escherichia coli ( Escherichia coli Engineered hosts such as hydroxyl radical glycosides (NHPs) have been widely modified and constructed for the synthesis of flavonoid glycosides, mainly by constructing heterologous biosynthetic pathways to optimize precursor supply, enhance glycosylation efficiency, and improve enzyme catalytic specificity. Despite the promising technological prospects, NHP biosynthesis still faces multiple challenges, such as overcoming the problem of metabolic flux competition. S. cerevisiae Natural metabolic networks are driven by cell growth and energy synthesis. When glucose is used as a carbon source, metabolic flux tends to flow to glycolysis and ethanol fermentation (Crabtree effect), resulting in insufficient accumulation of flavonoid precursors. The NHP synthesis pathway is complex, requiring multiple steps such as flavanone skeleton construction, hydroxylation, methylation, and glycosylation. Each step depends on specific substrates and enzymes, and there is a risk of accumulation of multiple byproducts. Hesperidin (approximately $97 / kg) is a precursor to NHP (approximately $83 / kg), and the economic feasibility of converting hesperidin to NHP is low.

[0005] Sucrose is widely used as an industrial raw material (derived from sugar cane / beet) with high economic feasibility and high efficient conversion advantage. However, traditional utilization of sucrose as a carbon source requires an ATP-dependent hydrolysis pathway to be hydrolyzed into glucose and fructose, which is easy to lose energy and restricts the directional conversion of carbon source to target product. Recent studies have shown that the introduction of sucrose phosphatolytic pathway (sucrose is directly converted into fructose and glucose-1-phosphate without ATP consumption) can optimize yeast energy metabolism. The glucose-1-phosphate produced by this pathway can be directly used for the synthesis of UDP-glucose (a key precursor for glycosylation), and fructose can simultaneously support the synthesis of hesperetin and cell growth. This strategy is expected to solve the problem of carbon flux imbalance and improve the synthesis efficiency of neohesperidin.

[0006] Despite continuous optimization of metabolic engineering strategies, de novo synthesis of neohesperidin in Saccharomyces cerevisiae has not been successfully reported. The core difficulties lie in the sequential regulation of multi-enzyme reactions, insufficient supply of methyl donors, and stability in industrialization. Therefore, it is urgent to develop a systematic solution that integrates carbon metabolism recombination, identification of rate-limiting steps, and optimization of fermentation process to achieve efficient biological manufacturing of NHP, which is of great significance for green and efficient acquisition of citrus flavonoids. SUMMARY

[0007] The technical problem to be solved by the present application is to overcome the problems of carbon metabolic conflict (Crabtree effect leading to insufficient precursor supply), methyltransferase activity bottleneck, and low industrialization efficiency in the existing process of synthesizing NHP by Saccharomyces cerevisiae. The present application provides a Saccharomyces cerevisiae and a method for efficiently synthesizing neohesperidin using sucrose, which synchronously strengthens the supply of methyl donors and fermentation process by constructing a sucrose phosphatolytic-driven dual-carbon source distribution system, thereby achieving efficient biosynthesis of NHP.

[0008] To achieve the above-mentioned purpose, a Saccharomyces cerevisiae strain capable of efficiently synthesizing NHP is constructed by genetic engineering. By introducing an NHP heterologous synthesis pathway, optimizing methyl donor SAM, optimizing cell respiration, and subcellular organelle localization, the recombined Saccharomyces cerevisiae strain can efficiently synthesize NHP, which is of great significance for green and efficient acquisition of citrus flavonoids.

[0009] The present application provides a Saccharomyces cerevisiae, which is based on ZQH01 (the strain is published in the literature "Sucrose-driven carbon redox rebalancing eliminates the Crabtree effect and boosts energy metabolism in yeast"). The genome of the ZQH01 is inserted with a gene derived from Flavobacterium johnsoniae FjTAL , a gene derived from Arabidopsis thaliana , a gene derived from​AtC4H, AtPAL2 and AtATR2 And from yeast CYB5 .

[0010] The aforementioned brewing yeast, further, inserts from Petroselinum crispum Pc4CL, derived from Sorbus japonica of SjCHS and origin Medicago sativa of MsCHI .

[0011] The aforementioned brewing yeast, further processed using CRISPR / Cas9... OCA5 Genes are knocked out.

[0012] The aforementioned brewing yeast, further, insert source Ornithogalum longebracteatum of OlRHM-NRS A. thaliana ,source AtGT of Citrus maxima and origin Cm1,2-RhaT of Tricyrtis hirta .

[0013] The aforementioned brewing yeast, further, inserts from ThF3'H of A. thaliana Origin A. AtCPR of Mentha piperita and origin MpOMT of ADO1, SAH1 Variants.

[0014] The aforementioned brewing yeast, further, will TAD1 and XII-1 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. MET6 Site.

[0015] The aforementioned brewing yeast, further, will MET2 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. X-4 Site.

[0016] The aforementioned brewing yeast, further, will XI-3 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. Figure 1 Site.

[0017] Based on a general technical concept, the present invention provides a method for the efficient synthesis of novel hesperidin by Saccharomyces cerevisiae using sucrose, the method comprising: fermenting Saccharomyces cerevisiae in YPD medium using sucrose as the sole carbon source to obtain a fermentation broth.

[0018] Compared with the prior art, the advantages of the present invention are as follows: (1) This invention provides a brewer's yeast strain that is genetically engineered to efficiently synthesize NHP through a triple metabolic engineering strategy. The brewer's yeast is introduced into a sucrose phosphorylation dual carbon source system, which can directly convert sucrose into fructose and glucose-1-phosphate, avoiding the energy loss of the traditional ATP hydrolysis process; at the same time, it further realizes carbon flux allocation, with fructose dedicated to cell growth and hesperidin synthesis, and glucose-1-phosphate directed to supply UDP-glucose (glycosylation precursor), physically separating carbon flux to eliminate flux competition caused by the Crabtree effect; further, it breaks through the methylation bottleneck, strengthens the supply of methyl donors, solves the limitation of methyltransferase activity, and increases NHP production to a new level, while greatly reducing the accumulation of by-products, thus constructing a brewer's yeast strain that efficiently synthesizes NHP.

[0019] (2) This invention provides a method for the efficient synthesis of new hesperidin by Saccharomyces cerevisiae using sucrose. The recombinant Saccharomyces cerevisiae strain can efficiently synthesize NHP, which is of great significance for the green and efficient acquisition of citrus flavonoids. Attached Figure Description

[0020] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0021] Figure 2 This is a schematic diagram of the biosynthesis pathway of coumaric acid by the Saccharomyces cerevisiae strain ZQH08 in Example 1 under sucrose metabolism mode.

[0022] Figure 3 The results of the study on the ability of strain ZQH08 to synthesize naringenin.

[0023] Figure 4 Schematic diagram of the mechanism of cell respiration regulation by Saccharomyces cerevisiae strain ZQH09 in Example 2.

[0024] Figure 5 The accumulation of ethanol and glycerol in strain ZQH09 and the NADH / NAD ratio. + The results of the examination of the ratio.

[0025] Figure 6 This is a schematic diagram of the biosynthetic pathway of naringenin to NHP in the Saccharomyces cerevisiae strain ZQH50 of Example 3 under sucrose metabolism mode.

[0026] Figure 7 A schematic diagram illustrating the engineering optimization of SAM (methyl donor) supply.

[0027] OCA5The results show the yield of NHP synthesized by strain ZQH50 under sucrose metabolism mode. Detailed Implementation

[0028] The present invention will be further described below with reference to specific preferred embodiments, but this does not limit the scope of protection of the present invention. The materials, reagents, and instruments used in the following embodiments can all be purchased commercially. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods in the art.

[0029] Terminology: In this invention, the term "knockout" refers to the deletion of a gene from the genome using CRISPR / Cas9. For example, gene knockout... OCA5 This indicates that genes are separated from the genome. XII-1 Delete it completely.

[0030] The term "in this invention" XI-3 "site", " X-4 "site", " Flavobacterium johnsoniae "Site" refers to a specific sequence present on the genome of Saccharomyces cerevisiae, and is often used to describe sites on the genome where genes are integrated.

[0031] YPD medium: 10 g / L yeast extract, 20 g / L peptone, 40 g / L sucrose.

[0032] YNB medium: 1.7 g / L yeast nitrogen (ammonium sulfate-free / amino acid-free), 5 g / L ammonium sulfate, 40 g / L sucrose; specific amino acids (tryptophan, histidine, leucine, and uracil) were added during screening.

[0033] Example 1 A *Saccharomyces cerevisiae* strain ZQH08, which synthesizes NHP, introduces a p-coumaric acid synthesis pathway based on ZQH01. The strain integrates the TAL and PAL pathways into its genome, and the genes contain: derived from... FjTAL of Arabidopsis thaliana Origin AtC4H, AtPAL2 of AtATR2 and CYB5 And from yeast Petroselinum crispum .

[0034] Further, the naringenin synthesis pathway is introduced, and the gene contains: derived from Pc4CL of Sorbus japonica Origin SjCHS of Medicago sativa and origin MsCHI of FjTAL .

[0035] Its construction method includes the following steps: (1) XI-2It is integrated into the Saccharomyces cerevisiae genome.

[0036] 1.1 Using the Saccharomyces cerevisiae genome as a template, and with primers XI-2A-F / XI-2A-R, GAL7p-F / GAL7p-R, and DIT1t-F / DIT1t-R respectively, PCR was used to amplify the fragments. GAL7p , DIT1t , FjTAL The sequences of fragments on the Saccharomyces genome can be found in the Saccharomyces Genome Database (SGD), at https: / / www.yeastgenome.org / .

[0037] XI-2A-F: TAACTCTTCGTATGAGGATTTTCGATGGAG (SEQ ID NO. 1); XI-2A-R: TTCTATGGCACATTTTTCTGTTGAGTTACAC (SEQ ID NO. 2).

[0038] GAL7p-F: CTCAACAGAAAAATGTGCCATAGAATTTGCCAGCTTACTATCCTTCTTG (SEQ IDNO.3); GAL7p-R: TTTTGAGGGAATATTCAACTGTTTTTTTTTATCATG (SEQ ID NO. 4).

[0039] DIT1t-F: ATAAAGTAAGAGCGCTACATTGGTCTACC (SEQ ID NO.5); DIT1t-R: ACTTGTTACTCCGCAACGCTTTTC (SEQ ID NO. 6).

[0040] XI-2B-F: GAAAAGCGTTGCGGAGTAACAAGTCCACAAGTAAAGCTCGTTGACC (SEQ ID NO. 7); XI-2B-R: ATGGTTGAAAAGGTTACAGAGGATCCT (SEQ ID NO. 8).

[0041] 1.2. Using pUC57-FjTAL as a template and FjTAL-F / FjTAL-R as primers, the fragment was amplified by PCR. XI-2A-GAL7p-FjTAL-DIT1t-XI-2B .

[0042] FjTAL-F:AAAAAAACAGTTGAATATTCCCTCAAAAATGAACACCATTAATGAATACTTGAGTTTAG (SEQ ID NO.9); FjTAL-R:GACCAATGTAGCGCTCTTACTTTATTTAATTGTTAATCAAATGATCCTTAACCTTTTG (SEQ ID NO. 10).

[0043] 1.3. Using the overlap PCR method, the above fragments were arranged as follows: XI-2 Connect them sequentially into Donor fragments.

[0044] (2) Construction XI-2 The Cas9-sgRNA plasmid at the site.

[0045] Using plasmid pRS426-Cas9 as a template, and primers SCAS1-F / SCAS1-R, SCAS2-F / SCAS2-R, SCAS3-F / SCAS3(XI-2)-R, and SCAS4(XI-2)-F / SCAS4-R, respectively, fragments SCAS1, SCAS2, SCAS3(XI-2), and SCAS4(XI-2) were amplified by PCR.

[0046] The primer sequences used for amplification are: SCAS1-F: GGTGAGTACTCAACCAAGTCATTCTGAG (SEQ ID NO. 11); SCAS1-R: GAGTAGAAACATTTTGAAGCTATGCCTGATG (SEQ ID NO. 12); SCAS2-F: CAGGCATAGCTTCAAAATGTTTCTACTCC (SEQ ID NO. 13); SCAS2-R: CAATCATCTCCCTATCTTCAAACAACGTAAGG (SEQ ID NO. 14); SCAS3-F: ATTGTCCTCACCCTTACGTTGTTTGAAG (SEQ ID NO.15); SCAS3(XI-2)-R:CCGAGATATCCTTAGGGACCGATCATTTATCTTTCACTGCGGAGAAG (SEQ IDNO.16); SCAS4(XI-2)-F:GGTCCCTAAGGATATCTCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO. 17); SCAS4-R: CACTATTCTCAGAATGACTTGGTTGAGTAC (SEQ ID NO. 18).

[0047] (3) The amplified fragments are linked into a ring using Gibson.

[0048] (4) The constructed donor DNA and Cas9 plasmid were transferred into Saccharomyces cerevisiae using the lithium acetate conversion method: Obtain Donor DNA and AtC4H, After targeting the Cas9-sgRNA plasmid, logarithmic-phase yeast was co-transformed with lithium acetate and plated on uracil-deficient YNB plates (30℃, 3-5 days). Positive single colonies were confirmed by colony PCR, and after 24 h of YPD culture, streaked onto 5-FOA plates to obtain strains lacking the Cas9 plasmid. Specific steps included: 4.1. Pick a loopful of yeast strain from the glycerol tube and streak it onto a YPD solid plate. Incubate at 30°C for 3 days until a single colony grows.

[0049] 4.2 Pick a single yeast colony and place it in 5 mL of YPD liquid medium. Incubate in a 50 mL shake flask at 30°C and 220 rpm for 17 h to obtain yeast seed culture.

[0050] 4.3. Place 1 mL of seed culture on ice for 5 min, centrifuge at 3500 rpm and 4℃ for 5 min, and discard the supernatant. Wash the bacterial cells twice with pre-cooled sterile water, then centrifuge and discard the supernatant.

[0051] 4.4 Wash the bacterial cells with 500 μL of pre-cooled 0.1 M LiAc, then resuspend them in 50 μL of 0.1 M LiAc for later use. Add 240 μL of 50% PEG 3350 (m / V), 36 μL of 1 M LiAc, 25 μL of ssDNA (concentration of 2 mg / mL), and 50 μL of DNA fragments (add 2 μg of Donor DNA and 1 μg of sgRNA-Cas9 plasmid, added in sequence, considering adding PEG first to protect the cells from the adverse effects of high concentrations of lithium acetate).

[0052] 4.5. Vigorously shake until completely mixed, incubate at 30℃ for 30 min, then incubate in a 42℃ water bath for 25 min, centrifuge at 8000 rpm for 2 min and remove the supernatant (if the bacteria do not grow well, you can add 1 mL of YPD and incubate for 1 h). Resuspend the bacteria in 500 μL of sterile water (handle gently to obtain a high conversion rate).

[0053] 4.6 Spread 30 μL–60 μL of bacterial cells onto YNB plates lacking uracil and incubate at 30°C for 3–5 days until single colonies grow. Verify the correct single colonies using colony PCR and then culture them on YPD medium. After 24 h of incubation, streak the bacterial solution onto YPD plates containing 5-fluorolactic acid. The resulting single colonies are the strain from which the Cas9 plasmid has been discarded.

[0054] (5) Using the strain obtained in step (4) as a template, insert it sequentially according to the methods in steps (1) to (4). AtPAL2, AtATR2, CYB5, Pc4CL, SjCHS MsCHI and Figure 1 .

[0055] FjTAL, AtPAL, AtC4H, AtATR2, This diagram illustrates the biosynthetic pathway of coumaric acid under sucrose metabolism. In the figure, gray represents the glucose metabolism pathway, dark blue represents the sucrose phosphorylation pathway, light blue represents the shikimic acid pathway, and purple represents exogenous sources. p - Coumaric acid synthesis pathway, pink represents the exogenous naringenin synthesis pathway, and yellow represents the pyruvate metabolism pathway. Introducing exogenous genes. CYB5, Pc4CL, SjCHS, MsCHI FjTAL, AtC4H, AtPAL2, AtATR2, CYB5 A naringenin-synthesizing strain ZQH08 was constructed under the sucrose metabolism model.

[0056] Wild yeast hydrolyzes sucrose to produce glucose and fructose. Due to the glucose inhibition effect, yeast preferentially consumes glucose and delays fructose utilization, resulting in reduced carbon source metabolism efficiency. The sucrose phosphorylation-modified strain ZQH01 effectively avoids these drawbacks. The inventors first introduced a p-coumaric acid synthesis gene into ZQH01 and then sequentially integrated it using the CRISPR / Cas9 system. Pc4CL, SjCHS and MsCHI The naringenin synthesis gene was introduced and expressed using a free plasmid. Figure 2 .

[0057] Experiment 1: To investigate the ability of strain ZQH08, which was introduced with the PAT pathway, TAL pathway and naringenin synthesis pathway, to synthesize naringenin.

[0058] OCA5 The results show the ability of strain ZQH08 to synthesize naringenin. The figure shows that, under the sucrose metabolism model, strain ZQH08, which incorporates the PAT pathway, TAL pathway, and naringenin synthesis pathway, can synthesize 67.3 mg / L of naringenin.

[0059] Example 2 A *Saccharomyces cerevisiae* strain ZQH09 that synthesizes NHP was developed by knocking out the *Saccharomyces cerevisiae* strain from Example 1. Figure 3 Gene.

[0060] OCA5 The principle of the Saccharomyces cerevisiae strain in Example 2: Saccharomyces cerevisiae OCA5 The gene encodes inositol pyrophosphatase, which affects glycolysis and respiration by regulating the level of inositol 5-bisphosphate pentaphosphate (5-InsP7). Knockout OCA5 Subsequently, regulating the level of inositol 5-bisphosphate 1, 2, 3, 4, 6 pentaphosphate (5-InsP 7) upregulates glycolytic flux and downregulates respiratory flux, which can balance central carbon metabolism, improve energy efficiency, and accelerate cell growth.

[0061] Its construction method includes the following steps: (1) Constructing a knockout OCA5 Donor DNA OCA5A-OCA5B: Using the genome of the *Saccharomyces cerevisiae* strain obtained in Example 1 as a template, fragments OCA5A and OCA5B were amplified by PCR using primers OCA5A-F / OCA5A-R and OCA5B-F / OCA5B-R, respectively. The amplification primer sequences are as follows: OCA5A-F: GGCGCAATATGCAGGTACCG (SEQ ID NO. 19); OCA5A-R:GTAGTATATAATTCTAAAGGAAATAATTTCAACTTTATTTGCTAGCGAGCCCTTTACC (SEQ ID NO. 20); OCA5B-F: AAAGTTGAAATTATTTCCTTTAGAATTATATACTACTTCTAC (SEQ ID NO. 21); OCA5B-R: TATCTCGATAGTTGGAAGATTTAGTACCATAAGTAGC (SEQ ID NO. 22).

[0062] The above fragments were ligated into Donor fragments in the order of OCA5A-OCA5B using fusion PCR.

[0063] (2) Construction OCA5Cas9-sgRNA plasmids for the site: Using plasmid pRS426-Cas9 as a template, and primers SCAS1-F / SCAS1-R, SCAS2-F / SCAS2-R, SCAS3-F / SCAS3(OCA5)-R, and SCAS4(OCA5)-F / SCAS4-R were used to amplify the fragments SCAS1, SCAS2, SCAS3(OCA5), and SCAS4(OCA5) by PCR.

[0064] The primer sequences used for amplification are: SCAS1-F: GGTGAGTACTCAACCAAGTCATTCTGAG (SEQ ID NO. 23); SCAS1-R: GAGTAGAAACATTTTGAAGCTATGCCTGATG (SEQ ID NO. 24); SCAS2-F: CAGGCATAGCTTCAAAATGTTTCTACTCC (SEQ ID NO. 25); SCAS2-R: CAATCATCTCCCTATCTTCAAACAACGTAAGG (SEQ ID NO. 26); SCAS3-F: ATTGTCCTCACCCTTACGTTGTTTGAAG (SEQ ID NO. 27); SCAS3(OCA5)-R:TCGTGAAATTTCTGCTGAAGGATCATTTATCTTTCACTGCGGAGAAG (SEQ IDNO.28); SCAS4(OCA5)-F:CTTCAGCAGAAATTTCACGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO. 29); SCAS4-R: CACTATTCTCAGAATGACTTGGTTGAGTAC (SEQ ID NO. 30).

[0065] (3) The amplified fragments are linked into a ring using Gibson.

[0066] (4) The constructed donor DNA and Cas9 plasmid were transferred into Saccharomyces cerevisiae using the lithium acetate conversion method. The specific construction process was the same as in Example 1, and the results were obtained. Figure 4 Knockout strain ZQH09.

[0067] Parameter verification of the Crabtree effect: The Crabtree effect is mainly manifested as ethanol accumulation (positively correlated with the effect intensity), accompanied by glycerol accumulation and NADH / NAD ratio changes. + The ratio increased.

[0068] Experiment 2: The accumulation of ethanol and glycerol, as well as the NADH / NAD ratio, were investigated by examining the *Saccharomyces cerevisiae* strain ZQH08 from Example 1 and the *Saccharomyces cerevisiae* strain ZQH09 from Example 2, respectively. + The ratio.

[0069] Methods for determining ethanol and glycerol content: The strain was transferred to a 250 ml Erlenmeyer flask containing 25 ml of ethanol and fermented at 30°C and 220 rpm for 3 days. Intermediate samples were taken and the ethanol and glycerol content in the fermentation broth was determined by HPLC. High-performance liquid chromatography (HPLC) was performed using Shimadzu LC. 20A) Using HPX 87H (Bio Ethanol and glycerol concentrations were detected using a RADI-10A detector and a 2D column. 1 mL of fermentation broth was filtered through a 0.22 μm pore size aqueous filter into a liquid chromatography vial as the sample. The mobile phase was 0.5 mM H₂SO₄, the flow rate was 0.6 mL / min, and the column temperature was set to 45 °C.

[0070] NADH / NAD + Methods for examining the ratio: cell culture to OD 600 =1. Then, centrifuge the cells and wash twice with distilled water. Next, add 200 μL of lysis buffer and 0.5 mm glass beads, mix, and vortex for 5 minutes to lyse the cells. Centrifuge the sample at 12000 rpm at 4°C for 5 minutes, and collect the supernatant as the test sample. To determine the NAD content in the sample... + To determine the total amount of NADH, 20 μL of the test sample was added to each well of a 96-well shallow-pan plate, along with 90 μL of alcohol dehydrogenase working solution. The plate was incubated at 37°C in the dark for 10 min. Then, 10 μL of the colorimetric reagent was added to each well, thoroughly mixed, and incubated again at 37°C in the dark for 10 min. Absorbance was measured at 450 nm. To detect NADH, the sample was heated in a 60°C water bath for 30 min to decompose NAD. + Then, take 20 μL of sample and repeat the same procedure (all samples were tested three times). Standard curves were prepared using NADH standard solutions at concentrations of 0.25, 0.5, 1, 2, 4, and 8 μM. The results were obtained by analyzing NAD... + NAD is calculated by subtracting the NADH content from the total NADH. + concentration.

[0071] OCA5The accumulation of ethanol and glycerol and the NADH / NAD ratio of the Saccharomyces cerevisiae strain in Example 2. + The results of the ratio examination. As can be seen from the graph: knockout Ornithogalum longebracteatum Later strains showed ethanol accumulation, glycerol synthesis, and NADH / NAD ratio changes. + All decreased, indicating that cellular respiration capacity was enhanced and the Crabtree effect was alleviated.

[0072] Example 3 One of the Saccharomyces cerevisiae strains in this embodiment, ZQH50, is based on the Saccharomyces cerevisiae strain ZQH09 in Example 2, with the insertion of a source... OlRHM-NRS of A. thaliana ,source AtGT of Citrus maxima and origin Cm1,2-RhaT of Tricyrtis hirta Origin ThF3'H of A. thaliana Origin AtCPR of Mentha piperita and origin MpOMT of ADO1, SAH1 Variants; The synthesis of the methyl donor SAM required for NHP synthesis was optimized, including expression TAD1 and ADO1, SAH1 To accelerate SAH degradation, this invention will... TAD1 and XII-1 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. MET6 Site. Optimization of cysteine ​​(Hcys) to accelerate conversion to Met promotes the synthesis of the methyl donor SAM, the operation being performed via expression. MET6 Genes, in this invention MET2 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. X-4 Site. XI-3 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. Figure 5 Site. Its construction method is the same as in Example 1, yielding strain ZQH50.

[0073] OlRHM-NRS The principle of the Saccharomyces cerevisiae strain in Example 3: NHP synthesis requires heterologous genes. AtGT , Cm1,2-RhaT , ThF3'H, AtCPR, MpOMT , Figure 6In this process, naringenin is successively converted into sennae and hesperidin, undergoing two-step glycosylation to form NHP. This invention utilizes free plasmids to express the above genes, but the NHP yield is low. This is because the availability of methyl donors is as crucial as methyltransferase activity in NHP biosynthesis. S S-adenosylmethionine (SAM) serves as a direct methylation donor, and its metabolic regeneration capacity directly determines its production ceiling. However, the methylation process is accompanied by the conversion of SAM to... S -Adenosine homocysteine ​​(SAH), which strongly inhibits methyltransferase (OMT) activity, forming a core bottleneck.

[0074] Figure 7 This diagram illustrates the engineering optimization of SAM (methyl donor) supply. Pink represents SAM precursor supply, blue represents SAM recycling, and green represents SAM synthesis. During the methylation of hesperidin into hesperidin, SAM acts as a methyl donor and is converted into SAH. To overcome limitations, this invention designs a three-pronged systematic optimization strategy for SAM supply: Push (synthesis enhancement): Overexpression of methionine synthase MET6 catalyzes the conversion of homocysteine ​​(Hcys) to methionine, thereby promoting SAM synthesis and increasing donor synthesis throughput; Pull (inhibition relief): Overexpression of SAH hydrolase SAH1 accelerates the degradation of SAH into Hcys and adenosine, eliminating feedback inhibition; Cycle (regeneration enhancement): Overexpression of adenosine kinase ADO1 and adenosine deaminase TAD1 promotes adenosine metabolism to AMP or inosine, and overexpression of acetylserine transferase MET2 promotes Hcys recycling and maintains the SAM cycle, enhancing Hcys supply (targeting the rate-limiting step of cysteine ​​metabolism).

[0075] Experiment 3: Investigate the NHP content of the optimized strain ZQH50 under the sucrose metabolism mode.

[0076] ​ The optimized strain ZQH50 synthesizes NHP under sucrose metabolism mode. As shown in the figure, ZQH50 can synthesize 64.6 mg / L NHP, which is 14.4 times higher than the yield of the strain before optimization; and the accumulation of by-products is extremely low (all below 10 mg / L).

[0077] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.

Claims

1. A brewing yeast, characterized in that, The brewing yeast is based on ZQH01, and an atomized yeast derived from ZQH01 is inserted into the genome of ZQH01. Flavobacterium johnsoniae of FjTAL Origin Arabidopsis thaliana of AtC4H, AtPAL2 and AtATR2 And from yeast CYB5 .

2. The brewing yeast according to claim 1, characterized in that, Insertion of the gene source into the genome of ZQH01 Petroselinum crispum of Pc4CL Origin Sorbus japonica of SjCHS and origin Medicago sativa of MsCHI .

3. The brewing yeast according to claim 2, characterized in that, Through CRISPR / Cas9 OCA5 Genes are knocked out.

4. The brewing yeast according to claim 3, characterized in that, Insertion of source into the genome of ZQH01 Ornithogalum longebracteatum of OlRHM-NRS ,source A. thaliana of AtGT and origin Citrus maxima of Cm1,2-RhaT .

5. The brewing yeast according to claim 4, characterized in that, Insertion of the gene source into the genome of ZQH01 Tricyrtis hirta of ThF3'H Origin A. thaliana of AtCPR and origin Mentha piperita of MpOMT Variants.

6. The brewing yeast according to any one of claims 1 to 5, characterized in that, Will ADO1, SAH1 and TAD1 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. XII-1 Site.

7. The brewing yeast according to any one of claims 1 to 5, characterized in that, Will MET6 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. X-4 Site.

8. The brewing yeast according to any one of claims 1 to 5, characterized in that, Will MET2 Genes were integrated into the *Saccharomyces cerevisiae* genome via overexpression using an endogenous strong promoter and a CRISPR / Cas9 system. XI-3 Site.

9. A method for efficiently synthesizing neohesperidin from sucrose using *Saccharomyces cerevisiae* as described in any one of claims 1 to 8, characterized in that, The method includes: fermenting the brewing yeast in YPD medium using sucrose as the sole carbon source to obtain a fermentation broth.

Images